Next Article in Journal
Drivers of Foliar Fungal Endophytic Communities of Kudzu (Pueraria montana var. lobata) in the Southeast United States
Next Article in Special Issue
Glassfrogs of Ecuador: Diversity, Evolution, and Conservation
Previous Article in Journal
Morphological Convergence and Divergence in Galaxias Fishes in Lentic and Lotic Habitats
Previous Article in Special Issue
Impact of Habitat Loss and Mining on the Distribution of Endemic Species of Amphibians and Reptiles in Mexico
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A New Genus of Terrestrial-Breeding Frogs (Holoadeninae, Strabomantidae, Terrarana) from Southern Peru

1
Department of Biological Sciences, Florida International University, Miami, FL 33199, USA
2
Museo de Biodiversidad del Perú, Cusco 08000, Peru
3
Museo de Historia Natural de la Universidad Nacional de San Antonio Abad del Cusco, Cusco 08000, Peru
4
Department of Biology, Illinois Wesleyan University, Bloomington, IL 61701, USA
5
Biology Program, California State University Channel Islands, Camarillo, CA 93012, USA
*
Author to whom correspondence should be addressed.
Diversity 2020, 12(5), 184; https://doi.org/10.3390/d12050184
Submission received: 7 April 2020 / Revised: 1 May 2020 / Accepted: 6 May 2020 / Published: 8 May 2020
(This article belongs to the Special Issue Systematics and Conservation of Neotropical Amphibians and Reptiles)

Abstract

We propose to erect a new genus of terrestrial-breeding frogs of the Terrarana clade to accommodate three species from the Province La Convención, Department of Cusco, Peru previously assigned to Bryophryne: B. flammiventris, B. gymnotis, and B. mancoinca. We examined types and specimens of most species, reviewed morphological and bioacoustic characteristics, and performed molecular analyses on the largest phylogeny of Bryophryne species to date. We performed phylogenetic analysis of a dataset of concatenated sequences from fragments of the 16S rRNA and 12S rRNA genes, the protein-coding gene cytochrome c oxidase subunit I (COI), the nuclear protein-coding gene recombination-activating protein 1 (RAG1), and the tyrosinase precursor (Tyr). The three species are immediately distinguishable from all other species of Bryophryne by the presence of a tympanic membrane and annulus, and by males having median subgular vocal sacs and emitting advertisement calls. Our molecular phylogeny confirms that the three species belong to a new, distinct clade, which we name Qosqophryne, and that they are reciprocally monophyletic with species of Microkayla. These two genera (Qosqophryne and Microkayla) are more closely related to species of Noblella and Psychrophrynella than to species of Bryophryne. Although there are no known morphological synapomorphies for either Microkayla or Qosqophryne, the high endemism of their species, and the disjoint geographic distribution of the two genera, with a gap region of ~310 km by airline where both genera are absent, provide further support for Qosqophryne having long diverged from Microkayla. The exploration of high elevation moss and leaf litter habitats in the tropical Andes will contribute to increase knowledge of the diversity and phylogenetic relationships within Terrarana.

Graphical Abstract

1. Introduction

Terrestrial-breeding frogs of the high Andes display an impressive degree of evolutionary convergence [1,2,3,4]. Such convergence is associated with life in the cloud forest and high-Andean grassland. Frogs in many genera of Terrarana have evolved strikingly similar body forms [4,5], typically a small, compact body with very short legs and feet, short arms and hands, loss of toe pads and discs, head wider than long, small eyes directed anterolaterally, and, in many groups, reduction or loss of tympanic structure and function [3]. The high similarity of body forms has delayed obtaining a taxonomic arrangement that reflects the evolutionary history and phylogenetic relationships of most species of small, terrestrial-breeding frogs of the Andes [1,6,7].
Illustrating the complexity within Terrarana of identifying monophyletic groups in presence of ecological convergence, authors originally assigned frogs belonging to different evolutionary lineages to the genus Phrynopus [1,8,9]. Indeed, Phrynopus might still contain incorrectly classified species of Pristimantis that lack vocal sacs, external tympanic apparatus and toe pads [10]. Subsequent molecular analyses revealed a much greater diversity and deeper genetic structure, such that Hedges et al. [1] proposed to split Phrynopus into four genera, and to erect the new subfamily Holoadeninae to include the newly described genera Bryophryne, Niceforonia, and Psychrophrynella. Within Holoadeninae, the molecular phylogeny by Hedges et al. [1] recognized Bryophryne as a distinct clade on the basis of DNA sequences from a single species, B. cophites (formerly Phrynopus cophites Lynch, 1975). Hedges et al. [1] used morphological characters to assign to Bryophryne a second species, Phrynopus bustamantei Chaparro, De la Riva, Padial, Ochoa, and Lehr, 2007. The new genus Byrophryne, along with the other genera of Holoadeninae, was recognized using molecular data, despite the lack of morphological synapomorphies [1,2,5,11].
Since Hedges et al. [1] published their molecular phylogeny, researchers have continued discovering terrestrial-breeding frogs: the number of species of Bryophryne has increased from two to 14 species [12,13,14,15,16,17], and the number of species across all Holoadeninae genera from 36 to 151 species [8]. As far as we know, all species of Bryophryne have micro-endemic distribution, and are only known to occur at their respective type localities and immediate surroundings [2,12,14,15,16,18]. The most recent phylogeny included six of the 14 species of Bryophryne, and recovered Bryophryne as being the sister taxon to the clade containing Barycholos, “Eleutherodactylus bilineatus”, Euparkerella, Holoaden, and Noblella [2]. However, this phylogeny by De la Riva et al. [2] did not include sequences of the three species of Bryophryne having an external tympanum and males with subgular vocal sacs, because sequences were unavailable at the time. Additionally, De la Riva et al. [2] erected a new genus, Microkayla, to accommodate all species of Psychrophrynella from Bolivia (and one species of Psychrophrynella from Peru), as well as two new species from Peru. Because of these discoveries, the integration of molecular, acoustic and morphological approaches, and the ongoing revision of existing and new material, we have a better understanding of the diversity in this group of cryptic genera. As part of our ongoing work, we have become aware of (1) uncertainty regarding the evolutionary relationships of Noblella and Psychrophrynella [2,19,20], (2) an underestimated species richness and endemism in Noblella and Psychrophrynella [19,20,21,22], and (3) three species of Bryophryne (B. flammiventris, B. gymnotis, B. mancoinca; Figure 1) having traits not shared with any other species of Bryophryne, such as having an external tympanum and males with subgular vocal sacs and emitting advertisement calls. Here we address the latter of these findings, and propose a new genus for the only three species of Bryophryne known to produce vocalizations and possessing external tympanic membrane and annulus.

2. Materials and Methods

We are familiar with most described species of Bryophryne, which we have seen in the field or inspected in collections. We provide a complete list of examined specimens in Appendix A. We used the literature (i.e., original species descriptions) for species whose specimens we could not examine. We have described the advertisement calls of B. gymnotis and B. mancoinca [14,17], and have heard and provided a short description of the call of B. flammiventris [15]. We refer readers to the original publications for details on recording methods.
We combined DNA sequences available from GenBank with sequences from newly collected tissues to generate molecular phylogenies of Bryophryne and closely related Holoadeninae taxa (Table 1). We considered sequences for a fragment of the 16S rRNA gene (16S), a fragment of the 12S rRNA gene (12S), the protein-coding gene cytochrome c oxidase subunit I (COI), the nuclear protein-coding gene recombination-activating protein 1 (RAG1), and the tyrosinase precursor (Tyr). All taxa selected for our comparisons belong to the subfamily Holoadeninae [1,23,24].

