Ameliorative Effect of Sipunculus nudus Hydrolysate on Cisplatin-Induced Nephrotoxicity by Mitigating Oxidative Stress, Inflammation and Apoptosis
Abstract
1. Introduction
2. Results
2.1. Amino Acid Composition of UFSH
2.2. Molecular Weight Distribution
2.3. Peptide Sequence Identification of UFSH
2.4. UFSH Attenuated Cisplatin-Induced Renal Dysfunction in Mice
2.5. UFSH Attenuated Renal Histopathological Changes in Mice
2.6. UFSH Attenuated Renal Fibrosis Changes in Mice
2.7. UFSH Inhibited the Expression of Renal KIM-1 in Renal
2.8. UFSH Attenuated Cisplatin-Induced Inflammation
2.9. UFSH Reduced Cisplatin-Induced Oxidative Stress
2.10. Effects of UFSH on MAPK and NF-κB Pathways in Cisplatin-Induced Renal Injury
2.11. UFSH Attenuated Cisplatin-Induced Apoptosis
3. Discussion
4. Materials and Methods
4.1. Preparation of Ultrafiltration Components Extracted by Enzymatic Hydrolysis of Sipunculus nudus
4.2. Amino Acid Composition Analysis
4.3. Determination of Molecular Weight Distribution
4.4. Identification of Peptides in UFSH Using LC-MS/MS
4.5. Animal Models and Treatment
4.6. Renal Function Test
4.7. Histological Examination
4.8. Immunohistochemical Stainning
4.9. Enzyme-Linked Immunosorbent Assay
4.10. Determination of SOD, GSH-Px and MDA in Renal Tissue
4.11. Western Blotting
4.12. Real-Time PCR
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Arany, I.; Safirstein, R.L. Cisplatin nephrotoxicity. Semin. Nephrol. 2003, 23, 460–464. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, K.; Saito, Y.; Yamaguchi, A.; Narumi, K.; Kobayashi, M. Relationship between magnesium dosage and the preventive effect on cisplatin-induced nephrotoxicity: Meta-analysis and meta-regression analysis. Int. J. Clin. Oncol. 2024, 29, 1817–1824. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Ma, H.; Shao, J.; Wu, J.; Zhou, L.; Zhang, Z.; Wang, Y.; Huang, Z.; Ren, J.; Liu, S.; et al. A Role for Tubular Necroptosis in Cisplatin-Induced AKI. J. Am. Soc. Nephrol. 2015, 26, 2647–2658. [Google Scholar] [CrossRef]
- Pabla, N.; Dong, Z. Cisplatin nephrotoxicity: Mechanisms and renoprotective strategies. Kidney Int. 2008, 73, 994–1007. [Google Scholar] [CrossRef]
- Ferenbach, D.A.; Bonventre, J.V. Mechanisms of maladaptive repair after AKI leading to accelerated kidney ageing and CKD. Nat. Rev. Nephrol. 2015, 11, 264–276. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.; Yamabe, N.; Lee, H.; Lim Lee, H.; Kim, D.W.; Wook Lee, J.; Sung Kang, K. Necrostatins regulate apoptosis, necroptosis, and inflammation in cisplatin-induced nephrotoxicity in LLC-PK1 cells. Bioorg. Med. Chem. Lett. 2021, 48, 128256. [Google Scholar] [CrossRef] [PubMed]
- Fang, C.Y.; Lou, D.Y.; Zhou, L.Q.; Wang, J.C.; Yang, B.; He, Q.J.; Wang, J.J.; Weng, Q.J. Natural products: Potential treatments for cisplatin-induced nephrotoxicity. Acta Pharmacol. Sin. 2021, 42, 1951–1969. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.P.; Tadagavadi, R.K.; Ramesh, G.; Reeves, W.B. Mechanisms of Cisplatin nephrotoxicity. Toxins 2010, 2, 2490–2518. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Yan, M.H.; Liu, Y.; Liu, Z.; Wang, Z.; Chen, C.; Zhang, J.; Sun, Y.S. Ginsenoside Rg5 Ameliorates Cisplatin-Induced Nephrotoxicity in Mice through Inhibition of Inflammation, Oxidative Stress, and Apoptosis. Nutrients 2016, 8, 566. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.U.; Kweon, B.; Oh, J.Y.; Seo, C.S.; Kim, D.G.; Kim, H.Y.; Lee, H.S.; Park, S.J.; Bae, G.S. Ojeoksan Ameliorates Cisplatin-Induced Acute Kidney Injury in Mice by Downregulating MAPK and NF-kappaB Pathways. Int. J. Mol. Sci. 2022, 23, 12254. [Google Scholar] [CrossRef]
