Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Animals and Tissue Collection
4.2. Enzyme Activity Assay
4.3. RNA Isolation
4.4. cDNA Synthesis
4.5. Real-Time PCR
4.6. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ladoux, A.; Peraldi, P.; Chignon-Sicard, B.; Dani, C. Distinct Shades of Adipocytes Control the Metabolic Roles of Adipose Tissues: From Their Origins to Their Relevance for Medical Applications. Biomedicines 2021, 9, 40. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Glazier, B.J.; Hinkel, B.C.; Cao, J.; Liu, L.; Liang, C.; Shi, H. Neuroendocrine Regulation of Energy Metabolism Involving Different Types of Adipose Tissues. Int. J. Mol. Sci. 2019, 20, 2707. [Google Scholar] [CrossRef] [PubMed]
- Ricquier, D.; Cassard-Doulcier, A.M. The biochemistry of white and brown adipocytes analysed from a selection of proteins. Eur. J. Biochem. 1993, 218, 785–796. [Google Scholar] [CrossRef] [PubMed]
- Hansen, J.B.; Jørgensen, C.; Petersen, R.K.; Hallenborg, P.; De Matteis, R.; Bøye, H.A.; Petrovic, N.; Enerbäck, S.; Nedergaard, J.; Cinti, S.; et al. Retinoblastoma Protein Functions as a Molecular Switch Determining White versus Brown Adipocyte Differentiation. Proc. Natl. Acad. Sci. USA 2004, 101, 4112–4117. [Google Scholar] [CrossRef]
- Wu, J.; Boström, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige Adipocytes Are a Distinct Type of Thermogenic Fat Cell in Mouse and Human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef]
- Giordano, A.; Smorlesi, A.; Frontini, A.; Barbatelli, G.; Cint, S. White, Brown and Pink Adipocytes: The Extraordinary Plasticity of the Adipose Organ. Eur. J. Endocrinol. 2014, 170, 159–171. [Google Scholar] [CrossRef]
- Cinti, S. Anatomy and Physiology of the Nutritional System. Mol. Asp. Med. 2019, 68, 101–107. [Google Scholar] [CrossRef]
- Chusyd, D.E.; Wang, D.; Huffman, D.M.; Nagy, T.R. Relationships between Rodent White Adipose Fat Pads and Human White Adipose Fat Depots. Front. Nutr. 2016, 3, 10. [Google Scholar] [CrossRef]
- Chun, K.H. Mouse Model of the Adipose Organ: The Heterogeneous Anatomical Characteristics. Arch. Pharm. Res. 2021, 44, 857–875. [Google Scholar] [CrossRef]
- Cinti, S. Adipose Organ Development and Remodeling. Compr. Physiol. 2018, 8, 1357–1431. [Google Scholar] [CrossRef]
- Schoettl, T.; Fischer, I.P.; Ussar, S. Heterogeneity of Adipose Tissue in Development and Metabolic Function. J. Exp. Biol. 2018, 121, jeb162958. [Google Scholar] [CrossRef] [PubMed]
- Cohen, P.; Kajimura, S. The Cellular and Functional Complexity of Thermogenic Fat. Nat. Rev. Mol. Cell Biol. 2021, 22, 393–409. [Google Scholar] [CrossRef]
- Carobbio, S.; Guénantin, A.C.; Samuelson, I.; Bahri, M.; Vidal-Puig, A. Brown and Beige Fat: From Molecules to Physiology and Pathophysiology. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 37–50. [Google Scholar] [CrossRef]