2.1. Laboratory Work

We followed protocols of extraction, amplification, and sequencing of DNA previously used for terrestrial-breeding frogs [1,20,22]. For the focal taxa (the three species members of the new genus), we extracted DNA from tissue samples obtained from six specimens collected in the field (two specimens per species). We also obtained DNA sequences from seven specimens in five other species of Bryophryne, and two specimens representing two species in other genera (Noblella and Psychrophrynella), and the remaining sequences are legacy data from GenBank.
We extracted DNA from liver tissue preserved in 70% ethanol by using a commercial extraction kit (IBI Scientific, Dubuque, IA, USA). We used selected primers (Table 2) to amplify DNA from each gene using the polymerase chain reaction (PCR) [22,32]. We obtained sequence data by running purified PCR products in an ABI 3730 Sequence Analyzer (Applied Biosystems), except sequences of B. mancoinca and B. phuyuhampatu, which we shipped to MCLAB (San Francisco, CA) for sequencing. We deposited all new sequences in GenBank (Table 1). We provide updated names of 86 terminals included in the analysis for 314 GenBank sequences.

2.2. Molecular Phylogenetic Analyses

We inferred the phylogenetic relationships among taxa through analysis of concatenated DNA sequences of the five gene fragments (16S, 12S, COI, RAG1, Tyr). We used Niceforonia dolops to root the tree. We aligned sequences with Geneious R6, v. 6.1.8 (Biomatters 2013), using the built-in Geneious Aligner program. We then used PartitionFinder, v. 1.1.1 [36] to select the best partitioning scheme and substitution model for each gene using the Bayesian information criterion (BIC). The best partitioning scheme included the following six subsets (best fitting substitution models are in parentheses): partition subset 1 includes 12S and 16S sequences (GTR + I + G), partition 2 is the first codon position of COI (SYM + G), partition 3 is the second codon position of COI (F81), partition 4 is the third codon position of COI (HKY + G), partition 5 includes the first and second codon positions of RAG together with the first and second codon positions of Tyr (HKY + I + G), and partition 6 includes the third codon position of RAG together with the third codon position of Tyr (K80 + G).
We used MrBayes, v. 3.2.0 [37] to infer a molecular phylogeny for the 106 terminals and 2632 bp concatenated partitioned dataset (16S, 12S, COI, RAG1, Tyr). We performed an MCMC Bayesian analysis that included two simultaneous runs of 10 million generations, sampled once every 1000 generations. Each run had one “cold” chain and three heated chains, and the burn-in was set to discard 25% samples from the cold chain. Upon completion of the MCMC Bayesian analysis, the average standard deviation of split frequencies was 0.003916. We used Tracer version 1.5 [38] to examine the effective sample sizes (ESS), to verify convergence, and to verify that the runs reached stationarity. The observed effective sample sizes were satisfactory for all parameters (ESS > 200). Lastly, we used FigTree v. 1.4.2 [39] to visualize the majority-rule consensus tree and assess node support (based on posterior probability values).
Our research was approved by the Institutional Animal Care and Use Committee of Florida International University (18-009). The Dirección General Forestal y de Fauna Silvestre, Ministerio de Agricultura y Riego issued the permit authorizing this research (collecting permits #292-2014-MINAGRI-DGFFS-DGEFFS, SERNANP-Machu Picchu 054-2012-SERNANP-JEF, Contrato de Acceso Marco a Recursos Genéticos, No 359-2013-MINAGRI-DGFFS-DGEFFS).
The electronic version of this article in portable document format will represent a published work according to the International Commission on Zoological Nomenclature (ICZN), and hence the new names contained in the electronic version are effectively published under that Code from the electronic edition alone. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) and the associated information can be viewed through any standard web browser at http://zoobank.org/urn:lsid:zoobank.org:pub:0B8FFBEE-96AA-46E1-BA6F-541DC9FA73BF.

