Effects of the Polar Fraction of Lophocereus schottii on Gene Expression and Hepatocyte Proliferation in a Wistar Rat Model of Hepatocellular Carcinoma
Abstract
1. Introduction
2. Results
2.1. Identification of Compounds from the Polar Fraction Extract
2.2. LsPF Reduces the Viability of Hepatocellular Carcinoma Cells In Vitro
2.3. Chemical Damage Reduces the Weight Gain of Animals Without Compromising Survival
2.4. Liver Function Markers Are Elevated in All Damage Induction Groups
2.5. Administration of DEN and 2-AAF Induces Nodule Formation and Hepatomegaly
2.6. Damage Treatment Induces Histological Changes and Fibrosis
2.7. LsPF May Have a Better Effect on Gene Expression in Already Damaged Tissue
3. Discussion
Limitations of the Study
4. Materials and Methods
4.1. Preparation of the Polar Fraction of L. schottii
4.2. Identification of Compounds from the Polar Fraction Extract by UPLC-MS
4.3. Qualitative Determination of Phytochemicals in the Polar Fraction of L. schottii
4.4. Effect of the Polar Fraction of L. schottii on the Viability of Liver Cancer Cell Lines
4.5. In Vivo Chemical Induction of Liver Cancer and Treatment with the Polar Fraction of L. schottii
4.6. Serum Biochemistry
4.7. Histological Analysis
4.8. Analysis of Gene Expression
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviation
| HCC | Hepatocellular carcinoma |
| LsPF | Lophocereus schottii Polar Fraction |
| DEN | Diethylnitrosamine |
| 2-AAF | 2-acetylaminofluorene; N-2-fluorenylacetamide |
| RNA | Ribonucleic acid |
| SEM | Standard error mean |
| Ctl | Control |
| wks | Weeks |
| Dmg | Damage |
| ALT | Alanine aminotransferase |
| AST | Aspartate aminotransferase |
| ALKP | Alkaline phosphatase |
| GGT | Gamma-glutamyl transferase |
| HDL-C | High-density lipoprotein |
| H&E | Hematoxylin & Eosin |
| CAT | Catalase |
| SOD | Superoxide dismutase |
| CYP2E | Cytochrome P450 family 2 subfamily E member 1 |
| TGFB1 | Transforming growth factor beta 1 |
| AFP | Alpha-fetoprotein |
| mRNA | Messenger RNA |
| INOS | Inducible nitric oxide synthase |
| IL6 | Interleukin 6 |
| IL1B | Interleukin 1 beta |
| ROS | Reactive oxygen species |
| HK2 | Hexokinase 2 |
| Nrf2 | Nuclear factor erythroid 2-related factor 2 |
| hTERT, | Human telomerase reverse transcriptase |
| MALAT1 | Metastasis-associated lung adenocarcinoma transcript 1 |
| cDNA | Complementary deoxyribonucleic acid |
| M-MLV RT | Moloney Murine Leukemia Virus reverse transcriptase |
References
- Ferlay, J.; Ervik, M.; Lam, F.; Laversanne, M.; Colombet, M.; Mery, L.; Piñeros, M.; Znaor, A.; Soerjomataram, I.; Bray, F. Global Cancer Observatory: Cancer Today. Lyon, France 2024. Available online: https://gco.iarc.who.int/media/globocan/factsheets/populations/900-world-fact-sheet.pdf (accessed on 15 May 2025).
- Rumgay, H.; Arnold, M.; Ferlay, J.; Lesi, O.; Cabasag, C.J.; Vignat, J.; Laversanne, M.; McGlynn, K.A.; Soerjomataram, I. Global burden of primary liver cancer in 2020 and predictions to 2040. J. Hepatol. 2022, 77, 1598–1606. [Google Scholar] [CrossRef]
- Rumgay, H.; Ferlay, J.; de Martel, C.; Georges, D.; Ibrahim, A.S.; Zheng, R.; Wei, W.; Lemmens, V.E.P.P.; Soerjomataram, I. Global, regional and national burden of primary liver cancer by subtype. Eur. J. Cancer 2022, 161, 108–118. [Google Scholar] [CrossRef]
- Chen, J.G.; Zhang, Y.H.; Lu, J.H.; Kensler, T.W. Liver Cancer Etiology: Old Issues and New Perspectives. Curr. Oncol. Rep. 2024, 26, 1452–1468. [Google Scholar] [CrossRef]
- Kim, D.Y. Changing etiology and epidemiology of hepatocellular carcinoma: Asia and worldwide. J. Liver Cancer 2024, 24, 622–670. [Google Scholar] [CrossRef]
- Gujarathi, R.; Klein, J.A.; Liao, C.Y.; Pillai, A. The Changing Demographics and Epidemiology of Hepatocellular Carcinoma. Clin. Liver Dis. 2025, 29, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Kemp, C.J. Animal Models of Chemical Carcinogenesis: Driving Breakthroughs in Cancer Research for 100 Years. Cold Spring Harb Protoc. 2015, 2015, 865–874. [Google Scholar] [CrossRef] [PubMed]
- De Minicis, S.; Kisseleva, T.; Francis, H.; Baroni, G.S.; Benedetti, A.; Brenner, D.; Alvaro, D.; Alpini, G.; Mazioni, M. Liver carcinogenesis: Rodent models of hepatocarcinoma and cholangiocarcinoma. Dig. Liver Dis. 2013, 45, 450–459. [Google Scholar] [CrossRef] [PubMed]
- National Toxicology Program. 15th Report on Carcinogens Research Triangle Park (NC): National Toxicology Program 2021. 2-Acetylaminofluorene: CAS No. 53-96-3. Available online: https://www.ncbi.nlm.nih.gov/books/NBK590899/ (accessed on 1 July 2025).