- Song, W.H.; Kim, H.Y.; Lim, Y.S.; Hwang, S.Y.; Lee, C.; Lee, D.Y.; Moon, Y.; Song, Y.J.; Yoon, S. Fish Collagen Peptides Protect against Cisplatin-Induced Cytotoxicity and Oxidative Injury by Inhibiting MAPK Signaling Pathways in Mouse Thymic Epithelial Cells. Mar. Drugs 2022, 20, 232. [Google Scholar] [CrossRef] [PubMed]
- Hidayat, M.; Prahastuti, S.; Riany, D.U.; Soemardji, A.A.; Suliska, N.; Garmana, A.N.; Assiddiq, B.F.; Hasan, K. Kidney therapeutic potential of peptides derived from the bromelain hydrolysis of green peas protein. Iran. J. Basic Med. Sci. 2019, 22, 1016–1025. [Google Scholar] [CrossRef]
- Zhang, C.X.; Dai, Z.R.; Cai, Q.X. Anti-inflammatory and anti-nociceptive activities of Sipunculus nudus L. extract. J. Ethnopharmacol. 2011, 137, 1177–1182. [Google Scholar] [CrossRef]
- Jiang, S.; Shen, X.; Liu, Y.; He, Y.; Jiang, D.; Chen, W. Radioprotective effects of Sipunculus nudus L. polysaccharide combined with WR-2721, rhIL-11 and rhG-CSF on radiation-injured mice. J. Radiat. Res. 2015, 56, 515–522. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.X.; Dai, Z.R. Anti-hypoxia activity of a polysaccharide extracted from the Sipunculus nudus L. Int. J. Biol. Macromol. 2011, 49, 523–526. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Liao, D.; Su, Y.; Liu, S.; Jiang, L.; Wu, J.; Liu, Z.; Wu, Y. Novel polysaccharide extracted from Sipunculus nudus inhibits HepG2 tumour growth in vivo by enhancing immune function and inducing tumour cell apoptosis. J. Cell. Mol. Med. 2021, 25, 8338–8351. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Zheng, Z.; Yuan, J.; Zhang, C.; Cao, W.; Qin, X. Collagen Peptides Derived from Sipunculus nudus Accelerate Wound Healing. Molecules 2021, 26, 1385. [Google Scholar] [CrossRef]
- Zhang, C.X.; Dai, Z.R. Immunomodulatory activities on macrophage of a polysaccharide from Sipunculus nudus L. Food Chem. Toxicol. 2011, 49, 2961–2967. [Google Scholar] [CrossRef] [PubMed]
- Hou, T.; Wang, C.; Ma, Z.; Shi, W.; Weiwei, L.; He, H. Desalted Duck Egg White Peptides: Promotion of Calcium Uptake and Structure Characterization. J. Agric. Food Chem. 2015, 63, 8170–8176. [Google Scholar] [CrossRef] [PubMed]
- Sharp, C.N.; Siskind, L.J. Developing better mouse models to study cisplatin-induced kidney injury. Am. J. Physiol. Renal Physiol. 2017, 313, F835–F841. [Google Scholar] [CrossRef]
- Yang, C.; Guo, Y.; Huang, T.S.; Zhao, J.; Huang, X.J.; Tang, H.X.; An, N.; Pan, Q.; Xu, Y.Z.; Liu, H.F. Asiatic acid protects against cisplatin-induced acute kidney injury via anti-apoptosis and anti-inflammation. Biomed. Pharmacother. 2018, 107, 1354–1362. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Wei, W.; Li, Y.; Huang, J.; Ci, X. Hesperetin relieves cisplatin-induced acute kidney injury by mitigating oxidative stress, inflammation and apoptosis. Chem. Biol. Interact. 2019, 308, 269–278. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Yao, Y.; Huang, H.; Hao, H.; Ying, M. Xanthohumol attenuates cisplatin-induced nephrotoxicity through inhibiting NF-kappaB and activating Nrf2 signaling pathways. Int. Immunopharmacol. 2018, 61, 277–282. [Google Scholar] [CrossRef]
