Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Animals and Tissue Collection
4.2. Enzyme Activity Assay
4.3. RNA Isolation
4.4. cDNA Synthesis
4.5. Real-Time PCR
4.6. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ladoux, A.; Peraldi, P.; Chignon-Sicard, B.; Dani, C. Distinct Shades of Adipocytes Control the Metabolic Roles of Adipose Tissues: From Their Origins to Their Relevance for Medical Applications. Biomedicines 2021, 9, 40. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Glazier, B.J.; Hinkel, B.C.; Cao, J.; Liu, L.; Liang, C.; Shi, H. Neuroendocrine Regulation of Energy Metabolism Involving Different Types of Adipose Tissues. Int. J. Mol. Sci. 2019, 20, 2707. [Google Scholar] [CrossRef] [PubMed]
- Ricquier, D.; Cassard-Doulcier, A.M. The biochemistry of white and brown adipocytes analysed from a selection of proteins. Eur. J. Biochem. 1993, 218, 785–796. [Google Scholar] [CrossRef] [PubMed]
- Hansen, J.B.; Jørgensen, C.; Petersen, R.K.; Hallenborg, P.; De Matteis, R.; Bøye, H.A.; Petrovic, N.; Enerbäck, S.; Nedergaard, J.; Cinti, S.; et al. Retinoblastoma Protein Functions as a Molecular Switch Determining White versus Brown Adipocyte Differentiation. Proc. Natl. Acad. Sci. USA 2004, 101, 4112–4117. [Google Scholar] [CrossRef]
- Wu, J.; Boström, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige Adipocytes Are a Distinct Type of Thermogenic Fat Cell in Mouse and Human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef]
- Giordano, A.; Smorlesi, A.; Frontini, A.; Barbatelli, G.; Cint, S. White, Brown and Pink Adipocytes: The Extraordinary Plasticity of the Adipose Organ. Eur. J. Endocrinol. 2014, 170, 159–171. [Google Scholar] [CrossRef]
- Cinti, S. Anatomy and Physiology of the Nutritional System. Mol. Asp. Med. 2019, 68, 101–107. [Google Scholar] [CrossRef]
- Chusyd, D.E.; Wang, D.; Huffman, D.M.; Nagy, T.R. Relationships between Rodent White Adipose Fat Pads and Human White Adipose Fat Depots. Front. Nutr. 2016, 3, 10. [Google Scholar] [CrossRef]
- Chun, K.H. Mouse Model of the Adipose Organ: The Heterogeneous Anatomical Characteristics. Arch. Pharm. Res. 2021, 44, 857–875. [Google Scholar] [CrossRef]
- Cinti, S. Adipose Organ Development and Remodeling. Compr. Physiol. 2018, 8, 1357–1431. [Google Scholar] [CrossRef]
- Schoettl, T.; Fischer, I.P.; Ussar, S. Heterogeneity of Adipose Tissue in Development and Metabolic Function. J. Exp. Biol. 2018, 121, jeb162958. [Google Scholar] [CrossRef] [PubMed]
- Cohen, P.; Kajimura, S. The Cellular and Functional Complexity of Thermogenic Fat. Nat. Rev. Mol. Cell Biol. 2021, 22, 393–409. [Google Scholar] [CrossRef]
- Carobbio, S.; Guénantin, A.C.; Samuelson, I.; Bahri, M.; Vidal-Puig, A. Brown and Beige Fat: From Molecules to Physiology and Pathophysiology. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 37–50. [Google Scholar] [CrossRef]