- Hasanin, A.H.; Habib, E.K.; El Gayar, N.; Matboli, M. Promotive action of 2-acetylaminofluorene on hepatic precancerous lesions initiated by diethylnitrosamine in rats: Molecular study. World. J. Hepatol. 2021, 13, 328–342. [Google Scholar] [CrossRef]
- Sánchez-Meza, J.; Campos-Valdez, M.; Domínguez-Rosales, J.A.; Godínez-Rubí, J.M.; Rodríguez-Reyes, S.C.; Martínez-López, E.; Zúñiga-González, G.M.; Sánchez-Orozco, L.V. Chronic Administration of Diethylnitrosamine and 2-Acetylaminofluorene Induces Hepatocellular Carcinoma in Wistar Rats. Int. J. Mol. Sci. 2023, 24, 8387. [Google Scholar] [CrossRef]
- Ait-Ahmed, Y.; Lafdil, F. Novel insights into the impact of liver inflammatory responses on primary liver cancer development. Liver Res. 2023, 7, 26–34. [Google Scholar] [CrossRef]
- Ding, Z.; Wang, L.; Sun, J.; Zheng, L.; Tang, Y.; Tang, H. Hepatocellular carcinoma: Pathogenesis, molecular mechanisms, and treatment advances. Front. Oncol. 2025, 15, 1526206. [Google Scholar] [CrossRef]
- Li, Y.; Yu, Y.; Yang, L.; Wang, R. Insights into the Role of Oxidative Stress in Hepatocellular Carcinoma Development. Front. Biosci. (Landmark Ed.) 2023, 28, 286. [Google Scholar] [CrossRef]
- Banerjee, A.; Farci, P. Fibrosis and Hepatocarcinogenesis: Role of Gene-Environment Interactions in Liver Disease Progression. Int. J. Mol. Sci. 2024, 25, 8641. [Google Scholar] [CrossRef]
- Chen, T. Unveiling the significance of inducible nitric oxide synthase: Its impact on cancer progression and clinical implications. Cancer Lett. 2024, 592, 216931. [Google Scholar] [CrossRef]
- Blas-García, A.; Apostolova, N. Novel Therapeutic Approaches to Liver Fibrosis Based on Targeting Oxidative Stress. Antioxidants 2023, 12, 1567. [Google Scholar] [CrossRef]
- Kudo, M. All Stages of Hepatocellular Carcinoma Patients Benefit from Systemic Therapy Combined with Locoregional Therapy. Liver Cancer 2023, 12, 395–404. [Google Scholar] [CrossRef] [PubMed]
- Sadagopan, N.; He, A.R. Recent Progress in Systemic Therapy for Advanced Hepatocellular Carcinoma. Int. J. Mol. Sci. 2024, 25, 1259. [Google Scholar] [CrossRef] [PubMed]
- Cerreto, M.; Cardone, F.; Cerrito, L.; Stella, L.; Santopaolo, F.; Pallozzi, M.; Gasbarrini, A.; Ponziani, F.R. The New Era of Systemic Treatment for Hepatocellular Carcinoma: From the First Line to the Optimal Sequence. Curr. Oncol. 2023, 30, 8774–8792. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Jiang, X.; Wang, L.; Jiang, S.; Luo, H.; Chen, Y.; Peng, C. The pathogenesis of liver cancer and the therapeutic potential of bioactive substances. Front. Pharmacol. 2022, 13, 1029601. [Google Scholar] [CrossRef]
- Orozco-Barocio, A.; Sánchez-Sánchez, M.A.; Rojas-Mayorquín, A.E.; Godínez-Rubí, M.; Reyes-Mata, M.P.; Ortuño-Sahagún, D. Phytochemicals from Cactaceae family for cancer prevention and therapy. Front. Pharmacol. 2024, 15, 1421136. [Google Scholar] [CrossRef]
- Vieira, A.C.A.; Ferreira, F.d.S.; Araújo, J.M.D.d.; Dutra, L.M.G.; Batista, K.S.; Cordeiro, A.M.T.d.M.; Aquino, J.d.S. Exploring the Potential Hepatoprotective Properties of Cactus (Cactaceae) in Liver Health and Disease Management: A Brief Review. Livers 2024, 4, 287–313. [Google Scholar] [CrossRef]
- Nason, J.D.; Hamrick, J.L.; Fleming, T.H. Historical vicariance and postglacial colonization effects on the evolution of genetic structure in Lophocereus, a Sonoran Desert columnar cactus. Evolution 2002, 56, 2214–2226. [Google Scholar] [CrossRef] [PubMed]
- Biblioteca Digital de la Medicina Tradicional Mexicana. Universidad Nacional Autónoma de México. Lophocereus schottii (Engelm.) Britton & Rose Cactaceae—Cactaceae. 2009. Available online: http://www.medicinatradicionalmexicana.unam.mx/apmtm/termino.php?l=3&t=lophocereus-schottii (accessed on 18 March 2025).