- Lin, W.H.; Jiang, W.P.; Chen, C.C.; Lee, L.Y.; Tsai, Y.S.; Chien, L.H.; Chou, Y.N.; Deng, J.S.; Huang, G.J. Renoprotective Effect of Pediococcus acidilactici GKA4 on Cisplatin-Induced Acute Kidney Injury by Mitigating Inflammation and Oxidative Stress and Regulating the MAPK, AMPK/SIRT1/NF-kappaB, and PI3K/AKT Pathways. Nutrients 2022, 14, 2877. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Cai, J.; Li, F.; Liu, Z.; Shu, S.; Wang, Y.; Liu, Y.; Tang, C.; Dong, Z. Chronic effects of repeated low-dose cisplatin treatment in mouse kidneys and renal tubular cells. Am. J. Physiol. Renal Physiol. 2019, 317, F1582–F1592. [Google Scholar] [CrossRef]
- Yucetas, C.S.; Ucler, N.; Cakir, T. The Effects of Agomelatine on The Biochemical and Pathological Features of Cisplatin-Induced Peripheral Neuropathy: The First Experimental Study in Rats. Turk. Neurosurg. 2019, 29, 901–908. [Google Scholar] [CrossRef] [PubMed]
- Statlender, L.; Shochat, T.; Robinson, E.; Fishman, G.; Hellerman-Itzhaki, M.; Bendavid, I.; Singer, P.; Kagan, I. Urea to creatinine ratio as a predictor of persistent critical illness. J. Crit. Care 2024, 83, 154834. [Google Scholar] [CrossRef] [PubMed]
- Ostermann, M.; Legrand, M.; Meersch, M.; Srisawat, N.; Zarbock, A.; Kellum, J.A. Biomarkers in acute kidney injury. Ann. Intensive Care 2024, 14, 145. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [PubMed]
- Gawel, S.; Wardas, M.; Niedworok, E.; Wardas, P. Malondialdehyde (MDA) as a lipid peroxidation marker. Wiad. Lek. 2004, 57, 453–455. [Google Scholar] [PubMed]
- Kishi, S.; Nagasu, H.; Kidokoro, K.; Kashihara, N. Oxidative stress and the role of redox signalling in chronic kidney disease. Nat. Rev. Nephrol. 2024, 20, 101–119. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Xie, K.; Wang, L.; Zheng, N.; Yu, X. Roles of Inflammasomes in Inflammatory Kidney Diseases. Mediat. Inflamm. 2019, 2019, 2923072. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Liu, T.; Langford, P.; Hua, K.; Zhou, S.; Zhai, Y.; Xiao, H.; Luo, R.; Bi, D.; Jin, H.; et al. Haemophilus parasuis induces activation of NF-kappaB and MAP kinase signaling pathways mediated by toll-like receptors. Mol. Immunol. 2015, 65, 360–366. [Google Scholar] [CrossRef]
- Kim, B.W.; More, S.V.; Yun, Y.S.; Ko, H.M.; Kwak, J.H.; Lee, H.; Suk, K.; Kim, I.S.; Choi, D.K. A novel synthetic compound MCAP suppresses LPS-induced murine microglial activation in vitro via inhibiting NF-kB and p38 MAPK pathways. Acta Pharmacol. Sin. 2016, 37, 334–343. [Google Scholar] [CrossRef] [PubMed]
- Ramesh, G.; Reeves, W.B. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J. Clin. Investig. 2002, 110, 835–842. [Google Scholar] [CrossRef] [PubMed]
- Fadeel, B.; Orrenius, S. Apoptosis: A basic biological phenomenon with wide-ranging implications in human disease. J. Intern. Med. 2005, 258, 479–517. [Google Scholar] [CrossRef]
- Loren, P.; Lugones, Y.; Saavedra, N.; Saavedra, K.; Paez, I.; Rodriguez, N.; Moriel, P.; Salazar, L.A. MicroRNAs Involved in Intrinsic Apoptotic Pathway During Cisplatin-Induced Nephrotoxicity: Potential Use of Natural Products Against DDP-Induced Apoptosis. Biomolecules 2022, 12, 1206. [Google Scholar] [CrossRef] [PubMed]
- Popgeorgiev, N.; Sa, J.D.; Jabbour, L.; Banjara, S.; Nguyen, T.T.M.; Akhavan, E.S.A.; Gadet, R.; Ralchev, N.; Manon, S.; Hinds, M.G.; et al. Ancient and conserved functional interplay between Bcl-2 family proteins in the mitochondrial pathway of apoptosis. Sci. Adv. 2020, 6, eabc4149. [Google Scholar] [CrossRef]
- Wang, Q.; Zhang, L.; Yuan, X.; Ou, Y.; Zhu, X.; Cheng, Z.; Zhang, P.; Wu, X.; Meng, Y.; Zhang, L. The Relationship between the Bcl-2/Bax Proteins and the Mitochondria-Mediated Apoptosis Pathway in the Differentiation of Adipose-Derived Stromal Cells into Neurons. PLoS ONE 2016, 11, e0163327. [Google Scholar] [CrossRef] [PubMed]