3. Results

We recovered a phylogenetic tree (Figure 2) that was largely congruent with previous analyses [2,24]. However, our tree recovered three species of Bryophryne not previously included in phylogenetic analyses (B. gymnotis, B. flammiventris, and B. mancoinca) as a clade that is sister to the clade containing all species of Microkayla. Thus, species of Microkayla, instead of other species of Byrophryne, share the most common shared ancestor with B. gymnotis, B. flammiventris, and B. mancoinca. The presence of large, external tympanic membrane and annulus, and males with a median subgular vocal sac and production of vocalizations, immediately distinguishes the newly recognized genus from all other species of Bryophryne. At least four species of Bryophryne were described as having small, barely visible (under the skin surface) tympanic membranes and annuli (B. bustamantei, B. quellokunka, B. tocra, B. wilakunka), but their external appearance does not look that different from the other species of Bryophryne known to lack a visible tympanic membrane [2,14,18]. One of these species, B. bustamantei was described as producing a short whistle, but there is no recording of the call nor voucher associated with a call [18]. The distribution range of B. bustamantei overlaps with that of B. gymnotis in the cloud forest near Abra Málaga [14,18,40], and thus it is possible that the call of B. gymnotis was erroneously associated with males of B. bustamantei. There also seems to be some problems identifying specimens of this species, as shown by our phylogeny where specimens identified as B. bustamantei by one of us do not group with sequences from one of the paratypes of B. bustamantei (MHNC 6019).
We propose to erect the new genus Qosqophryne gen. n. to accommodate Bryophryne gymnotis, B. flammiventris, and B. mancoinca. Several lines of evidence support the idea that Qosqophryne is distinct from its sister genus Microkayla. The molecular phylogeny indicates there is a degree of divergence comparable to that observed between other genera of strabomantid frogs (Figure 2). Our molecular analyses show strong support for the divergence of Microkayla and Qosqophryne gen. n. The lack of geographic overlap between the two genera, with a gap region of ~320 km by airline where both genera are absent, further supports this divergence by preventing recent gene flow among species of both genera (Figure 3). Furthermore, several glaciated peaks, including the massive Ausangate mountains and associates peaks of the Cordillera de Vilcanota, are interspersed along this gap region of 320 km.
Similarly to recent phylogenies [28,41], we found that Noblella is not monophyletic: the species from southern Peru along with species of Psychrophrynella form a clade that is sister taxon to Microkayla + Qosqophryne, whereas the species of Noblella from northern Peru and Ecuador are closely related to “Eleutherodactylus bilineatus” and Barycholos (Figure 2). Because the type species N. peruviana occurs in southern Peru, and the most similar species sequenced to date N. thiuni is part of the Noblella/Psychrophrynella clade [28], our findings support the hypothesis that Noblella occurs only in southern Peru and northern Bolivia, and that species from northern Peru and Ecuador belong to a different genus [28,41]. Furthermore, our tree suggests that species of Noblella and Psychrophrynella belong to the same lineage, as supported by the respective type genera sharing several morphological traits [2,5,20,28,42]. Therefore, the two possibilities are that some species of Noblella have been misidentified as Psychrophrynella (and vice versa), or that Psychrophrynella is a junior synonym of Noblella. We will not be able to resolve the taxonomic uncertainty associated with Noblella and Psychrophrynella until we obtain DNA sequences from the respective type species N. peruviana and P. bagrecito [2,19,20,28].
Finally, our inferred phylogeny suggests that there are at least seven additional putative new species of Bryophryne, Noblella, and Psychrophrynella (Figure 2), and confirms previous findings of cryptic species diversity particularly in leaf litter, cloud forest frogs in the Noblella/Psychrophrynella clade [22]. These putative new species, similarly to most known species of high-elevation Holoadeninae [4], are highly endemic and known from single localities (or, around those localities, from within a narrow elevational range in the same valley, [22]). Of special interest among the putative new species, Psychrophrynella MUSM 27619 is the first specimen of the Noblella/Psychrophrynella lineage known from the Vilcabamba range.
Taxonomy
Qosqophryne new genus
Type species.Bryophryne gymnotis Lehr and Catenazzi, 2009
Included species.Qosqophryne flammiventris (Lehr and Catenazzi, 2010), comb. nov.; Q. mancoinca (Mamani, Catenazzi, Ttito, Mallqui, Chaparro, 2017), comb. nov.
Diagnosis. (1) Head wider than long, narrower than body, body robust, extremities short; (2) tympanic membrane and annulus present; (3) cranial crests absent; (4) prevomerine teeth and dentigerous process of vomers present (but absent in Q. flammiventris); (5) trips of digits narrow, rounded, circumferential grooves absent, terminal phalanges T-shaped to knobbed; (6) Finger I shorter than Finger II, nuptial pads absent; (7) Toe V shorter than Toe III; (8) fingers and toes with lateral fringes (but absent in Q. flammiventris); (9) subarticular tubercles small, rounded; (10) dorsolateral folds short, discontinuous or continuous; (11) discoidal fold absent (present in Q. mancoinca); (12) trigeminal nerve passing external to m. adductor mandibulae externus (‘S’ condition; Lynch, 1986); (13) snout-vent length from 16.7–19.3 mm in males and 16.0–22.2 mm in females of Q. gymnotis, to 19.6–22.9 mm in males and 23.6–26.5 mm in females of Q. mancoinca; (14) males with median subgular vocal sac and vocal slits, nuptial pads absent; (15) advertisement call whistle-like, composed of a single, tonal note in Q. gymnotis, 2–3 short notes in Q. mancoinca, and 3–4 short notes in Q. flammiventris.
There are no known morphological synapomorphies for Qosqophryne, but the three known species share the following traits (Table 3): (1) males with median subgular vocal sac produce whistle-like tonal calls composed of 1–4 short notes; (2) tongue ovate; (3) skin on venter smooth to weakly areolate (in Q. flammiventris); (4) inner tarsal fold absent. Four other genera of Holadeninae occur south of the Apurimac canyon, a proposed biogeographic barrier for high-elevation terrestrial breeding frogs [13,14,15]. Bryophryne differs from Qosqophryne in lacking an externally visible tympanum, and having males without vocal sac and not emitting vocalizations [2,12,16]. Oreobates have head about the same width as body, smooth venter, subarticular and supernumerary tubercles large, conical or subconical, projecting, and range in snout-vent length from 20–63 mm [1,5]. Noblella and Psychrophrynella have smooth venter, elongated tongue, two prominent metatarsal tubercles, and in most species facial masks and/or a tarsal fold-like, sigmoid tubercle [2,19,20,28]. Qosqophryne is most similar to its sister genus Microkayla. Putative synapomorphies of Microkayla are a rounded tongue, areolate belly, and absence of prominent metatarsal tubercles [2]. It is presumed that all species of Microkayla vocalize, and known calls consist of a simple, short whistle-like tonal note [2,4]. Qosqophryne differs from most Microkayla in having (except for Q. flammiventris) fingers and toes with lateral fringes (absent in Microkayla), and having (except Q. flammiventris) dentigerous processes of vomers (absent in Microkayla). Future examination of osteological characters, for example through computed tomography, might help identify such characters, and resolve the condition of the tympanic apparatus in the three genera Bryophryne, Microkayla and Qosqophryne.
Etymology. The name refers to the city of Cusco, using the spelling Qosqo which more closely reflects the name in Quechua. Qosqo is used in apposition with phryne, from the greek for “frog”. Thus, the name for the new genus alludes to the geographic distribution of the three known species in the Peruvian Department of Cusco.
Distribution, natural history, and conservation. The three species of Qosqophryne occur within a region of ~150 km2 in the upper montane forests and grasslands of the Cordilleras de Urubamba and Cordillera de Vilcabamba, Provincia La Convención, Department Cusco, Peru. These frogs inhabit cloud forests, elfin forests, montane scrub and humid grasslands (puna) from 3270 to 3800 m a.s.l. Similar to other regions in the high Andes, these habitats and their amphibian communities are threatened by pasture burning, climate change and associated expansion of agricultural activities, deforestation, and the fungal disease chytridiomycosis [43,44]. Although chytridiomycosis has caused the collapse of montane frog communities at several sites in Departamento Cusco [45,46], terrestrial-breeding frogs have generally declined the least, and several species challenged in experimental infection trials appears to resist or tolerate infection [47]. Protection of natural habitats will benefit conservation of these frogs. Two of the three species occur within naturally protected areas: Q. gymnotis within the Área de Conservación Privada Abra Málaga, and Q. mancoinca within Machu Picchu Historic Sanctuary.
Remarks. The new genus is distinguished from all species of Bryophryne by the presence of tympanum and tympanic annulus, and median subgular vocal sacs in males. Furthermore, males of all three species of Qosqophryne are known to emit advertisement calls (unknown in all species of Bryophryne, except possibly for B. bustamantei). We have described the advertisement calls of Q. gymnotis and Q. mancoinca [14,17]. One of us (LM) has recorded the advertisement call of a male Q. flammiventris (MUBI 13365) at the type locality, and this call is composed of 3–4 short notes (~15–35 ms duration) at dominant frequency ~3000 Hz. Females of Q. gymnotis attend clutches of 14–16 eggs [39], but unattended clutches of up to 19 eggs have also been found [14].
The new genus Qosqophryne is supported by our molecular phylogeny, the most complete to date covering three mitochondrial and two nuclear gene fragments, as well as most described species of Bryophryne and Microkayla. Despite the absence of known synapomorphies for the sister clades Microkayla and Qosqophryne, we are confident that our proposed arrangement reflects the evolutionary history of these organisms, and yet still takes into consideration taxonomic stability [48]. There is strong support (bootstrap probabilities) at the node where Microkayla and Qosqophryne diverge, and the relative branch lengths leading to their respective living species is similar, or in some cases exceed the branch lengths separating other genera within Terrarana (e.g., Euparkerella and Holoaden, or Barycholos and the “northern clade” of Noblella).

4. Discussion

Our study integrating molecular, acoustic and morphological information justifies the erection of the new genus of strabomantid frog Qosqophryne. The molecular phylogeny we inferred, the most complete phylogeny to date in terms of terminal sampling for genera of Holoadeninae [2,24], provides strong support for this new genus forming a sister clade to Microkayla. Furthermore, our phylogeny confirms taxonomic uncertainty regarding the genera Noblella and Psychrophrynella [2,19,20], suggests the presence of several undescribed species of Noblella and Psychrophrynella, and generalizes the idea of high species endemism in high elevation Andean strabomantids [2,4,19,20,21,22,49].
Morphological synapomorphies for the new genus Qosqophryne have not been recognized, and there does not appear to be a unique combination of meristic traits to distinguish all species of Microkayla from species of Qosqophryne. However, there are some characteristics that help distinguish the two genera. Some of the traits present in Qosqophryne but absent in Microkayla are fingers and toes with lateral fringes, venter smooth (areolate in Microkayla), and presence of dentigerous processes of vomers (but absent in Q. flammiventris). The structure of the advertisement call, when known, appears to be similar in both genera, i.e., a whistle-like call, but composed of a single note in Microkayla vs. 2–4 notes in Qosqophryne (except for Q. gymnotis). There is limited information on parental care, but it appears that females attend clutches in Q. gymnotis [39], whereas males attend clutches in M. illimani and M. teqta [50,51]. Similarly to Qosqophryne, females attend clutches in B. cophites [52], B. hanssaueri and B. nubilosus (Catenazzi, pers. obs.). However, we lack natural history information from most species of strabomantid frogs, and thus any generalization on parental care is premature.
In support of our proposed new genus, there is a wide gap, both in terms of airline distance and the highly dissected topography, in the distribution range of species of Microkayla and Qosqophryne. These are all highly endemic, terrestrial-breeding frogs most likely characterized by extreme low vagility, as suggested by their patchy distribution in cloud forests and grasslands. All species of Microkayla occur from extreme southern Peru (Department Puno) to the western limits of department Santa Cruz in central Bolivia (Serranía Siberia), whereas the three species of Qosqophryne occur in the Vilcabamba mountain range in the Peruvian Department of Cusco. The gap of 320 km by airline between the southernmost locality of Qosqophryne (Q. gymnotis; −13.07558, −72.38201) and the northernmost locality of Microkayla (M. boettgeri) overlaps with the distribution range of Bryophryne. At the northern limit, B. abramalagae and B. bustamantei are marginally sympatric with Q. gymnotis, whereas at the southern limit, B. wilakunka (Ayapata, Puno, −13.85294, −70.31450) occurs ~80 km NW of the type locality of M. boettgeri (Phara, Puno, −14.16247, −69.66250). Although many species in these genera of Holoadeninae are likely “micro-endemic”, researchers have seldom invested much effort in documenting the distribution ranges of most species, and it is possible that some of these species occur more widely than presently known. Therefore, currently five genera of Holoadeninae occur in the tropical Andes south of the Apurimac canyon in Cusco, Puno and northern Bolivia: Bryophryne, Psychrophrynella and Qosqophryne in the Vilcabamba mountain range; Bryophryne, Noblella and Psychrophrynella in the Vilcanota range; Bryophryne, Microkayala, Noblella and Psychrophrynella in the Carabaya range, and Microkayala south of the Apolobamba range.