- Orozco-Barocio, A.; Paniagua-Domínguez, B.L.; Benítez-Saldaña, P.A.; Flores-Torales, E.; Velázquez-Magaña, S.; Nava, H.J. Cytotoxic effect of the ethanolic extract of Lophocereus schottii: A Mexican medicinal plant. Afr. J. Tradit. Complement. Altern. Med. 2013, 10, 397–404. [Google Scholar] [PubMed]
- Orozco-Barocio, A.; Robles-Rodríguez, B.S.; Camacho-Corona, M.D.R.; Méndez-López, L.F.; Godínez-Rubí, M.; Peregrina-Sandoval, J.; Rivera, G.; Rojas-Mayorquín, A.E.; Ortuño-Sahagún, D. In vitro Anticancer Activity of the Polar Fraction from the Lophocereus schottii Ethanolic Extract. Front. Pharmacol. 2022, 13, 820381. [Google Scholar] [CrossRef]
- National Center for Biotechnology Information. PubChem Compound Summary for CID 442313, Lophocerine. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/Lophocerine (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Substance Record for SID 272933415, 22030-12-2. In: Japan Chemical Substance Dictionary (Nikkaji). 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/substance/272933415 (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Compound Summary for CID 52923786, 1-octadecyl-2-(9Z,12Z,15Z-octadecatrienoyl)-glycero-3-phosphocholin. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/52923786 (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Compound Summary for CID 5282102, Astragalin. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/5282102 (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Compound Summary for CID 197081, Cyanidin 3-glucoside chloride. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/197081 (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Compound Summary for CID 131752667, Kaempferol 3-xylosylglucoside. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/131752667 (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Compound Summary for CID 5282347, Al-pha-Tocotrienol. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/5282347 (accessed on 15 May 2025).
- National Center for Biotechnology Information. PubChem Compound Summary for CID 6124299, Caffeoylmalic Acid. 2004. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/6124299 (accessed on 15 May 2025).
- Patel, S.; Patel, S.; Kotadiya, A.; Patel, S.; Shrimali, B.; Joshi, N.; Patel, T.; Trivedi, H.; Patel, J.; Joharapurkar, A.; et al. Age-related changes in hematological and biochemical profiles of Wistar rats. Lab. Anim. Res. 2024, 40, 7. [Google Scholar] [CrossRef]
- Ballesteros-Ramírez, R.; Lasso, P.; Urueña, C.; Saturno, J.; Fiorentino, S. Assessment of Acute and Chronic Toxicity in Wistar Rats (Rattus norvegicus) and New Zealand Rabbits (Oryctolagus cuniculus) of an Enriched Polyphenol Extract Obtained from Caesalpinia spinosa. J. Toxicol. 2024, 2024, 3769933. [Google Scholar] [CrossRef]
- Ihedioha, J.I.; Noel-Uneke, O.A.; Ihedioha, T.E. Reference values for the serum lipid profile of albino rats (Rattus norvegicus) of varied ages and sexes. Comp. Clin. Pathol. 2013, 22, 93–99. [Google Scholar] [CrossRef]
- Vigneshwar, R.; Arivuchelvan, A.; Mekala, P.; Imayarasi, K. Sex-specific reference intervals for Wistar albino rats: Hematology and clinical biochemistry. Indian J. Anim. Health. 2021, 60, 58–65. [Google Scholar] [CrossRef]
- Djerassi, C.; Frick, N.; Geller, L.E. Alkaloid Studies. I. The Isolation of Pilocereine from the Cactus Lophocereus schottii. J. Am. Chem. Soc. 1953, 75, 3632–3635. [Google Scholar] [CrossRef]
- Djerassi, C.; Nakano, T.; Bobbitt, J.M. Alkaloid studies—XX. Tetrahedron 1958, 2, 58–63. [Google Scholar] [CrossRef]
- Djerassi, C.; Brewer, H.W.; Clarke, C.; Durham, L.J. Alkaloid Studies. XXXVIII. 1 Pilocereine-A Trimeric Cactus Alkaloid 2. J. Am. Chem. Soc. 1962, 84, 3210–3212. [Google Scholar] [CrossRef]
- Campbell, C.E.; Kircher, H.W. Senita cactus: A plant with interrupted sterol biosynthetic pathways. Phytochemistry 1980, 19, 2777–2779. [Google Scholar] [CrossRef]
- Liu, C.; Yang, S.; Wang, K.; Bao, X.; Liu, Y.; Zhou, S.; Liu, H.; Qiu, Y.; Wanf, T.; Yu, H. Alkaloids from Traditional Chinese Medicine against hepatocellular carcinoma. Biomed. Pharmacother. 2019, 120, 109543. [Google Scholar] [CrossRef] [PubMed]
- Lechner, J.F.; Stoner, G.D. Red beetroot and betalains as cancer chemopreventative agents. Molecules 2019, 24, 1602. [Google Scholar] [CrossRef]
- Li, W.; Hao, J.; Zhang, L.; Cheng, Z.; Deng, X.; Shu, G. Astragalin Reduces Hexokinase 2 through Increasing miR-125b to Inhibit the Proliferation of Hepatocellular Carcinoma Cells In Vitro and In Vivo. J. Agric. Food. Chem. 2017, 65, 5961–5972. [Google Scholar] [CrossRef]