- Peng, Z.; Gao, J.; Su, W.; Cao, W.; Zhu, G.; Qin, X.; Zhang, C.; Qi, Y. Purification and Identification of Peptides from Oyster (Crassostrea hongkongensis) Protein Enzymatic Hydrolysates and Their Anti-Skin Photoaging Effects on UVB-Irradiated HaCaT Cells. Mar. Drugs 2022, 20, 749. [Google Scholar] [CrossRef]
- Yu, X.; Meng, X.; Xu, M.; Zhang, X.; Zhang, Y.; Ding, G.; Huang, S.; Zhang, A.; Jia, Z. Celastrol ameliorates cisplatin nephrotoxicity by inhibiting NF-kappaB and improving mitochondrial function. eBioMedicine 2018, 36, 266–280. [Google Scholar] [CrossRef] [PubMed]
Amino Acids | Hydrolyzed Amino Acids (g/100 g) | Amino Acids | Hydrolyzed Amino Acids (g/100 g) |
---|---|---|---|
Arginine (Arg) | 3.94 | Leucine (Leu) * | 2.33 |
Lysine (Lys) * | 1.15 | Methionine (Met) * | 0.58 |
Alanine (Ala) | 3.22 | Histidine (His) | 0.56 |
Threonine (Thr) * | 1.10 | Phenylalanine (Phe) | 1.21 |
Glycine (Gly) | 1.96 | Glutamic (Glu) | 1.71 |
Valine (Val) * | 1.80 | Aspartic (Asp) | 2.08 |
Serine + Proline (Ser + Pro) | 0.90 | Cysteine (Cys) | 0.10 |
Isoleucine (Iso) * | 1.67 | Tyrosine (Tyr) * | 1.17 |
Total | 25.49 |
No. | Peptide Sequence | Length | Mass | Contents (%) |
---|---|---|---|---|
1 | FIIDDKGNLR | 10 | 1189.65 | 5.44 |
2 | FRCPEAL | 7 | 891.43 | 2.18 |
3 | VGGLDERR | 8 | 900.48 | 2.06 |
4 | IIAPPER | 7 | 794.47 | 1.90 |
5 | EYDESGPSIV | 11 | 1231.54 | 1.77 |
6 | SIQEDIKSR | 9 | 1074.57 | 1.51 |
7 | RELPGHT | 7 | 808.42 | 1.45 |
8 | KCDVDIR | 7 | 904.44 | 1.41 |
9 | ITKPAPQ | 7 | 753.44 | 1.38 |
10 | RVAPEEHP | 8 | 933.47 | 1.28 |
11 | IIAPPERK | 8 | 922.56 | 1.12 |
12 | ILGPGGK | 8 | 640.39 | 1.08 |
Gene | Primary Sequence (5′→3′) |
---|---|
Mouse TNF-α | F: CATCTTCTCAAAATTCGAGTGACAA |
R: TGGGAGTAGACAAGGTACAACCC | |
Mouse IL-6 | F: ACAAAGCCAGAGTCCTTCAGAGAG |
R: TTGGATGGTCTTGGTCCTTAGCCA | |
Mouse COX-2 | F: AGGACTCTGCTCACGAAGGA R: TGACATGGATTGGAACAGCA |
Mouse KIM-1 | F: ACATATCGTGGAATCACAACGAC R: ACTGCTCTTCTGATAGGTGACA |
Mouse BAX | F: TGGAGATGAACTGGACAGCAATAT R: GCAAAGTAGAAGAGGGCAACCAC |
Mouse GAPDH | F: GTCTTCACTACCATGGAGAAGG R: TCATGGATGACCTTGGCCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tao, S.; Qi, Y.; Gao, J.; Yuan, H.; Wang, R.; Shen, X.; Wei, G.; Peng, Z. Ameliorative Effect of Sipunculus nudus Hydrolysate on Cisplatin-Induced Nephrotoxicity by Mitigating Oxidative Stress, Inflammation and Apoptosis. Mar. Drugs 2025, 23, 100. https://doi.org/10.3390/md23030100
Tao S, Qi Y, Gao J, Yuan H, Wang R, Shen X, Wei G, Peng Z. Ameliorative Effect of Sipunculus nudus Hydrolysate on Cisplatin-Induced Nephrotoxicity by Mitigating Oxidative Stress, Inflammation and Apoptosis. Marine Drugs. 2025; 23(3):100. https://doi.org/10.3390/md23030100
Chicago/Turabian StyleTao, Susu, Yi Qi, Jialong Gao, Huafang Yuan, Ruimin Wang, Xiaoqin Shen, Gang Wei, and Zhilan Peng. 2025. "Ameliorative Effect of Sipunculus nudus Hydrolysate on Cisplatin-Induced Nephrotoxicity by Mitigating Oxidative Stress, Inflammation and Apoptosis" Marine Drugs 23, no. 3: 100. https://doi.org/10.3390/md23030100
APA StyleTao, S., Qi, Y., Gao, J., Yuan, H., Wang, R., Shen, X., Wei, G., & Peng, Z. (2025). Ameliorative Effect of Sipunculus nudus Hydrolysate on Cisplatin-Induced Nephrotoxicity by Mitigating Oxidative Stress, Inflammation and Apoptosis. Marine Drugs, 23(3), 100. https://doi.org/10.3390/md23030100