Author Contributions

Conceptualization, A.C., L.M., E.L. and R.v.M.; methodology, A.C., L.M., E.L. and R.v.M.; software, A.C. and R.v.M.; validation, A.C., L.M., E.L. and R.v.M.; formal analysis, A.C. and R.v.M.; investigation, A.C., L.M., E.L. and R.v.M.; resources, A.C. and R.v.M.; data curation, A.C., R.v.M.; writing—original draft preparation, A.C.; writing—review and editing, A.C., L.M., E.L. and R.v.M.; visualization, A.C., L.M., E.L. and R.v.M.; supervision, A.C.; project administration, A.C.; funding acquisition, A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Amazon Conservation Association, the Rufford Foundation, the Chicago Board of Trade Endangered Species Fund, and the Amphibian Specialist Group.

Acknowledgments

We thank the staff of the Museo de Biodiversidad del Perú (MUBI) for access to the herpetological collection.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Appendix A. Specimens Examined

Bryophryne abramalagae: PERU: CUSCO: Provincia La Convención: Distrito de Huayopata, Abra de Málaga (13°07′23.8″ S, 72°20′51.2″ W), 4000 m a.s.l., MUSM 27630–32, MTD 47489–91.
Bryophryne bakersfield: PERU: CUSCO: Provincia La Convención: Distrito de Echarate, Roquerío de Lorohuachana, 3620 m a.s.l. (12°29′43.8″ S, 72°04′35.9″ W), MHNC 7972.
Bryophryne bustamantei: PERU: CUSCO: Provincia La Convención: Abra de Málaga: MUSM 24537–38.
Bryophryne cophites: PERU: CUSCO: Provincia de Paucartambo: Distrito Kosñipata: S slope Abra Ac[j]anaco, 14 km NNE Paucartambo, 3400 m a.s.l.: KU 138884 (holotype); N slope Abra Ac[j]anaco, 27 km NNE Paucartambo, 3450 m a.s.l.: KU 138885–908, 138911–5 (all paratypes); 2 km NE of Abra Ac[j]anaco, 3280 m a.s.l.: MHNG 2698.24, 5.5 km N of Abra Acanacu [Acjanaco], 3523 m: MUSM 27895, Tres Cruces, 8.5 km N of Abra Ac[j]anaco, 3590 m a.s.l.: MUSM 20855–56, 26283–84, 26264, 26266–67, 26313, 26315, 27896, 30414–17, Pillco Grande, 3865 m a.s.l., near border of Manu NP: CORBIDI 11919.
Bryophryne flammiventris: PERU: CUSCO: Provincia de La Convención, Distrito de Vilcabamba, road between Vilcabamba and Pampaconas, 3800 m a.s.l.: MUSM 27613 (holotype), MUSM 27612, 27614–15, MTD 46890–92 (paratypes).
Bryophryne gymnotis: PERU: CUSCO: Provincia de La Convención, Distrito de Huayopata: 1 km east of San Luis, 3272–3354 m a.s.l.: MUSM 24543 (holotype), MHNG 2710.28, 2710.29, MTD 46860–64, 47288, 47291–92, 47297, MUSM 24541–42, 24544–45, 24546–56, MVZ 258407–10 (paratypes).
Bryophryne hanssaueri: PERU: CUSCO: Provincia de Paucartambo, Distrito de Kosñipata: Acjanaco, Manu National Park, 3266 m a.s.l.: MUSM 27567 (holotype); from near Acjanaco, Manu National Park, 3280–3430 m a.s.l.: MHNG 2698.25, MTD 46865–66, 46887–89, MUSM 24557, 27568–69, 27607–11, MVZ 258411–13 (all paratypes).
Bryophryne mancoinca: PERU: CUSCO: Provincia de La Convención, Hornopampa sector, near Salkantay Mountain, along the road to the Archeological Complex of Choquequirao, 3707 m a.s.l.: MUBI 11152 (holotype), MUBI 11147–11151, 11153, 11154, 11159, 16068, 16069, 16074, 16083 (paratypes).
Bryophryne nubilosus: PERU: CUSCO: Provincia de Paucartambo: Distrito de Kosñipata, 500 m NE of Esperanza, 2712 m a.s.l.: MUSM 26310 (holotype), MUSM 26311; near the type locality, 13°11′33.21″ S, 71°35′25.17″ W, 3065 m: MTD 47294; near Hito Pillahuata, 2600 m: MUSM 20970; Quebrada Toqoruyoc, 3097 m a.s.l.: MUSM 26312, MTD 47293; Esperanza, 2800 m: MHNSM 26316–17; 13°11′20.2″ S, 71°35′07.3″ W, 2900 m a.s.l.: MUSM 24539–40.
Bryophryne phuyuhampatu: PERU: CUSCO: Provincia de Paucartambo: Distrito de Paucartambo, Quispillomayo valley, Área de Conservación Privada (ACP) Ukumari Llaqta, 2795–2850 m a.s.l., 13°22′12.14″ S; 71°6′49.82″ W (WGS84; type locality), CORBIDI 18224–18226, MUBI 14654 and 14655.
Bryophryne quellokunka: PERU: CUSCO: Provincia de Quispicanchis: Distrito de Marcapata: Coline, 3672 m a.s.l.: MUSM 27571, 27573.
Bryophryne zonalis: PERU: CUSCO: Provincia de Quispicanchis, Distrito de Marcapata, Kusillochayoc at 3129 m a.s.l.: MUSM 27570 (holotype), MTD 46867, 46869–70, MUSM 27572, 27574–75, 27861, MVZ 258414 (paratypes); at Puente Coline, 3285 m a.s.l.: MVZ 258415 (paratype).
Microkayla boettgeri: PERU: PUNO: Provincia de Sandia, Distrito de Limbani, Phara, 3466 m a.s.l.: MHNSM 19966 (holotype), MHNSM 19967–76, MTD 46508–9, 46512–19 (paratypes).
Microkayla chapi: PERU: PUNO: Provincia de Sandia, Distrito de Limbani, 3.7 km from Sina, Hirigache River valley, 3466 m a.s.l.: MUBI 5326 (holotype), MUBI 5325, 5327, 5330, 5331, 5328, 5329 (paratypes).
Microkayla chilina: PERU: PUNO: Provincia de Sandia, Distrito de Limbani, 3.7 km from Sina, Hirigache River valley, 3466 m a.s.l.: MUBI 5355 (holotype), MUBI 5350, 5351, 5353, 5354 (paratypes).
Qosqophryne flammiventris: PERU: CUSCO: Provincia de La Convención, Distrito de Vilcabamba, road between Vilcabamba and Pampaconas, 3800 m a.s.l., MUBI 13365.
Qosqophryne gymnotis: PERU: CUSCO: Provincia de La Convención, Distrito de Huayopata: San Luis, MUBI 14315–14319.