- Moghadam, D.; Zarei, R.; Vakili, S.; Ghojoghi, R.; Zarezade, V.; Veisi, A.; Sabaghan, M.; Azadbakht, O.; Behrouj, H. The effect of natural polyphenols Resveratrol, Gallic acid, and Kuromanin chloride on human telomerase reverse transcriptase (hTERT) expression in HepG2 hepatocellular carcinoma: Role of SIRT1/Nrf2 signaling pathway and oxidative stress. Mol. Biol. Rep. 2023, 50, 77–84. [Google Scholar] [CrossRef]
- Moghadam, D.; Zarei, R.; Tatar, M.; Khoshdel, Z.; Mashayekhi, F.J.; Naghibalhossaini, F. Anti-Proliferative and Anti-Telomerase Effects of Blackberry Juice and Berry- Derived Polyphenols on HepG2 Liver Cancer Cells and Normal Human Blood Mononuclear Cells. Anti-Cancer Agents Med. Chem. 2022, 22, 395–403. [Google Scholar] [CrossRef]
- Matboli, M.; Hasanin, A.H.; Hussein, R.; El-Nakeep, S.; Habib, E.K.; Ellackany, R.; Saleh, L.A. Cyanidin 3-glucoside modulated cell cycle progression in liver precancerous lesion, in vivo study. World J. Gastroenterol. 2021, 27, 1435–1450. [Google Scholar] [CrossRef]
- Lin, J.; Schyschka, L.; Mühl-Benninghaus, R.; Neumann, J.; Hao, L.; Nussler, N.; Dooley, S.; Liu, L.; Stöckle, U.; Nussler, A.K.; et al. Comparative analysis of phase I and II enzyme activities in 5 hepatic cell lines identifies Huh-7 and HCC-T cells with the highest potential to study drug metabolism. Arch. Toxicol. 2012, 86, 87–95. [Google Scholar] [CrossRef]
- Yue, R.; Liu, H.; Huang, Y.; Wang, J.; Shi, D.; Su, Y.; Lio, Y.; Cai, P.; Jin, G.; Yu, C. Sempervirine Inhibits Proliferation and Promotes Apoptosis by Regulating Wnt/β-Catenin Pathway in Human Hepatocellular Carcinoma. Front. Pharmacol. 2021, 12, 806091. [Google Scholar] [CrossRef]
- Lv, C.; Lan, A.; Fan, X.; Huang, C.; Yang, G. Asperolide A induces apoptosis and cell cycle arrest of human hepatoma cells with p53-Y220C mutant through p38 mediating phosphorylation of p53 (S33). Heliyon 2023, 9, e13843. [Google Scholar] [CrossRef] [PubMed]
- Kawamoto, M.; Yamaji, T.; Saito, K.; Shirasago, Y.; Satomura, K.; Endo, T.; Fukasawa, M.; Hanada, K.; Osada, N.Y. Identification of Characteristic Genomic Markers in Human Hepatoma HuH-7 and Huh7.5.1-8 Cell Lines. Front. Genet. 2020, 11, 546106. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Ho, S.S.; Greer, S.U.; Spies, N.; Bell, J.M.; Zhang, X.; Zhu, X.; Arthur, J.G.; Byeon, S.; Pattni, R.; et al. Haplotype-resolved and integrated genome analysis of the cancer cell line HepG2. Nucleic Acids Res. 2019, 47, 3846–3861. [Google Scholar] [CrossRef] [PubMed]
- Castro-Gil, M.P.; Sánchez-Rodríguez, R.; Torres-Mena, J.E.; López-Torres, C.D.; Quintanar-Jurado, V.; Gabiño-López, N.B.; Villa-Treviño, S.; Del-Pozo-Jauner, L.; Arellanes-Robledo, J.; Pérez-Carreón, J.I. Enrichment of progenitor cells by 2-acetylaminofluorene accelerates liver carcinogenesis induced by diethylnitrosamine in vivo. Mol. Carcinog. 2021, 60, 377–390. [Google Scholar] [CrossRef]
- Malik, S.; Bhatnagar, S.; Chaudhary, N.; Katare, D.P.; Jain, S.K. DEN+2-AAF-induced multistep hepatotumorigenesis in Wistar rats: Supportive evidence and insights. Protoplasma 2013, 250, 175–183. [Google Scholar] [CrossRef]
- Ishteyaque, S.; Yadav, K.S.; Verma, S.; Washimkar, K.R.; Mugale, M.N. CYP2E1 triggered GRP78/ATF6/CHOP signaling axis inhibit apoptosis and promotes progression of hepatocellular carcinoma. Arch. Biochem. Biophys. 2023, 745, 109701. [Google Scholar] [CrossRef]
- Ding, Y.F.; Wu, Z.H.; Wei, Y.J.; Shu, L.; Peng, Y.R. Hepatic inflammation-fibrosis-cancer axis in the rat hepatocellular carcinoma induced by diethylnitrosamine. J. Cancer Res. Clin. Oncol. 2017, 143, 821–834. [Google Scholar] [CrossRef]
- Singh, D.; Singh, M.; Yadav, E.; Falls, N.; Singh Dangi, D.; Kumar, V.; Ramteke, P.W.; Verma, A. Attenuation of diethylnitrosamine (DEN)–Induced hepatic cancer in experimental model of Wistar rats by Carissa carandas embedded silver nanoparticles. Biomed. Pharmacother. 2018, 108, 757–765. [Google Scholar] [CrossRef]
- Lagopoulos, L.; Sunahara, G.I.; Würzner, H.; Fliesen, T.; Stalder, R. The correlation of body growth with diethylnitrosamine-induced hepatocarcinogenesis in relation to serum insulin and somatomedin-C. Carcinogenesis 1991, 12, 211–215. [Google Scholar] [CrossRef]
- Anoopraj, R.; Hemalatha, S.; Balachandran, C. A preliminary study on serum liver function indices of Diethylnitrosamine induced hepatocarcinogenesis and chemoprotective potential of Eclipta alba in male Wistar rats. Vet. World. 2014, 7, 439–442. [Google Scholar] [CrossRef][Green Version]
- Awhin, E.P.; Jeroh, E.; Anigboro, A.A.; Rachael, N. Effect of chronic consumption of Piliostigma thonningii on activities of alanine aminotransferase and aspartate aminotransferase in serum and liver in Rattus novergicus. Pak. J. Biol. Sci. 2013, 16, 2062–2065. [Google Scholar] [CrossRef][Green Version]
- Adeyemi, O.S.; Akanji, M.A. Biochemical changes in the kidney and liver of rats following administration of ethanolic extract of Psidium guajava leaves. Hum. Exp. Toxicol. 2011, 30, 1266–1274. [Google Scholar] [CrossRef]