- Cinti, S. The Adipose Organ at a Glance. DMM Dis. Models Mech. 2012, 5, 588–594. [Google Scholar] [CrossRef]
- Montanari, T.; Pošćić, N.; Colitti, M. Factors Involved in White-to-Brown Adipose Tissue Conversion and in Thermogenesis: A Review. Obes. Rev. 2017, 18, 495–513. [Google Scholar] [CrossRef] [PubMed]
- Czumaj, A.; Szrok-Jurga, S.; Hebanowska, A.; Turyn, J.; Swierczynski, J.; Sledzinski, T.; Stelmanska, E. The Pathophysiological Role of CoA. Int. J. Mol. Sci. 2020, 21, 9057. [Google Scholar] [CrossRef] [PubMed]
- Szrok-Jurga, S.; Czumaj, A.; Turyn, J.; Hebanowska, A.; Swierczynski, J.; Sledzinski, T.; Stelmanska, E. The Physiological and Pathological Role of Acyl-CoA Oxidation. Int. J. Mol. Sci. 2023, 24, 14857. [Google Scholar] [CrossRef] [PubMed]
- Stelmanska, E.; Korczynska, J.; Swierczynski, J. Tissue-Specific Effect of Refeeding after Short- and Long-Term Caloric Restriction on Malic Enzyme Gene Expression in Rat Tissues. Acta Biochim. Pol. 2004, 51, 805–814. [Google Scholar] [CrossRef]
- Kochan, Z.; Karbowska, J.; Swierczynski, J. Unusual Increase of Lipogenesis in Rat White Adipose Tissue after Multiple Cycles of Starvation-Refeeding. Metabolism 1997, 46, 10–17. [Google Scholar] [CrossRef]
- Atzmon, G.; Yang, X.M.; Muzumdar, R.; Ma, X.H.; Gabriely, I.; Barzilai, N. Differential Gene Expression between Visceral and Subcutaneous Fat Depots. Horm. Metab. Res. 2002, 34, 622–628. [Google Scholar] [CrossRef]
- Wronska, A.; Sledzinski, T.; Goyke, E.; Lawniczak, A.; Wierzbicki, P.; Kmiec, Z. Short-Term Calorie Restriction and Refeeding Differently affect Lipogenic Enzymes in Major White Adipose Tissue Depots of Young and Old Rats. J. Physiol. Pharmacol. 2014, 65, 117–126. [Google Scholar] [PubMed]
- Wronska, A.; Lawniczak, A.; Wierzbicki, P.M.; Goyke, E.; Sledzinski, T.; Kmiec, Z. White Adipose Tissue Depot-Specific Activity of Lipogenic Enzymes in Response to Fasting and Refeeding in Young and Old Rats. Gerontology 2015, 61, 448–455. [Google Scholar] [CrossRef] [PubMed]
- Stelmanska, E.; Swierczynski, J. Up-Regulation of Lipogenic Enzyme Genes Expression in Inguinal White Adipose Tissue of Female Rats by Progesterone. J. Steroid Biochem. Mol. Biol. 2013, 134, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Turyn, J.; Stojek, M.; Swierczynski, J. Up-Regulation of Stearoyl-CoA Desaturase 1 and Elongase 6 Genes Expression in Rat Lipogenic Tissues by Chronic Food Restriction and Chronic Food Restriction/Refeeding. Mol. Cell Biochem. 2010, 345, 181–188. [Google Scholar] [CrossRef]
- Turyn, J.; Mika, A.; Stepnowski, P.; Swierczynski, J. Unusual Increase of Scd1 and Elovl6 Expression in Rat Inguinal Adipose Tissue. Cent. Eur. J. Biol. 2012, 7, 192–200. [Google Scholar] [CrossRef]
- Ohno, H.; Shinoda, K.; Spiegelman, B.M.; Kajimura, S. PPARγ Agonists Induce a White-to-Brown Fat Conversion through Stabilization of PRDM16 Protein. Cell Metab. 2012, 15, 395–404. [Google Scholar] [CrossRef]