References

  1. Hedges, S.B.; Duellman, W.E.; Heinicke, M.P. New World direct-developing frogs (Anura: Terrarana): Molecular phylogeny, classification, biogeography, and conservation. Zootaxa 2008, 1737, 1–182. [Google Scholar] [CrossRef] [Scilit]
  2. De La Riva, I.; Chaparro, J.C.; Castroviejo-Fisher, S.; Padial, J.M. Underestimated anuran radiations in the high Andes: Five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae). Zool. J. Linn. Soc. 2018, 182, 129–172. [Google Scholar] [CrossRef] [Scilit]
  3. von May, R.; Lehr, E.; Rabosky, D.L. Evolutionary radiation of earless frogs in the Andes: Molecular phylogenetics and habitat shifts in high-elevation terrestrial breeding frogs. PeerJ 2018, 6, e4313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. De La Riva, I. Unexpected Beta-Diversity Radiations in Highland Clades of Andean Terraranae. In Neotropical Diversification: Patterns and Processes; Rull, V., Carnaval, A., Eds.; Springer: Cham, Switzerland, 2020. [Google Scholar]
  5. Duellman, W.E.; Lehr, E. Terrestrial-Breeding Frogs (Strabomantidae) in Peru; Natur und Tier Verlag: Münster, Germany, 2009; p. 382. [Google Scholar]
  6. Heinicke, M.P.; Duellman, W.E.; Trueb, L.; Means, D.B.; MacCulloch, R.D.; Hedges, S.B. A new frog family (Anura: Terrarana) from South America and an expanded direct-developing clade revealed by molecular phylogeny. Zootaxa 2009, 2211, 1–35. [Google Scholar] [CrossRef] [Scilit]
  7. Heinicke, M.P.; Lemmon, A.R.; Lemmon, E.M.; McGrath, K.; Hedges, S.B. Phylogenomic support for evolutionary relationships of New World direct-developing frogs (Anura: Terraranae). Mol. Phylogenet. Evol. 2017. [Google Scholar] [CrossRef] [Scilit]
  8. Frost, D.R. Amphibian Species of the World: An Online Reference. Version 6.0. Available online: http://research.amnh.org/herpetology/amphibia/index.html (accessed on 23 October 2019).
  9. Heinicke, M.P.; Duellman, W.E.; Hedges, S.B. Major Caribbean and Central American frog faunas originated by ancient oceanic dispersal. Proc. Natl. Acad. Sci. USA 2007, 104, 10092–10097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Lehr, E.; von May, R. A new species of terrestrial-breeding frog (Amphibia, Craugastoridae, Pristimantis) from high elevations of the Pui Pui Protected Forest in central Peru. ZooKeys 2017, 660, 17–42. [Google Scholar] [CrossRef] [Scilit]
  11. Condori Ccarhuarupay, F.P. Filogenia Morfológica del Género Bryophryne Hedges, 2008 (Anura: Craugastoridae); Universidad Nacional San Antonio Abad del Cusco: Cusco, Peru, 2018. [Google Scholar]
  12. Chaparro, J.C.; Padial, J.M.; Gutierrez, R.C.; De la Riva, I. A new species of Andean frog of the genus Bryophryne from southern Peru (Anura: Craugastoridae) and its phylogenetic position, with notes on the diversity of the genus. Zootaxa 2015, 3994, 94–108. [Google Scholar] [CrossRef] [Scilit]
  13. Lehr, E.; Catenazzi, A. A new species of Bryophryne (Anura: Strabomantidae) from southern Peru. Zootaxa 2008, 1784, 1–10. [Google Scholar] [CrossRef] [Scilit]
  14. Lehr, E.; Catenazzi, A. Three new species of Bryophryne (Anura: Strabomantidae) from the Region of Cusco, Peru. S. Am. J. Herpetol. 2009, 4, 125–138. [Google Scholar] [CrossRef] [Scilit]
  15. Lehr, E.; Catenazzi, A. Two new species of Bryophryne (Anura: Strabomantidae) from high elevations in southern Peru (Region of Cusco). Herpetologica 2010, 66, 308–319. [Google Scholar] [CrossRef] [Scilit]
  16. Catenazzi, A.; Ttito, A.; Diaz, M.I.; Shepack, A. Bryophryne phuyuhampatu sp n. a new species of Cusco Andes frog from the cloud forest of the eastern slopes of the Peruvian Andes (Amphibia, Anura, Craugastoridae). Zookeys 2017, 685, 65–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Mamani, L.; Catenazzi, A.; Ttito, A.; Mallqui, S.; Chaparro, J.C. A new species of Bryophryne (Anura: Strabomantidae) from the Cordillera de Vilcabamba, southeastern Peruvian Andes. Phyllomedusa 2017, 16, 129–141. [Google Scholar] [CrossRef] [Scilit]
  18. Chaparro, J.C.; De la Riva, I.; Padial, J.M.; Ochoa, J.A.; Lehr, E. A new species of Phrynopus from Departamento Cusco, southern Peru (Anura: Brachycephalidae). Zootaxa 2007, 1618, 61–68. [Google Scholar] [CrossRef] [Scilit]
  19. Catenazzi, A.; Ttito, A. A new species of Psychrophrynella (Amphibia, Anura, Craugastoridae) from the humid montane forests of Cusco, eastern slopes of the Peruvian Andes. PeerJ 2016, 4, e1807. [Google Scholar] [CrossRef] [Scilit]
  20. Catenazzi, A.; Ttito, A. Psychrophrynella glauca sp. n. a new species of terrestrial-breeding frogs (Amphibia, Anura, Strabomantidae) from the montane forests of the Amazonian Andes of Puno, Peru. PeerJ 2018, 6, e444. [Google Scholar] [CrossRef] [Scilit]
  21. Catenazzi, A.; Uscapi, V.; von May, R. A new species of Noblella from the humid montane forests of Cusco, Peru. Zookeys 2015, 516, 71–84. [Google Scholar] [CrossRef] [Scilit]
  22. von May, R.; Catenazzi, A.; Corl, A.; Santa-Cruz, R.; Carnaval, A.C.; Moritz, C. Divergence of thermal physiological traits in terrestrial breeding frogs along a tropical elevational gradient. Ecol. Evol. 2017, 7, 3257–3267. [Google Scholar] [CrossRef] [Scilit]
  23. Canedo, C.; Haddad, C.F. Phylogenetic relationships within anuran clade Terrarana, with emphasis on the placement of Brazilian Atlantic rainforest frogs genus Ischnocnema (Anura: Brachycephalidae). Mol. Phylogenet. Evol. 2012, 65, 610–620. [Google Scholar] [CrossRef] [Scilit]
  24. Padial, J.M.; Grant, T.; Frost, D.R. Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria. Zootaxa 2014, 3825, 1–132. [Google Scholar] [CrossRef] [Scilit]
  25. Motta, A.P.; Chaparro, J.C.; Pombal, J.P.; Guayasamin, J.M.; De la Riva, I.; Padial, J.M. Molecular phylogenetics and taxonomy of the Andean genus Lynchius Hedges, Duellman, and Heinicke 2008 (Anura: Craugastoridae). Herpetol. Monogr. 2016, 30, 119–142. [Google Scholar] [CrossRef] [Scilit]