- Adane, F.; Assefa, W.; Alem, M.B.; Dessalegn, M. Sub-chronic toxicity of the aqueous leaf extract of Ocimum lamiifolium Hochst. ex Benth on biochemical parameters and histopathology of liver and kidney in rats: In vivo and in-silico toxicity studies. BMC Complement. Med. Ther. 2023, 23, 30. [Google Scholar] [CrossRef]
- Behl, T.; Gupta, A.; Albratty, M.; Najmi, A.; Meraya, A.M.; Alhazmi, H.A.; Anwer, M.K.; Bhatia, S.; Bungau, S.G. Alkaloidal Phytoconstituents for Diabetes Management: Exploring the Unrevealed Potential. Molecules 2022, 27, 5851. [Google Scholar] [CrossRef] [PubMed]
- Rasouli, H.; Yarani, R.; Pociot, F.; Popović-Djordjević, J. Anti-diabetic potential of plant alkaloids: Revisiting current findings and future perspectives. Pharmacol. Res. 2020, 155, 104723. [Google Scholar] [CrossRef]
- Mengistu, Y.; Dedefo, G.; Arkew, M.; Asefa, G.; Jebessa, G.; Atnafu, A.; Ataro, Z.; Kinde, S. Effect of Regular Khat Chewing on Serum Fasting Sugar Level in Diabetic patients versus Healthy Individuals; A comparative study. Nutr. Metab. Insights 2021, 14, 11786388211035220. [Google Scholar] [CrossRef]
- Alsalahi, A.; Chik, Z.; Mohamed, Z.; Giribabu, N.; Alshawsh, M.A. Cathinone: An alkaloid of Catha edulis (Khat) exacerbated hyperglycemia in diabetes-induced rats. Saudi J. Biol. Sci. 2021, 28, 4633–4643. [Google Scholar] [CrossRef] [PubMed]
- Koch, M.A. Chapter 18-Experimental Modeling and Research Methodology. In American College of Laboratory Animal Medicine, 2nd ed.; Suckow, M.A., Weisbroth, S.H., Franklin, C.L., Eds.; Academic Press: Cambridge, MA, USA, 2006; pp. 587–625. [Google Scholar]
- Kim, J.; De Jesus, O. Medication Routes of Administration. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar] [PubMed]
- Bruschi, M.L. 1-General considerations. In Strategies to Modify the Drug Release from Pharmaceutical Systems; Woodhead Publishing; Elsevier: Amsterdam, The Netherlands, 2015; pp. 1–14. [Google Scholar]
- Kamata, S.; Akahoshi, N.; Ishii, I. 2D DIGE proteomic analysis highlights delayed postnatal repression of α-fetoprotein expression in homocystinuria model mice. FEBS Open Bio 2015, 5, 535–541. [Google Scholar] [CrossRef]
- Chen, W.; Peng, J.; Ye, J.; Dai, W.; Li, G.; He, Y. Aberrant AFP expression characterizes a subset of hepatocellular carcinoma with distinct gene expression patterns and inferior prognosis. J. Cancer 2020, 11, 403–413. [Google Scholar] [CrossRef] [PubMed]
- Morris, S.M.; Baek, J.Y.; Koszarek, A.; Kanngurn, S.; Knoblaugh, S.E.; Grady, W.M. Transforming growth factor-beta signaling promotes hepatocarcinogenesis induced by p53 loss. Hepatology 2021, 55, 121–131. [Google Scholar] [CrossRef]
- Bierie, B.; Stover, D.G.; Abel, T.W.; Chytil, A.; Gorska, A.E.; Aakre, M.; Forrester, E.; Yang, L.; Wagner, K.U.; Moses, H.L. Transforming Growth Factor–β Regulates Mammary Carcinoma Cell Survival and Interaction with the Adjacent Microenvironment. Cancer Res. 2008, 68, 1809–1819. [Google Scholar] [CrossRef]
- Cordenonsi, M.; Dupont, S.; Maretto, S.; Insinga, A.; Imbriano, C.; Piccolo, S. Links between tumor suppressors: p53 is required for TGF-β gene responses by cooperating with Smads. Cell 2003, 113, 301–314. [Google Scholar] [CrossRef]
- Zhuge, J.; Cederbaum, A.I. Increased toxicity by transforming growth factor-beta 1 in liver cells overexpressing CYP2E1. Free Radic. Biol. Med. 2006, 41, 1100–1112. [Google Scholar] [CrossRef]
- Lu, Y.; Cederbaum, A.I. CYP2E1 and oxidative liver injury by alcohol. Free Radic. Biol. Med. 2008, 44, 723–738. [Google Scholar] [CrossRef]
- Verna, L.; Whysner, J.; Williams, G.M. N-nitrosodiethylamine mechanistic data and risk assessment: Bioactivation, DNA-adduct formation, mutagenicity, and tumor initiation. Pharmacol. Ther. 1996, 71, 57–81. [Google Scholar] [CrossRef]
- Yamazaki, H.; Oda, Y.; Funae, Y.; Imaoka, S.; Inui, Y.; Guengerich, F.P.; Shimada, T. Participation of rat liver cytochrome P450 2E1 in the activation of N-nitrosodimethylamine and N-nitrosodiethylamine to products genotoxic in an acetyltransferase-overexpressing Salmonella typhimurium strain (NM2009). Carcinogenesis 1992, 13, 979–985. [Google Scholar] [CrossRef]
- Yamazaki, H.; Inui, Y.; Yun, C.H.; Guengerich, F.P.; Shimada, T. Cytochrome P450 2E1 and 2A6 enzymes as major catalysts for metabolic activation of N-nitrosodialkylamines and tobacco-related nitrosamines in human liver microsomes. Carcinogenesis 1992, 13, 1789–1794. [Google Scholar] [CrossRef]
- Kang, J.S.; Wanibuchi, H.; Morimura, K.; Gonzalez, F.J.; Fukushima, S. Role of CYP2E1 in diethylnitrosamine-induced hepatocarcinogenesis in vivo. Cancer Res. 2007, 67, 11141–11146. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Wang, Z.; Wang, G.J.; Zhang, H.X.; Gao, N.; Wang, J.; Wang, C.E.; Chang, Z.; Fang, Y.; Zhang, Y.F.; et al. Higher CYP2E1 Activity Correlates with Hepatocarcinogenesis Induced by Di-ethylnitrosamine. J. Pharmacol. Exp. Ther. 2018, 365, 398–407. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Wang, G.J.; Wang, Z.; Gao, N.; Li, J.; Zhang, Y.F.; Zhou, J.; Zhang, H.X.; Wen, Q.; Jin, H.; et al. High CYP2E1 activity correlates with hepatofibrogenesis induced by nitrosamines. Oncotarget 2017, 8, 112199–112210. [Google Scholar] [CrossRef] [PubMed]
- Webster, F.; Lambert, I.B.; Yauk, C.L. Adverse Outcome Pathway on Cyp2e1 Activation Leading to Liver Cancer; OECD Series on Adverse Outcome Pathways; OECD Publishing: Paris, France, 2021. [Google Scholar] [CrossRef]
- Yeh, W.J.; Tsai, C.C.; Ko, J.; Yang, H.Y. Hylocereus polyrhizus Peel Extract Retards Alcoholic Liver Disease Progression by Modulating Oxidative Stress and Inflammatory Responses in C57BL/6 Mice. Nutrients 2020, 12, 3884. [Google Scholar] [CrossRef]
- Salminen, K.A.; Meyer, A.; Jerabkova, L.; Korhonen, L.E.; Rahnasto, M.; Juvonen, R.O.; Imming, P.; Raunio, H. Inhibition of human drug metabolizing cytochrome P450 enzymes by plant isoquinoline alkaloids. Phytomedicine 2011, 18, 533–538. [Google Scholar] [CrossRef]
- McDonald, M.G.; Tian, D.-D.; Thummel, K.E.; Paine, M.F.; Rettie, A. Modulation of Major Human Liver Microsomal Cytochromes P450 by Component Alkaloids of Goldenseal: Time-Dependent Inhibition and Allosteric Effects. Drug Metab. Dispos. 2020, 48, 1018–1027. [Google Scholar] [CrossRef]
- Frank, M.R.; Fogleman, J.C. Involvement of cytochrome P450 in host-plant utilization by Sonoran Desert Drosophila. Proc. Natl. Acad. Sci. USA 1992, 89, 11998–12002. [Google Scholar] [CrossRef]
- Carreira, V.; Bouzas, S.; Padró, J.; Soto, I.M. P450gene family mediates allelochemical detoxification and tolerance to alkaloids in cactophilic Drosophila. Entomol. Exp. Appl. 2022, 170, 948–956. [Google Scholar] [CrossRef]
- Fogleman, J.C.; Danielson, P.B. Chemical Interactions in the Cactus-Microorganism-Drosophila Model System of the Sonoran Desert. Am. Zool. 2001, 41, 877–888. [Google Scholar] [CrossRef]
- Kircher, H.W.; Heed, W.B.; Russell, J.S.; Grove, J. Senita cactus alkaloids: Their significance to Sonoran Desert Drosophila ecology. J. Insect Physiol. 1967, 13, 1869–1874. [Google Scholar] [CrossRef]
- Chen, Y.C.; Chen, H.H.; Chen, P.M. Catalase expression is an independent prognostic marker in liver hepatocellular carcinoma. Oncologie 2024, 26, 79–90. [Google Scholar] [CrossRef]
- Glorieux, C.; Buc Calderon, P. Targeting catalase in cancer. Redox Biol. 2024, 77, 103404. [Google Scholar] [CrossRef] [PubMed]
- Alves, A.F.; Moura, A.C.; Andreolla, H.F.; Veiga, A.B.G.D.; Fiegenbaum, M.; Giovenardi, M.; Almeida, S. Gene expression evaluation of antioxidant enzymes in patients with hepatocellular carcinoma: RT-qPCR and bioinformatic analyses. Genet. Mol. Biol. 2021, 44, e20190373. [Google Scholar] [CrossRef]
- Sánchez-Rodríguez, R.; Torres-Mena, J.E.; del Pozo Yauner, L.; Pérez-Carreón, J.I. Chapter 36, Biomarkers of the Antioxidant Response: A Focus on Liver Carcinogenesis. In Biomarkers in Liver Disease; Preedy, V.R., Ed.; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar] [CrossRef]
- Fahim, S.A.; Ibrahim, S.; Tadros, S.A.; Badary, O.A. Protective effects of butylated hydroxytoluene on the initiation of N-nitrosodiethylamine-induced hepatocellular carcinoma in albino rats. Hum. Exp. Toxicol. 2023, 42, 9603271231165664. [Google Scholar] [CrossRef] [PubMed]
- Marí, M.; Cederbaum, A.I. Induction of catalase, alpha, and microsomal glutathione S-transferase in CYP2E1 overexpressing HepG2 cells and protection against short-term oxidative stress. Hepatology 2001, 33, 652–661. [Google Scholar] [CrossRef]
- Killingsworth, Z.K.; Misare, K.R.; Ryan, A.S.; Ampolini, E.A.; Mendenhall, T.T.; Engevik, M.A.; Hartman, J.H. Subcellular expression of CYP2E1 in HepG2 cells impacts response to free oleic and palmitic acid. Curr. Res. Toxicol. 2024, 7, 100195. [Google Scholar] [CrossRef]
- Jasnie, F.H. Biological activities and chemical constituents of Chromolaena odorata (L.) King & Robinson. Master’s Thesis, University of Malaya, Kuala Lumpur, Malaysia, 2009. [Google Scholar]
- Jara Beltrán, A.I. Ánalisis fitoquímico y determinación de la actividad antioxidante del extracto etanólico de las hojas de la especie Piper imperiale (Piperaceae). Bachelor’s Thesis, Universidad de Ciencias Aplicadas y Ambientales, Bogotá, Columbia, 2013. [Google Scholar]
- Diario Oficial de la Federación. NORMA Oficial Mexicana NOM-062-ZOO-1999, Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. 2001. Available online: https://www.gob.mx/senasica/documentos/nom-062-zoo-1999/ (accessed on 1 July 2025).
- Home Office. United Kingdom. Code of Practice for the Housing and Care of Animals Bred, Supplied or Used for Scientific Purposes. 2014. Available online: https://assets.publishing.service.gov.uk/media/5a7ee67ce5274a2e8ab48e98/CoPanimalsWeb.pdf (accessed on 1 July 2025).
- Sotocinal, S.G.; Sorge, R.E.; Zaloum, A.; Tuttle, A.H.; Martin, L.J.; Wieskopf, J.S.; Mapplebeck, J.C.S.; Wei, P.; Zhan, S.; Zhang, S.; et al. The Rat Grimace Scale: A partially automated method for quantifying pain in the laboratory rat via facial expressions. Mol. Pain 2011, 7, 55. [Google Scholar] [CrossRef] [PubMed]
- Guido, M.; Mangia, A.; Faa, G.; Gruppo Italiano Patologi Apparato Digerente (GIPAD); Società Italiana di Anatomia Patologica e Citopatologia Diagnostica/International Academy of Pathology, Italian division (SIAPEC/IAP). Chronic viral hepatitis: The histology report. Dig. Liver Dis. 2011, 43, S331–S343. [Google Scholar] [CrossRef] [PubMed]







| Reference Values | Ctl | LsPF | Dmg | Dmg+7wks-LsPF | Dmg+13wks-LsPF | |
|---|---|---|---|---|---|---|
| Biochemical markers | ||||||
| ALT (U/L) | 22.68–45.64 a | 39.80 ± 1.715 | 52.50 ± 4.252 * | 162. 8 ± 24.42 **& | 216.2 ± 25.90 **& | 274.4 ± 42.31 **&$ |
| AST (U/L) | 85.71–213.33 a | 173.0 ± 8.88 | 170.3 ± 28.40 | 357.2 ± 31.83 **&& | 376.8 ± 33.49 **& | 485.8± 70.96 **& |
| ALKP (U/L) | 81.16–209.65 a | 151.8 ± 7.372 | 197.8 ± 32.67 | 563.7 ± 46.71 **&& | 619.0 ± 61.98 **& | 423.00 ± 39.35 **& |
| Albumin (g/dL) | 3.4–4.8 a | 3.700 ± 0.0707 | 4.025 ± 0.1493 | 3.783 ± 0.1579 | 3.66 ± 0.0748 | 3.560 ± 0.2542 |
| Total bilirubin (mg/dL) | 0.02–0.42 a | 0.2400 ± 0.02449 | 0.1250 ± 0.02500 * | 1.500 ± 0.7559 **&& | 0.9400 ± 0.1364 **& | 2.520 ± 1.027 **& |
| GGT (U/L) | 0–6 b | 8.000 ± 0.000 | 8.000 ± 0.000 | 47.50 ± 8.036 **&& | 64.40 ± 2.821 **&& | 80.80 ± 15.70 **&& |
| Total proteins (g/dL) | 5.76–6.94 a | 6.220 ± 0.0969 | 6.750 ± 0.2062 * | 6.983 ± 0.1470 * | 6.680 ± 0.1428 * | 6.560 ± 0.2293 |
| Creatinine (mg/dL) | 0.34–0.9 a | 0.52 ± 0.037 | 0.63 ± 0.085 | 0.58 ± 0.031 | 0.50 ± 0.000 | 0.48 ± 0.037 |
| Urea (mg/dL) | 21.74–48.2 a | 48.00 ± 3.597 | 46.53 ± 2.904 | 49.17 ± 2.287 | 47.84 ± 1.326 | 45.38 ± 2.451 |
| Glucose (mg/dL) | 39.55–137.06 a | 91.0 ± 9.450 | 146.0 ± 16.16 * | 104.3 ± 7.606& | 133.0 ± 8.068 *$ | 113.2 ± 9.723 |
| Lipids profile | ||||||
| Cholesterol (mg/dL) | 20–92 b | 51.80 ± 1.655 | 62.00 ± 9.174 | 111.70 ± 10.49 **& | 109.00 ± 8.081 **& | 117.40 ± 10.48 **& |
| Triglycerides (mg/dL) | 27–108 b | 76.80 ± 8.817 | 72.00 ± 15.71 | 96.00 ± 4.619 | 71.20 ± 8.411 | 97.20 ± 12.54 |
| HDL-C (mg/dL) | 36.26–54.55 c | 37.60 ± 1.503 | 42.00 ± 6.338 | 68.00 ± 3.812 **&& | 71.00 ± 3.924 **&& | 67.60 ± 7.718 ** |
| Activity Grade | ||
|---|---|---|
| Portal/periportal | Lobular | |
| None | None | 0 |
| Portal inflammation alone | Inflammation but no necrosis | 1 |
| Mild piecemeal necrosis | Focal necrosis or acidophilic bodies | 2 |
| Moderate piecemeal necrosis | Severe focal cell damage | 3 |
| Severe piecemeal necrosis | Damage includes bridging necrosis | 4 |
| Fibrosis score | ||
| No fibrosis | 0 | |
| Enlarged, fibrotic portal tracts | 1 | |
| Periportal fibrosis or portal-portal septa, but intact architecture | 2 | |