- Vitali, A.; Murano, I.; Zingaretti, M.C.; Frontini, A.; Ricquier, D.; Cinti, S. The Adipose Organ of Obesity-Prone C57BL/6J Mice Is Composed of Mixed White and Brown Adipocytes. J. Lipid Res. 2012, 53, 619–629. [Google Scholar] [CrossRef]
- Negroiu, C.E.; Tudorașcu, I.; Bezna, C.M.; Godeanu, S.; Diaconu, M.; Danoiu, R.; Danoiu, S. Beyond the Cold: Activating Brown Adipose Tissue as an Approach to Combat Obesity. J. Clin. Med. 2024, 13, 1973. [Google Scholar] [CrossRef] [PubMed]
- Tamucci, K.A.; Namwanje, M.; Fan, L.; Qiang, L. The Dark Side of Browning. Protein Cell 2017, 9, 152–163. [Google Scholar] [CrossRef]
- Chondronikola, M.; Volpi, E.; Børsheim, E.; Porter, C.; Annamalai, P.; Enerbäck, S.; Lidell, M.E.; Saraf, M.K.; Labbe, S.M.; Hurren, N.M.; et al. Brown Adipose Tissue Improves Whole-Body Glucose Homeostasis and Insulin Sensitivity in Humans. Diabetes 2014, 63, 4089–4099. [Google Scholar] [CrossRef]
- Marlatt, K.L.; Ravussin, E. Brown Adipose Tissue: An Update on Recent Findings. Curr. Obes. Rep. 2017, 6, 389–396. [Google Scholar] [CrossRef] [PubMed]
- Sidossis, L.S.; Porter, C.; Saraf, M.K.; Børsheim, E.; Radhakrishnan, R.S.; Chao, T.; Ali, A.; Chondronikola, M.; Mlcak, R.; Finnerty, C.C.; et al. Browning of Subcutaneous White Adipose Tissue in Humans after Severe Adrenergic Stress. Cell Metab. 2015, 22, 219–227. [Google Scholar] [CrossRef] [PubMed]
- Montaigne, D.; Butruille, L.; Staels, B. PPAR Control of Metabolism and Cardiovascular Functions. Nat. Rev. Cardiol. 2021, 18, 809–823. [Google Scholar] [CrossRef] [PubMed]
- Shen, S.-H.; Singh, S.P.; Raffaele, M.; Waldman, M.; Hochhauser, E.; Ospino, J.; Arad, M.; Peterson, S.J. Adipocyte-Specific Expression of PGC1α Promotes Adipocyte Browning and Alleviates Obesity-Induced Metabolic Dysfunction in an HO-1-Dependent Fashion. Antioxidants 2022, 11, 1147. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.Y.; Luong, Q.; Sharma, R.; Dreyfuss, J.M.; Ussar, S.; Kahn, C.R. Developmental and Functional Heterogeneity of White Adipocytes within a Single Fat Depot. EMBO J. 2019, 38, e99291. [Google Scholar] [CrossRef]
- Wang, X.; Xu, M.; Li, Y. Adipose Tissue Aging and Metabolic Disorder, and the Impact of Nutritional Interventions. Nutrients 2022, 14, 3134. [Google Scholar] [CrossRef]
- Ou, M.-Y.; Zhang, H.; Tan, P.-C.; Zhou, S.-B.; Li, Q.-F. Adipose Tissue Aging: Mechanisms and Therapeutic Implications. Cell Death Dis. 2022, 13, 300. [Google Scholar] [CrossRef]
- Mooradian, A.D.; Albert, S.G. The Age-Related Changes in Lipogenic Enzymes: The Role of Dietary Factors and Thyroid Hormone Responsiveness. Mech. Ageing Dev. 1999, 108, 139–149. [Google Scholar] [CrossRef]
- Nogalska, A.; Pankiewicz, A.; Goyke, E.; Swierczynski, J. The Age-Related Inverse Relationship between Ob and Lipogenic Enzymes Genes Expression in Rat White Adipose Tissue. Exp. Gerontol. 2003, 38, 415–422. [Google Scholar] [CrossRef]
- Nogalska, A.; Swierczynski, J. The Age-Related Differences in Obese and Fatty Acid Synthase Gene Expression in White Adipose Tissue of Rat. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2001, 1533, 73–80. [Google Scholar] [CrossRef]
- Schosserer, M.; Grillari, J.; Wolfrum, C.; Scheideler, M. Age-Induced Changes in White, Brite, and Brown Adipose Depots: A Mini-Review. Gerontology 2018, 64, 229–236. [Google Scholar] [CrossRef] [PubMed]
- Bagchi, D.P.; Macdougald, O.A. Identification and Dissection of Diverse Mouse Adipose Depots. J. Vis. Exp. 2019, 149, e59499. [Google Scholar] [CrossRef]
- Börgeson, E.; Boucher, J.; Hagberg, C.E. Of Mice and Men: Pinpointing Species Differences in Adipose Tissue Biology. Front. Cell Dev. Biol. 2022, 10, 1003118. [Google Scholar] [CrossRef]
- Zelewski, M.; Swierczynski, J. Comparative Studies on Lipogenic Enzyme Activities in Brown Adipose Tissue and Liver of the Rat during Starvation-Refeeeding Transition and Cold Exposure. Comp. Biochem. Physiol. 1990, 97, 59–63. [Google Scholar] [CrossRef] [PubMed]
- Peterson, G.L. A Simplification of the Protein Assay Method of Lowry et al. Which Is More Generally Applicable. Anal. Biochem. 1977, 83, 346–356. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]








| Group | Body Weight (g) | WAT Mass (g) | Posterior Subcutaneous WAT Mass (g) |
|---|---|---|---|
| 2-month-old | 270 ± 17.2 | 4.5 ± 1.2 | 2.5 ± 0.7 |
| 12-month-old | 528 ± 56.7 * | 30 ± 11.2 ** | 11.8 ± 6.7 * |
| Gene | Primer Sequence (5′→3′) |
|---|---|
| Fasn | F: ATGGGAAGGTGTCTGTGCACAT R: TGTGGATGATGTTGATGATA |
| Acly | F: CTCACACGGAAGCTCATCAA R: ATGGCAACACCCTCGTAGAC |
| Me1 | F: GCCCTGAATATGATGCGTTT R: CACAGACGCTGTTCCTTGAA |
| Ucp1 | F: CCGAGCCAAGATGGTGAGTT R: CCTTGGATCTGAAGGCGGAC |
| Cs | F: GTAATTCATCTCCGTCATGCCA R: GTCAGCGAGAGTTTGCTCTGAA |
| Tbp | F: CACCGTGAATCTTGGCTGTAAAC R: ATGATGACTGCAGCAAACCG |
| Rpl19 | F: CTGCGTCTGCAGCCATGAGTATGC R: TTACCACAGCGGAGGACGCTAGAG |
| PPAR γ | F: CCAGAGTCTGCTGATCTGCG R: GCCACCTCTTTGCTCTGCTC |
| PGC1α | F: ACTGAGCTACCCTTGGGATG R: GGAATATGGTGATCGGGAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Turyn, J.; Stelmanska, E.; Szrok-Jurga, S. Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot. Int. J. Mol. Sci. 2024, 25, 11546. https://doi.org/10.3390/ijms252111546
Turyn J, Stelmanska E, Szrok-Jurga S. Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot. International Journal of Molecular Sciences. 2024; 25(21):11546. https://doi.org/10.3390/ijms252111546
Chicago/Turabian StyleTuryn, Jacek, Ewa Stelmanska, and Sylwia Szrok-Jurga. 2024. "Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot" International Journal of Molecular Sciences 25, no. 21: 11546. https://doi.org/10.3390/ijms252111546
APA StyleTuryn, J., Stelmanska, E., & Szrok-Jurga, S. (2024). Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot. International Journal of Molecular Sciences, 25(21), 11546. https://doi.org/10.3390/ijms252111546