  26. Padial, J.M.; Chaparro, J.C.; Castroviejo-Fisher, S.; Guayasamin, J.M.; Lehr, E.; Delgado, A.J.; Vaira, M.; Teixeira, M., Jr.; Aguay, R.; de la Riva, I. A revision of species diversity in the Neotropical genus Oreobates (Anura: Strabomantidae), with the description of three new species from the Amazonian slopes of the Andes. Am. Mus. Novit. 2012, 3752, 1–55. [Google Scholar] [CrossRef] [Scilit]
  27. Santa-Cruz, R.; von May, R.; Catenazzi, A.; Whitcher, C.; Tejeda, E.L.; Rabosky, D.L. A new species of terrestrial-breeding frog (Amphibia, Strabomantidae, Noblella) from the upper Madre de Dios watershed, Amazonian Andes and lowlands of southern Peru. Diversity (Basel) 2019, 11, 145. [Google Scholar] [CrossRef] [Scilit]
  28. Lehr, E.; Fritzsch, G.; Müller, A. Analysis of Andes frogs (Phrynopus, Leptodactylidae, Anura) phylogeny based on 12S and 16S mitochondrial rDNA sequences. Zool. Scr. 2005, 34, 593–603. [Google Scholar] [CrossRef] [Scilit]
  29. Padial, J.M.; Chaparro, J.C.; De La Riva, I. Systematics of Oreobates and the Eleutherodactylus discoidalis species group (Amphibia, Anura), based on two mitochondrial DNA genes and external morphology. Zool. J. Linn. Soc. 2008, 152, 737–773. [Google Scholar] [CrossRef] [Scilit]
  30. Shepack, A.; von May, R.; Ttito, A.; Catenazzi, A. A new species of Pristimantis (Amphibia, Anura, Craugastoridae) from the foothills of the Andes in Manu National Park, southeastern Peru. Zookeys 2016, 574, 143–164. [Google Scholar]
  31. von May, R.; Rabosky, D.L.; Lehr, E. Earless frogs in the Andes: Extraordinary ecological divergence and morphological diversity. Nat. Hist. 2018, 126, 12–15. [Google Scholar]
  32. Palumbi, S.R.; Martin, A.; Romano, S.; McMillan, W.O.; Stice, L.; Grabawski, G. The Simple Fool’s Guide to PCR (Version 2.0); Privately published; Palumbi, S., Ed.; University of Hawaii: Honolulu, HI, USA, 1991. [Google Scholar]
  33. Meyer, C.P. Molecular systematics of cowries (Gastropoda: Cypraeidae) and diversification patterns in the tropics. Biol. J. Linn. Soc. 2003, 79, 401–459. [Google Scholar] [CrossRef] [Scilit]
  34. Bossuyt, F.; Milinkovitch, M.C. Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proc. Natl. Acad. Sci. USA 2000, 97, 6585–6590. [Google Scholar] [CrossRef] [Scilit]
  35. Lanfear, R.; Calcott, B.; Ho, S.; Guindon, S. PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol. 2012, 29, 1695–1701. [Google Scholar] [CrossRef] [Scilit]
  36. Ronquist, F.; Huelsenbeck, J. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Rambaut, A.; Drummond, A. Tracer. Version 1.5. 2007. Available online: http://tree.bio.ed.ac.uk/software/tracer (accessed on 30 October 2019).
  38. Rambaut, A. FigTree. Version 1.4.2. 2009. Available online: http://tree.bio.ed.ac.uk/software/figtree (accessed on 30 October 2019).
  39. Mamani, L.; Diaz, M.I.; Ttito, J.W.; Condori, F.P.; Ttito, A. Parental care and altitudinal range extension of the endemic frog Bryophryne gymnotis (Anura: Craugastoridae) in the Andes of southeastern Peru. Phyllomedusa 2017, 16, 109–112. [Google Scholar] [CrossRef] [Scilit]
  40. Catenazzi, A.; Ttito, A. Noblella thiuni sp. n. a new (singleton) species of minute terrestrial-breeding frog (Amphibia, Anura, Strabomantidae) from the montane forest of the Amazonian Andes of Puno, Peru. PeerJ 2019, 7, e6780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Reyes-Puig, J.P.; Reyes-Puig, C.; Ron, S.; Ortega, J.A.; Guayasamin, J.M.; Goodrum, M.; Recalde, F.; Vieira, J.J.; Koch, C.; Yanez-Munoz, M.H. A new species of terrestrial frog of the genus Noblella Barbour, 1930 (Amphibia: Strabomantidae) from the Llanganates-Sangay Ecological Corridor, Tungurahua, Ecuador. PeerJ 2019, 7, e7405. [Google Scholar] [CrossRef] [Scilit]
  42. De la Riva, I.; Chaparro, J.C.; Padial, J.M. The taxonomic status of Phyllonastes Heyer and Phrynopus peruvianus (Noble) (Lissamphibia, Anura): Resurrection of Noblella Barbour. Zootaxa 2008, 1685, 67–68. [Google Scholar] [CrossRef] [Scilit]
  43. Catenazzi, A.; von May, R. Conservation status of amphibians in Peru. Herpetol. Monogr. 2014, 28, 1–23. [Google Scholar] [CrossRef] [Scilit]
  44. De La Riva, I.; Reichle, S. Diversity and conservation of the amphibians of Bolivia. Herpetol. Monogr. 2014, 28, 46–65. [Google Scholar] [CrossRef] [Scilit]
  45. Catenazzi, A.; Lehr, E.; Rodriguez, L.O.; Vredenburg, V.T. Batrachochytrium dendrobatidis and the collapse of anuran species richness and abundance in the upper Manu National Park, southeastern Peru. Conserv. Biol. 2011, 25, 382–391. [Google Scholar] [CrossRef] [Scilit]
  46. Catenazzi, A.; Lehr, E.; Vredenburg, V.T. Thermal physiology, disease and amphibian declines in the eastern slopes of the Andes. Conserv. Biol. 2014, 28, 509–517. [Google Scholar] [CrossRef] [Scilit]
  47. Catenazzi, A.; Finkle, J.; Foreyt, E.; Wyman, L.; Swei, A.; Vredenburg, V.T. Epizootic to enzootic transition of a fungal disease in tropical Andean frogs: Are surviving species still susceptible? PLoS ONE 2017, 12, e0186478. [Google Scholar] [CrossRef] [Scilit]
  48. ICZN. International Code of Zoological Nomenclature, 4th ed.; International Trust for Zoological Nomenclature: London, UK, 1999. [Google Scholar]
  49. De la Riva, I. Bolivian frogs of the genus Phrynopus, with the description of twelve new species (Anura: Brachycephalidae). Herpetol. Monogr. 2007, 21, 241–277. [Google Scholar] [CrossRef] [Scilit]
  50. Willaert, B.; Reichle, S.; Stegen, G.; Martel, A.; Barrón, S.; Sánchez de Lozada, N.; Greenhawk, N.; Agostini, G.; Muñoz, A. Distribution, ecology, and conservation of the critically endangered frog Psychrophrynella illimani (Anura: Craugastoridae) with description of its call. Salamandra 2016, 52, 317–327. [Google Scholar]
  51. De la Riva, I.; Burrowes, P.A. A new species of Psychrophrynella (Anura: Craugastoridae) from the Cordillera Real, Department La Paz, Bolivia. Zootaxa 2014, 3887, 459–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Catenazzi, A. Phrynopus cophites. Reproduction. Herpetol. Rev. 2006, 37, 206. [Google Scholar]