| Fibrosis with architectural distortion, but no obvious cirrhosis | 3 | |
| Probable or definite cirrhosis | 4 | |
| Tumoral features | ||
| Differentiation grade | ||
| Well-differentiated * | 1 | |
| Moderate differentiation ** | 2 | |
| Poorly differentiated *** | 3 | |
| Other features | ||
| Necrosis | Present/Absent | |
| Mitosis | Average mitotic cells (ten fields at 40×) | |
| Primer ID | Sequence |
|---|---|
| AFP-F | 5′-CTTGGTGAAGCAAAAGCCTGAA |
| AFP-R | 5′-GGACCCTCTTCTGTGAAACAGACT |
| CAT-F | 5′-GGAGGCGGGAACCCAATAG |
| CAT-R | 5′-GTGTGCCATCTCGTCAGTGAA |
| COL1A-F | 5′-CAAGATGGTGGCCGTTACTAC |
| COL1A-R | 5′- AGTACTCTCCGCTCTTCCAG |
| CYP2E1-F | 5′- CTTTCCCTCTTCCCATCCTT |
| CYP2E1 -R | 5′- CCCGTCCAGAAAACTCATTC |
| IL-1B-F | 5′- CCAAGCACCTTCTTTTCCTTC |
| IL-1B-R | 5′- GTCAGACAGCACGAGGCATT |
| IL-6-F | 5′- CCACCCACAACAGACCAGTA |
| IL-6-R | 5′- CTCCAGAAGACCAGAGCAGAT |
| INOS-F | 5′- GCCCCTTCAATGGTTGGTAC |
| INOS-R | 5′- AGGCCAGTGTGTGGGTCTC |
| SOD-F | 5′ AATGTGTCCATTGAAGATCGTGTGA |
| SOD-R | 5′ GCTTCCAGCATTTCCAGTCTTTGTA |
| TGFB-F | 5′ TGCTAATGGTGGACCGCAA |
| TGFB-R | 5′ CACTGCTTCCCGAATGTCTGA |
| RPL41-F | 5′ GGCAGAGGTCCAAGTAAACCA |
| RPL41-R | 5′ ATCTCGGCGAGGTGACATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Campos-Valdez, M.; Sánchez-Meza, J.; Orozco-Barocio, A.; Domínguez-Rosales, J.A.; Godínez-Rubí, J.M.; Rodríguez-Reyes, S.C.; Martínez-López, E.; Bueno-Topete, M.R.; Castro-García, M.A.; Zúñiga-González, G.M.; et al. Effects of the Polar Fraction of Lophocereus schottii on Gene Expression and Hepatocyte Proliferation in a Wistar Rat Model of Hepatocellular Carcinoma. Int. J. Mol. Sci. 2025, 26, 9788. https://doi.org/10.3390/ijms26199788
Campos-Valdez M, Sánchez-Meza J, Orozco-Barocio A, Domínguez-Rosales JA, Godínez-Rubí JM, Rodríguez-Reyes SC, Martínez-López E, Bueno-Topete MR, Castro-García MA, Zúñiga-González GM, et al. Effects of the Polar Fraction of Lophocereus schottii on Gene Expression and Hepatocyte Proliferation in a Wistar Rat Model of Hepatocellular Carcinoma. International Journal of Molecular Sciences. 2025; 26(19):9788. https://doi.org/10.3390/ijms26199788
Chicago/Turabian StyleCampos-Valdez, Marina, Jaime Sánchez-Meza, Arturo Orozco-Barocio, José A. Domínguez-Rosales, Juliana Marisol Godínez-Rubí, Sarai C. Rodríguez-Reyes, Erika Martínez-López, Miriam R. Bueno-Topete, Manuel A. Castro-García, Guillermo M. Zúñiga-González, and et al. 2025. "Effects of the Polar Fraction of Lophocereus schottii on Gene Expression and Hepatocyte Proliferation in a Wistar Rat Model of Hepatocellular Carcinoma" International Journal of Molecular Sciences 26, no. 19: 9788. https://doi.org/10.3390/ijms26199788
APA StyleCampos-Valdez, M., Sánchez-Meza, J., Orozco-Barocio, A., Domínguez-Rosales, J. A., Godínez-Rubí, J. M., Rodríguez-Reyes, S. C., Martínez-López, E., Bueno-Topete, M. R., Castro-García, M. A., Zúñiga-González, G. M., Ortuño-Sahagún, D., & Sánchez-Orozco, L. V. (2025). Effects of the Polar Fraction of Lophocereus schottii on Gene Expression and Hepatocyte Proliferation in a Wistar Rat Model of Hepatocellular Carcinoma. International Journal of Molecular Sciences, 26(19), 9788. https://doi.org/10.3390/ijms26199788