- Cinti, S. The Adipose Organ at a Glance. DMM Dis. Models Mech. 2012, 5, 588–594. [Google Scholar] [CrossRef]
- Montanari, T.; Pošćić, N.; Colitti, M. Factors Involved in White-to-Brown Adipose Tissue Conversion and in Thermogenesis: A Review. Obes. Rev. 2017, 18, 495–513. [Google Scholar] [CrossRef] [PubMed]
- Czumaj, A.; Szrok-Jurga, S.; Hebanowska, A.; Turyn, J.; Swierczynski, J.; Sledzinski, T.; Stelmanska, E. The Pathophysiological Role of CoA. Int. J. Mol. Sci. 2020, 21, 9057. [Google Scholar] [CrossRef] [PubMed]
- Szrok-Jurga, S.; Czumaj, A.; Turyn, J.; Hebanowska, A.; Swierczynski, J.; Sledzinski, T.; Stelmanska, E. The Physiological and Pathological Role of Acyl-CoA Oxidation. Int. J. Mol. Sci. 2023, 24, 14857. [Google Scholar] [CrossRef] [PubMed]
- Stelmanska, E.; Korczynska, J.; Swierczynski, J. Tissue-Specific Effect of Refeeding after Short- and Long-Term Caloric Restriction on Malic Enzyme Gene Expression in Rat Tissues. Acta Biochim. Pol. 2004, 51, 805–814. [Google Scholar] [CrossRef]
- Kochan, Z.; Karbowska, J.; Swierczynski, J. Unusual Increase of Lipogenesis in Rat White Adipose Tissue after Multiple Cycles of Starvation-Refeeding. Metabolism 1997, 46, 10–17. [Google Scholar] [CrossRef]
- Atzmon, G.; Yang, X.M.; Muzumdar, R.; Ma, X.H.; Gabriely, I.; Barzilai, N. Differential Gene Expression between Visceral and Subcutaneous Fat Depots. Horm. Metab. Res. 2002, 34, 622–628. [Google Scholar] [CrossRef]
- Wronska, A.; Sledzinski, T.; Goyke, E.; Lawniczak, A.; Wierzbicki, P.; Kmiec, Z. Short-Term Calorie Restriction and Refeeding Differently affect Lipogenic Enzymes in Major White Adipose Tissue Depots of Young and Old Rats. J. Physiol. Pharmacol. 2014, 65, 117–126. [Google Scholar] [PubMed]
- Wronska, A.; Lawniczak, A.; Wierzbicki, P.M.; Goyke, E.; Sledzinski, T.; Kmiec, Z. White Adipose Tissue Depot-Specific Activity of Lipogenic Enzymes in Response to Fasting and Refeeding in Young and Old Rats. Gerontology 2015, 61, 448–455. [Google Scholar] [CrossRef] [PubMed]
- Stelmanska, E.; Swierczynski, J. Up-Regulation of Lipogenic Enzyme Genes Expression in Inguinal White Adipose Tissue of Female Rats by Progesterone. J. Steroid Biochem. Mol. Biol. 2013, 134, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Turyn, J.; Stojek, M.; Swierczynski, J. Up-Regulation of Stearoyl-CoA Desaturase 1 and Elongase 6 Genes Expression in Rat Lipogenic Tissues by Chronic Food Restriction and Chronic Food Restriction/Refeeding. Mol. Cell Biochem. 2010, 345, 181–188. [Google Scholar] [CrossRef]
- Turyn, J.; Mika, A.; Stepnowski, P.; Swierczynski, J. Unusual Increase of Scd1 and Elovl6 Expression in Rat Inguinal Adipose Tissue. Cent. Eur. J. Biol. 2012, 7, 192–200. [Google Scholar] [CrossRef]
- Ohno, H.; Shinoda, K.; Spiegelman, B.M.; Kajimura, S. PPARγ Agonists Induce a White-to-Brown Fat Conversion through Stabilization of PRDM16 Protein. Cell Metab. 2012, 15, 395–404. [Google Scholar] [CrossRef]
- Vitali, A.; Murano, I.; Zingaretti, M.C.; Frontini, A.; Ricquier, D.; Cinti, S. The Adipose Organ of Obesity-Prone C57BL/6J Mice Is Composed of Mixed White and Brown Adipocytes. J. Lipid Res. 2012, 53, 619–629. [Google Scholar] [CrossRef]
- Negroiu, C.E.; Tudorașcu, I.; Bezna, C.M.; Godeanu, S.; Diaconu, M.; Danoiu, R.; Danoiu, S. Beyond the Cold: Activating Brown Adipose Tissue as an Approach to Combat Obesity. J. Clin. Med. 2024, 13, 1973. [Google Scholar] [CrossRef] [PubMed]
- Tamucci, K.A.; Namwanje, M.; Fan, L.; Qiang, L. The Dark Side of Browning. Protein Cell 2017, 9, 152–163. [Google Scholar] [CrossRef]
- Chondronikola, M.; Volpi, E.; Børsheim, E.; Porter, C.; Annamalai, P.; Enerbäck, S.; Lidell, M.E.; Saraf, M.K.; Labbe, S.M.; Hurren, N.M.; et al. Brown Adipose Tissue Improves Whole-Body Glucose Homeostasis and Insulin Sensitivity in Humans. Diabetes 2014, 63, 4089–4099. [Google Scholar] [CrossRef]
- Marlatt, K.L.; Ravussin, E. Brown Adipose Tissue: An Update on Recent Findings. Curr. Obes. Rep. 2017, 6, 389–396. [Google Scholar] [CrossRef] [PubMed]
- Sidossis, L.S.; Porter, C.; Saraf, M.K.; Børsheim, E.; Radhakrishnan, R.S.; Chao, T.; Ali, A.; Chondronikola, M.; Mlcak, R.; Finnerty, C.C.; et al. Browning of Subcutaneous White Adipose Tissue in Humans after Severe Adrenergic Stress. Cell Metab. 2015, 22, 219–227. [Google Scholar] [CrossRef] [PubMed]
- Montaigne, D.; Butruille, L.; Staels, B. PPAR Control of Metabolism and Cardiovascular Functions. Nat. Rev. Cardiol. 2021, 18, 809–823. [Google Scholar] [CrossRef] [PubMed]
- Shen, S.-H.; Singh, S.P.; Raffaele, M.; Waldman, M.; Hochhauser, E.; Ospino, J.; Arad, M.; Peterson, S.J. Adipocyte-Specific Expression of PGC1α Promotes Adipocyte Browning and Alleviates Obesity-Induced Metabolic Dysfunction in an HO-1-Dependent Fashion. Antioxidants 2022, 11, 1147. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.Y.; Luong, Q.; Sharma, R.; Dreyfuss, J.M.; Ussar, S.; Kahn, C.R. Developmental and Functional Heterogeneity of White Adipocytes within a Single Fat Depot. EMBO J. 2019, 38, e99291. [Google Scholar] [CrossRef]
- Wang, X.; Xu, M.; Li, Y. Adipose Tissue Aging and Metabolic Disorder, and the Impact of Nutritional Interventions. Nutrients 2022, 14, 3134. [Google Scholar] [CrossRef]
- Ou, M.-Y.; Zhang, H.; Tan, P.-C.; Zhou, S.-B.; Li, Q.-F. Adipose Tissue Aging: Mechanisms and Therapeutic Implications. Cell Death Dis. 2022, 13, 300. [Google Scholar] [CrossRef]
- Mooradian, A.D.; Albert, S.G. The Age-Related Changes in Lipogenic Enzymes: The Role of Dietary Factors and Thyroid Hormone Responsiveness. Mech. Ageing Dev. 1999, 108, 139–149. [Google Scholar] [CrossRef]
- Nogalska, A.; Pankiewicz, A.; Goyke, E.; Swierczynski, J. The Age-Related Inverse Relationship between Ob and Lipogenic Enzymes Genes Expression in Rat White Adipose Tissue. Exp. Gerontol. 2003, 38, 415–422. [Google Scholar] [CrossRef]
- Nogalska, A.; Swierczynski, J. The Age-Related Differences in Obese and Fatty Acid Synthase Gene Expression in White Adipose Tissue of Rat. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2001, 1533, 73–80. [Google Scholar] [CrossRef]
- Schosserer, M.; Grillari, J.; Wolfrum, C.; Scheideler, M. Age-Induced Changes in White, Brite, and Brown Adipose Depots: A Mini-Review. Gerontology 2018, 64, 229–236. [Google Scholar] [CrossRef] [PubMed]
- Bagchi, D.P.; Macdougald, O.A. Identification and Dissection of Diverse Mouse Adipose Depots. J. Vis. Exp. 2019, 149, e59499. [Google Scholar] [CrossRef]
- Börgeson, E.; Boucher, J.; Hagberg, C.E. Of Mice and Men: Pinpointing Species Differences in Adipose Tissue Biology. Front. Cell Dev. Biol. 2022, 10, 1003118. [Google Scholar] [CrossRef]
- Zelewski, M.; Swierczynski, J. Comparative Studies on Lipogenic Enzyme Activities in Brown Adipose Tissue and Liver of the Rat during Starvation-Refeeeding Transition and Cold Exposure. Comp. Biochem. Physiol. 1990, 97, 59–63. [Google Scholar] [CrossRef] [PubMed]
- Peterson, G.L. A Simplification of the Protein Assay Method of Lowry et al. Which Is More Generally Applicable. Anal. Biochem. 1977, 83, 346–356. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Group | Body Weight (g) | WAT Mass (g) | Posterior Subcutaneous WAT Mass (g) |
---|---|---|---|
2-month-old | 270 ± 17.2 | 4.5 ± 1.2 | 2.5 ± 0.7 |
12-month-old | 528 ± 56.7 * | 30 ± 11.2 ** | 11.8 ± 6.7 * |
Gene | Primer Sequence (5′→3′) |
---|---|
Fasn | F: ATGGGAAGGTGTCTGTGCACAT R: TGTGGATGATGTTGATGATA |
Acly | F: CTCACACGGAAGCTCATCAA R: ATGGCAACACCCTCGTAGAC |
Me1 | F: GCCCTGAATATGATGCGTTT R: CACAGACGCTGTTCCTTGAA |
Ucp1 | F: CCGAGCCAAGATGGTGAGTT R: CCTTGGATCTGAAGGCGGAC |
Cs | F: GTAATTCATCTCCGTCATGCCA R: GTCAGCGAGAGTTTGCTCTGAA |
Tbp | F: CACCGTGAATCTTGGCTGTAAAC R: ATGATGACTGCAGCAAACCG |
Rpl19 | F: CTGCGTCTGCAGCCATGAGTATGC R: TTACCACAGCGGAGGACGCTAGAG |
PPAR γ | F: CCAGAGTCTGCTGATCTGCG R: GCCACCTCTTTGCTCTGCTC |
PGC1α | F: ACTGAGCTACCCTTGGGATG R: GGAATATGGTGATCGGGAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Turyn, J.; Stelmanska, E.; Szrok-Jurga, S. Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot. Int. J. Mol. Sci. 2024, 25, 11546. https://doi.org/10.3390/ijms252111546
Turyn J, Stelmanska E, Szrok-Jurga S. Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot. International Journal of Molecular Sciences. 2024; 25(21):11546. https://doi.org/10.3390/ijms252111546
Chicago/Turabian StyleTuryn, Jacek, Ewa Stelmanska, and Sylwia Szrok-Jurga. 2024. "Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot" International Journal of Molecular Sciences 25, no. 21: 11546. https://doi.org/10.3390/ijms252111546
APA StyleTuryn, J., Stelmanska, E., & Szrok-Jurga, S. (2024). Two Regions with Different Expression of Lipogenic Enzymes in Rats’ Posterior Subcutaneous Fat Depot. International Journal of Molecular Sciences, 25(21), 11546. https://doi.org/10.3390/ijms252111546