Figure 1. Holotypes of species of Qosqophryne gen. n. in dorsolateral and ventral views: (A,B) Q. flammiventris (MUSM 27613; SVL 19.8 mm): (C,D) Q. gymnotis (MUSM 25543; SVL 18.4 mm); (E,F) Q. mancoinca (MUBI 11152; SVL 26.5 mm). Photographs by E. Lehr (A,B), A. Catenazzi (C,D) and L. Mamani (E,F).
Figure 1. Holotypes of species of Qosqophryne gen. n. in dorsolateral and ventral views: (A,B) Q. flammiventris (MUSM 27613; SVL 19.8 mm): (C,D) Q. gymnotis (MUSM 25543; SVL 18.4 mm); (E,F) Q. mancoinca (MUBI 11152; SVL 26.5 mm). Photographs by E. Lehr (A,B), A. Catenazzi (C,D) and L. Mamani (E,F).
Diversity 12 00184 g001
Figure 2. Bayesian maximum clade-credibility tree for 106 species of Holoadeninae (Terrarana) based on a 2646-bp concatenated partitioned dataset (fragments of genes 16S, 12S, COI, RAG1, and Tyr), highlighting the relationships of the three genera Bryophryne, Microkayla and Qosqophryne gen. n. Posterior probabilities are indicated at each node. The frog illustrated here is Qosqophryne gymnotis, paratype MUSM 24542 (photograph by A. Catenazzi).
Figure 2. Bayesian maximum clade-credibility tree for 106 species of Holoadeninae (Terrarana) based on a 2646-bp concatenated partitioned dataset (fragments of genes 16S, 12S, COI, RAG1, and Tyr), highlighting the relationships of the three genera Bryophryne, Microkayla and Qosqophryne gen. n. Posterior probabilities are indicated at each node. The frog illustrated here is Qosqophryne gymnotis, paratype MUSM 24542 (photograph by A. Catenazzi).
Diversity 12 00184 g002
Figure 3. Type localities of frogs in the genera Bryophryne (white circles, species details not shown), Microkayla (squares) and Qosqophryne gen. n. (red asterisks) in southern Peru and northern Bolivia. The known distribution range of these frogs is limited to the type locality and immediate surroundings. For species of Microkayla: (1) M. boettgeri; (2) M. chilina; (3) M. chapi; (4) M. katantika; (5) M. chaupi; (6) M. melanocheira; (7) M. colla; (8) M. kallawaya; (9) M. guillei; (10) M. saltator; (11) M. iani; (12) M. illampu; (13) M. ankohuma; (14) M. condoriri; (15) M. teqta; (16) M. huayna; (17) M. chacaltaya; (18) M. wettsteini. The map does not include seven species of Microkayla distributed in central and southern Bolivia (type localities outside the limits of this map).
Figure 3. Type localities of frogs in the genera Bryophryne (white circles, species details not shown), Microkayla (squares) and Qosqophryne gen. n. (red asterisks) in southern Peru and northern Bolivia. The known distribution range of these frogs is limited to the type locality and immediate surroundings. For species of Microkayla: (1) M. boettgeri; (2) M. chilina; (3) M. chapi; (4) M. katantika; (5) M. chaupi; (6) M. melanocheira; (7) M. colla; (8) M. kallawaya; (9) M. guillei; (10) M. saltator; (11) M. iani; (12) M. illampu; (13) M. ankohuma; (14) M. condoriri; (15) M. teqta; (16) M. huayna; (17) M. chacaltaya; (18) M. wettsteini. The map does not include seven species of Microkayla distributed in central and southern Bolivia (type localities outside the limits of this map).
Diversity 12 00184 g003
Table 1. GenBank accession numbers for taxa and genes sampled in this study. Genbank accession codes of the new sequences are highlighted in bold font.
Table 1. GenBank accession numbers for taxa and genes sampled in this study. Genbank accession codes of the new sequences are highlighted in bold font.
Taxon16S12SCOIRAG1TyrVoucher NbrReference
Barycholos pulcherEU186709---EU186765KU 217781[1]
Barycholos ternetziJX267466--JX267543JX267680CFBH 19426[23]
Bryophryne bakersfieldKT276291KT276283---MHNC 6007[12]
Bryophryne bakersfieldMF186344MF186287-KT276278-MHNC 6009[12]
Bryophryne bustamanteiMT437052--MT431911-MUSM 24537This study
Bryophryne bustamanteiCMT437053--MT431912-MUSM 24538This study
Bryophryne bustamanteiKT276293KT276286-KT276280KT276296MHNC 6019[12]
Bryophryne cf. zonalisMT437054-MT435518--CORBIDI 17475This study
Bryophryne cophitesEF493537--EF493423EF493508KU173497[9]
Bryophryne cophitesKY652641-KY672976KY672961KY681062AC 270.07[22]
Bryophryne hanssaueriKY652642-KY672977KY681084KY681063MUSM 27567[22]
Bryophryne nubilosusKY652643-KY672978KY681085KY681064MUSM 27882[22]
Bryophryne phuyuhampatuMF419259----CORBIDI 18224[16]
Bryophryne phuyuhampatuMF419259----MUBI 14654[16]
Bryophryne quellokunkaMT437061----MUSM 27571This study
Bryophryne quellokunkaMF186387MF186309-MF186526-MNCN 43780[2]
Bryophryne sp.MT437062--MT431916-MUSM 27961This study
Bryophryne sp.MT437063--MT431917-AC 41.09This study
Bryophryne tocraMF186396MF186315-MF186541MF186583MNCN 43786[2]
Bryophryne wilakunkaMF186349MF186291---MUBI 5425[2]
Bryophryne zonalisMT437064----MUSM 27939This study
Eleutherodactylus bilineatusJX267324--JX267556JX267691MNRJ 46476[23]
Euparkerella brasiliensisJX267468--JX267545JX267682-[23]
Holoaden bradeiEF493366EF493378-EF493449EU186779USNM 207945[9]
Holoaden luederwaldtiEU186710EU186728-EU186747EU186768MZUSP 131872[1]
Holoaden luederwaldtiJX267470----CFBH 19552[23]
Lynchius flavomaculatusEU186667EU186667-EU186745EU186766KU218210[1]
Lynchius nebulanastesEU186704EU186704---KU 181408[1]
Lynchius oblitusKX470783KX470776-KX470792KX470799MHNC 8614[25]
Lynchius parkeriEU186705EU186705---KU 181307[1]
Lynchius simmonsiJF810004JF809940-JF809915JF809894QZ 41639[26]
Microkayla adenopleuraMF186339----MNCN 44809[2]
Microkayla adenopleuraMF186340MF186283-MF186537MF186565MNCN 44810[2]
Microkayla ankohuma-MF186288---MNKA 7280[2]
Microkayla ankohuma-MF186289---CBF 5982[2]
Microkayla boettgeriMF186352MF186293MF186456--MNCN 43778[2]
Microkayla boettgeriMF186353MF186294--MF186559MUBI 5363[2]
Microkayla boettgeriMF186354----MUBI 5364[2]
Microkayla cf. iatamasiMF186365----MNCN-DNA 20927[2]
Microkayla chacaltayaMF186357--MF186532-MNCN 42052[2]
Microkayla chapiMF186417MF186328-MF186540MF186562MNCN 43762[2]
Microkayla chilinaMF186411----MUBI 5350[2]
Microkayla chilinaMF186414MF186327MF186457MF186539MF186561MNCN 43772[2]
Microkayla condoririMF186358----CBF 5988[2]
Microkayla guilleiAY843720AY843720--DQ282995AMNH A165108[9]
Microkayla iatamasiAM039644AM039712---MTD TD 1231[9]
Microkayla illampuMF186373----CBF 5999[2]
Microkayla kallawayaMF186379----MNCN 42509[2]
Microkayla katantikaMF186380-MF186453--CBF 6012[2]
Microkayla kempffiMF186384----MNCN 43646[2]
Microkayla quimsacruzisMF186407----MNCN 42039[2]
Microkayla saltatorAM039642AM039710---MTD TD 1229[9]
Microkayla sp. CoscapaMF186399----CBF 6564[2]
Microkayla sp. Khatu RiverMF186409----MNCN 42034[2]
Microkayla teqtaMF186400MF186318--MF186552MNCN 45702[2]
Microkayla utururoMF186433----MNCN 46987[2]
Microkayla wettsteiniMF186434MF186338-MF186531MF186551CBF 6241[2]
Niceforonia brunneaEF493357----KU 178258[9]
Niceforonia dolopsEF493394-----[9]
Noblella heyeriJX267541JX267463---QCAZ 31471[23]
Noblella lochitesEU186699EU186699-EU186756EU186777KU 177356[1]
Noblella losamigosMN366392-MN356099--MVZ 292687[27]
Noblella losamigosKY652644--KY672962KY681065MUSA 6973[22]
Noblella losamigosMN056358-MN356098--MUBI 17413[27]
Noblella madreselvaMN064565--MN355547-CORBIDI 15769[27]
Noblella myrmecoidesJX267542JX267464---QCAZ 40180[23]
Noblella myrmecoidesMN056357----CORBIDI PV45[28]
Noblella pygmaeaKY652645-KY672979KY681086KY681066MUSM 24536[22]
Noblella sp.AM039646AM039714---MTD 45180[29]
Noblella sp. RKY652646-KY672980KY681087KY681067MUSM 27582[22]
Noblella thiuniMK072732----CORBIDI 18723[28]
Oreobates amarakaeriJF809996JF809934-JF809913JF809891MHNC 6975[26]
Oreobates ayacuchoJF809970JF809933-JF809912JF809890MNCN IDlR5024[26]
Oreobates cruralisEU186666EU186666-EU186743EU186764KU 215462[1]
Oreobates gemcareJF809960JF809930-JF809909-MHNC 6687[26]
Oreobates granulosusEU368897JF809929-JF809908JF809887MHNC 3396[30]
Phrynopus auriculatusEF493708EF493708---KU 291634[9]
Phrynopus barthlenaeAM039653AM039721---SMF 81720[29]
Phrynopus brackiEF493709EF493709-EF493421-USNM 286919[9]
Phrynopus bufoidesAM039645AM039713---MHNSM 19860[29]
Phrynopus heimorumAM039635AM039703MF186462MF186545MF186580MTD 45621[29]
Phrynopus horstpauliAM039651AM039719---MTD 44333[29]
Phrynopus intiMF651902MF651909-MF651917-MUSM 31968[3]
Phrynopus kauneorumAM039655AM039723---MHNSM 20595[29]
Phrynopus peruanusMG896582MG896605MG896615MG896626MG896631MUSM 38316[3]
Phrynopus pesantesiAM039656AM039724---MTD 45072[29]
Phrynopus spIMG896589MG896606-MG896629-MUSM 33261[3]
Phrynopus tautzorumAM039652AM039720---MHNSM 20613[29]
Phrynopus tribulosusEU186725EU186707---KU 291630[1]
Pristimantis attenboroughiKY594752-KY962779KY962759-MUSM 31186[10]
Pristimantis pluvialisKX155577--KY962769-CORBIDI 11862[31]
Pristimantis reichleiEF493707EF493707-EF493436-MHNSM 9267[9]
Pristimantis stictogasterEF493704EF493704-EF493445-KU 291659[9]
Psychrophrynella chirihampatuKU884559----CORBIDI 16495[19]
Psychrophrynella chirihampatuKU884560----MHNC 14664[19]
Psychrophrynella glaucaMG837565----CORBIDI 18729[20]
Psychrophrynella sp.MT437065----MUSM 27619This study
Psychrophrynella sp.MT437066----MTD 47488This study
Psychrophrynella sp. PKY652660-KY672992KY681089KY681081AC116.09[22]
Psychrophrynella sp. RKY652661-KY672993KY681090KY681082AC148.07[22]
Psychrophrynella usurpatorKY652662-KY672994KY672975KY681083AC186.09[22]
Qosqophryne flammiventrisMT437055----MTD 46890This study
Qosqophryne flammiventrisMT437056--MT431913-MUSM 27615This study
Qosqophryne gymnotisMT437057--MT431914-MUSM 24546This study
Qosqophryne gymnotisMT437058--MT431915-MUSM 24543This study
Qosqophryne mancoincaMT437059-MT435519--MUBI 16068This study
Qosqophryne mancoincaMT437060-MT435520--MUBI 16069This study
Table 2. Primers used in this study.
Table 2. Primers used in this study.
LocusPrimer Sequence (5′-3′)Reference
16S16SARFCGCCTGTTTATCAAAAACAT[33]
16SBRRCCGGTCTGAACTCAGATCACGT[33]
12SL25195FAAACTGGGATTAGATACCCCACTA[33]
H2916RGAGGGTGACGGGCGGTGTGT[33]
COIdgLCO1490FGGTCAACAAATCATAAAGAYATYGG[34]
dgHCO2198RTAAACTTCAGGGT GACCAAARAAYCA[34]
RAG1R182FGCCATAACTGCTGGAGCATYAT[9]
R270RAGYAGATGTTGCCTGGGTCTTC[9]
TyrTyr1CFGGCAGAGGAWCRTGCCAAGATGT[35]
Tyr1GRTGCTGGGCRTCTCTCCARTCCCA[35]
Table 3. Meristic traits (+ = character present, ‒ = character absent) for the three known species of Qosqophryne gen. n.
Table 3. Meristic traits (+ = character present, ‒ = character absent) for the three known species of Qosqophryne gen. n.
CharactersQ. gymnotisQ. flammiventrisQ. mancoinca
Skin on dorsumshagreenShagreen with small scattered tuberclesShagreen with small conical tubercles
Skin on ventersmoothWeakly areolatesmooth
Dorsolateral foldsDiscontinuous, shortDiscontinuous, shortContinuous, short
Tympanic membrane+++
Tympanic annulus+++
Dentigerous processes of vomers++
Vocal sac+++
Vocal slits+++
Nuptial pads
Fingers with lateral fringes++
Toes with lateral fringes++
Inner tarsal fold
Dorsum colorationReddish, grayish or purplish brown or dark gray with narrow tan middorsal stripeGrayish brownReddish brown or grayish brown with narrow tan middorsal stripe
Venter colorationDark brown, tan, or reddish brown with pale gray flecksBlackish brown with yellow, orange or pink blotchesGray or pale bluish gray with reddish-brown reticulation

Share and Cite

MDPI and ACS Style

Catenazzi, A.; Mamani, L.; Lehr, E.; von May, R. A New Genus of Terrestrial-Breeding Frogs (Holoadeninae, Strabomantidae, Terrarana) from Southern Peru. Diversity 2020, 12, 184. https://doi.org/10.3390/d12050184

AMA Style

Catenazzi A, Mamani L, Lehr E, von May R. A New Genus of Terrestrial-Breeding Frogs (Holoadeninae, Strabomantidae, Terrarana) from Southern Peru. Diversity. 2020; 12(5):184. https://doi.org/10.3390/d12050184

Chicago/Turabian Style

Catenazzi, Alessandro, Luis Mamani, Edgar Lehr, and Rudolf von May. 2020. "A New Genus of Terrestrial-Breeding Frogs (Holoadeninae, Strabomantidae, Terrarana) from Southern Peru" Diversity 12, no. 5: 184. https://doi.org/10.3390/d12050184

APA Style

Catenazzi, A., Mamani, L., Lehr, E., & von May, R. (2020). A New Genus of Terrestrial-Breeding Frogs (Holoadeninae, Strabomantidae, Terrarana) from Southern Peru. Diversity, 12(5), 184. https://doi.org/10.3390/d12050184

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop