Interplay of Vitamin D, Unfolded Protein Response, and Iron Metabolism in Neuroblastoma Cells: A Therapeutic Approach in Neurodegenerative Conditions
Abstract
1. Introduction
2. Results
2.1. Verification of UPR Generated in SH-SY5Y Cell by Tg Administration
2.2. Expression Analysis of PDIA3 in SH-SY5Y Cells after Tg Treatment
2.3. Effects of VD or Tg on the mRNA Expression of the HAMP Gene
2.4. Administrations of VD and Tg in Different Orders Produced Alterations in the Expression Levels of UPR-Related Genes
2.5. VD Post-Treatment Resulted in Reduced Expression of PDIA3
2.6. Post-Treatment with VD Suppressed the Expression of the HAMP Gene
2.7. Expression Changes in Iron Transporters, Ferroportin, and DMT1 in the Different Treatments of SH-SY5
2.8. Iron Storage and Cellular Iron Content after VD and Tg Administration
2.9. Changes in the Secreted Proinflammatory Cytokine Levels of the Treated SH-SY5Y Cells
2.10. Expression of mRNA and Protein of Fractalkine after the Tg and VD Treatments
2.11. Phosphorylation of Significant Signaling Pathways Components after UPR Generation and VD Effect
3. Discussion
4. Materials and Methods
4.1. Cell Cultures and Treatments
4.2. Real-Time qPCR
4.3. Western Blot Analysis
4.4. Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
4.5. Iron Measurements
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Saponaro, F.; Saba, A.; Zucchi, R. An Update on Vitamin d Metabolism. Int. J. Mol. Sci. 2020, 21, 6573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouillon, R.; Marcocci, C.; Carmeliet, G.; Bikle, D.; White, J.H.; Dawson-Hughes, B.; Lips, P.; Munns, C.F.; Lazaretti-Castro, M.; Giustina, A.; et al. Skeletal and Extraskeletal Actions of Vitamin D: Current Evidence and Outstanding Questions. Endocr. Rev. 2019, 40, 1109–1151. [Google Scholar] [CrossRef] [Scilit]
- Sergeev, I.N. Vitamin D Status and Vitamin D-Dependent Apoptosis in Obesity. Nutrients 2020, 12, 1392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramagopalan, S.V.; Heger, A.; Berlanga, A.J.; Maugeri, N.J.; Lincoln, M.R.; Burrell, A.; Handunnetthi, L.; Handel, A.E.; Disanto, G.; Orton, S.M.; et al. A ChIP-Seq Defined Genome-Wide Map of Vitamin D Receptor Binding: Associations with Disease and Evolution. Genome Res. 2010, 20, 1352–1360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varghese, J.E.; Shanmugam, V.; Rengarajan, R.L.; Meyyazhagan, A.; Arumugam, V.A.; Al-Misned, F.A.; El-Serehy, H.A. Role of Vitamin D3 on Apoptosis and Inflammatory-Associated Gene in Colorectal Cancer: An in Vitro Approach. J. King Saud Univ.-Sci. 2020, 32, 2786–2789. [Google Scholar] [CrossRef] [Scilit]
- Cui, X.; Eyles, D.W. Vitamin D and the Central Nervous System: Causative and Preventative Mechanisms in Brain Disorders. Nutrients 2022, 14, 4353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eyles, D.W. Vitamin D: Brain and Behavior. JBMR Plus 2021, 5, e10419. [Google Scholar] [CrossRef] [Scilit]
- Scheper, W.; Hoozemans, J.J.M. The Unfolded Protein Response in Neurodegenerative Diseases: A Neuropathological Perspective. Acta Neuropathol. 2015, 130, 315–331. [Google Scholar] [CrossRef] [Scilit]
- van Ziel, A.M.; Scheper, W. The Upr in Neurodegenerative Disease: Not Just an inside Job. Biomolecules 2020, 10, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, Regulation and Functions of the Unfolded Protein Response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef] [Scilit]
- Jaskulska, A.; Janecka, A.E.; Gach-Janczak, K. Thapsigargin—From Traditional Medicine to Anticancer Drug. Int. J. Mol. Sci. 2021, 22, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, B.-C.; Zhang, S.-T.; Chen, G. Research Progress of the UPR Mechanism and Its Effect on Improving Foreign Protein Expression. Protein Pept. Lett. 2020, 27, 831–840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva, D.C.; Valentão, P.; Andrade, P.B.; Pereira, D.M. Endoplasmic Reticulum Stress Signaling in Cancer and Neurodegenerative Disorders: Tools and Strategies to Understand Its Complexity. Pharmacol. Res. 2020, 155, 104702. [Google Scholar] [CrossRef] [Scilit]
- Hoozemans, J.J.M.; Van Haastert, E.S.; Nijholt, D.A.T.; Rozemuller, A.J.M.; Scheper, W. Activation of the Unfolded Protein Response Is an Early Event in Alzheimer’s and Parkinson’s Disease. Neurodegener. Dis. 2012, 10, 212–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hadzhieva, M.; Kirches, E.; Mawrin, C. Review: Iron Metabolism and the Role of Iron in Neurodegenerative Disorders. Neuropathol. Appl. Neurobiol. 2014, 40, 240–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iyer, S.R.; Tidemand, K.D.; Babicz, J.T.; Jacobs, A.B.; Gee, L.B.; Haahr, L.T.; Yoda, Y.; Kurokuzu, M.; Kitao, S.; Saito, M.; et al. Direct Coordination of Pterin to FeII Enables Neurotransmitter Biosynthesis in the Pterin-Dependent Hydroxylases. Proc. Natl. Acad. Sci. USA 2021, 118, e2022379118. [Google Scholar] [CrossRef] [Scilit]
- Ward, R.J.; Zucca, F.A.; Duyn, J.H.; Crichton, R.R.; Zecca, L. The Role of Iron in Brain Ageing and Neurodegenerative Disorders. Lancet Neurol. 2014, 13, 1045–1060. [Google Scholar] [CrossRef] [Scilit]
- Pal, A.; Cerchiaro, G.; Rani, I.; Ventriglia, M.; Rongioletti, M.; Longobardi, A.; Squitti, R. Iron in Alzheimer’s Disease: From Physiology to Disease Disabilities. Biomolecules 2022, 12, 1248. [Google Scholar] [CrossRef] [Scilit]
- Qian, Z.M.; Ke, Y. Hepcidin and Its Therapeutic Potential in Neurodegenerative Disorders. Med. Res. Rev. 2020, 40, 633–653. [Google Scholar] [CrossRef] [Scilit]
- Iwasaki, Y.; Suganami, T.; Hachiya, R.; Shirakawa, I.; Kim-Saijo, M.; Tanaka, M.; Hamaguchi, M.; Takai-Igarashi, T.; Nakai, M.; Miyamoto, Y.; et al. Activating Transcription Factor 4 Links Metabolic Stress to Interleukin-6 Expression in Macrophages. Diabetes 2014, 63, 152–161. [Google Scholar] [CrossRef] [Scilit]
- Martinon, F.; Chen, X.; Lee, A.H.; Glimcher, L.H. TLR Activation of the Transcription Factor XBP1 Regulates Innate Immune Responses in Macrophages. Nat. Immunol. 2010, 11, 411–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, A.; Ghosh, R.; Guchhait, P. CXCR3 Antagonist Rescues ER Stress and Reduces Inflammation and JEV Infection in Mice Brain. Cytokine 2023, 172, 156380. [Google Scholar] [CrossRef] [Scilit]
- Banerjee, A.; Damera, G.; Bhandare, R.; Gu, S.; Lopez-Boado, Y.S.; Panettieri, R.A.; Tliba, O. Vitamin D and Glucocorticoids Differentially Modulate Chemokine Expression in Human Airway Smooth Muscle Cells. Br. J. Pharmacol. 2008, 155, 84–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pandur, E.; Tamási, K.; Pap, R.; Jánosa, G.; Sipos, K. Modulatory Effects of Fractalkine on Inflammatory Response and Iron Metabolism of Lipopolysaccharide and Lipoteichoic Acid-Activated THP-1 Macrophages. Int. J. Mol. Sci. 2022, 23, 2629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pandur, E.; Tamási, K.; Pap, R.; Varga, E.; Miseta, A.; Sipos, K. Fractalkine Induces Hepcidin Expression of BV-2 Microglia and Causes Iron Accumulation in SH-SY5Y Cells. Cell. Mol. Neurobiol. 2019, 39, 985–1001. [Google Scholar] [CrossRef] [Scilit]
- Chichiarelli, S.; Altieri, F.; Paglia, G.; Rubini, E.; Minacori, M.; Eufemi, M. ERp57/PDIA3: New Insight. Cell. Mol. Biol. Lett. 2022, 27, 12. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, S.J.; Pinto, J.P.; Picarote, G.; Costa, V.M.; Carvalho, F.; Rangel, M.; de Sousa, M.; de Almeida, S.F. ER Stress-Inducible Factor CHOP Affects the Expression of Hepcidin by Modulating C/EBPalpha Activity. PLoS ONE 2009, 4, e6618. [Google Scholar] [CrossRef] [Scilit]
- Mi, X.; Li, Q.; Wen, X.; Xie, J.; Wang, Y.; Song, N. Extracellular α-Synuclein Modulates Iron Metabolism Related Proteins via Endoplasmic Reticulum Stress in MES23.5 Dopaminergic Cells. Neurochem. Res. 2021, 46, 1502–1513. [Google Scholar] [CrossRef] [Scilit]
- Bacchetta, J.; Zaritsky, J.J.; Sea, J.L.; Chun, R.F.; Lisse, T.S.; Zavala, K.; Nayak, A.; Wesseling-Perry, K.; Westerman, M.; Hollis, B.W.; et al. Suppression of Iron-Regulatory Hepcidin by Vitamin D. J. Am. Soc. Nephrol. 2014, 25, 564–572. [Google Scholar] [CrossRef] [Scilit]
- Dusek, P.; Hofer, T.; Alexander, J.; Roos, P.M.; Aaseth, J.O. Cerebral Iron Deposition in Neurodegeneration. Biomolecules 2022, 12, 714. [Google Scholar] [CrossRef] [Scilit]
- Tofaris, G.K.; Revesz, T.; Jacques, T.S.; Papacostas, S.; Chataway, J. Adult-Onset Neurodegeneration with Brain Iron Accumulation and Cortical α-Synuclein and Tau Pathology: A Distinct Clinicopathological Entity. Arch. Neurol. 2007, 64, 280–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magalingam, K.B.; Somanath, S.D.; Ramdas, P.; Haleagrahara, N.; Radhakrishnan, A.K. 6-Hydroxydopamine Induces Neurodegeneration in Terminally Differentiated SH-SY5Y Neuroblastoma Cells via Enrichment of the Nucleosomal Degradation Pathway: A Global Proteomics Approach. J. Mol. Neurosci. 2022, 72, 1026–1046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xicoy, H.; Wieringa, B.; Martens, G.J.M. The SH-SY5Y Cell Line in Parkinson’s Disease Research: A Systematic Review. Mol. Neurodegener. 2017, 12, 10. [Google Scholar] [CrossRef] [Scilit]
- de Medeiros, L.M.; De Bastiani, M.A.; Rico, E.P.; Schonhofen, P.; Pfaffenseller, B.; Wollenhaupt-Aguiar, B.; Grun, L.; Barbé-Tuana, F.; Zimmer, E.R.; Castro, M.A.A.; et al. Cholinergic Differentiation of Human Neuroblastoma SH-SY5Y Cell Line and Its Potential Use as an In Vitro Model for Alzheimer’s Disease Studies. Mol. Neurobiol. 2019, 56, 7355–7367. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Hu, J.; Yuan, X.; Shen, L.; Zhu, L.; Luo, Q. Hepcidin Decreases Rotenone-Induced α-Synuclein Accumulation via Autophagy in SH-SY5Y Cells. Front. Mol. Neurosci. 2020, 13, e560891. [Google Scholar] [CrossRef] [Scilit]
- Costa, I.; Barbosa, D.J.; Silva, V.; Benfeito, S.; Borges, F.; Remião, F.; Silva, R. Research Models to Study Ferroptosis’s Impact in Neurodegenerative Diseases. Pharmaceutics 2023, 15, 1369. [Google Scholar] [CrossRef] [Scilit]
- Enck, J.R.; Olson, E.C. Calcium Signaling during Cortical Apical Dendrite Initiation: A Role for Cajal-Retzius Neurons. Int. J. Mol. Sci. 2023, 24, 12965. [Google Scholar] [CrossRef] [Scilit]
- Sergeev, I.N. Vitamin D-Mediated Apoptosis in Cancer and Obesity. Horm. Mol. Biol. Clin. Investig. 2014, 20, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Dusso, A.S.; Brown, A.J.; Slatopolsky, E. Vitamin D. Am. J. Physiol.-Ren. Physiol. 2005, 289, F8–F28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gil, Á.; Plaza-Diaz, J.; Mesa, M.D. Vitamin D: Classic and Novel Actions. Ann. Nutr. Metab. 2018, 72, 87–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palimariciuc, M.; Balmus, I.M.; Gireadă, B.; Ciobica, A.; Chiriță, R.; Iordache, A.C.; Apostu, M.; Dobrin, R.P. The Quest for Neurodegenerative Disease Treatment—Focusing on Alzheimer’s Disease Personalised Diets. Curr. Issues Mol. Biol. 2023, 45, 1519–1535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lasoń, W.; Jantas, D.; Leśkiewicz, M.; Regulska, M.; Basta-Kaim, A. The Vitamin D Receptor as a Potential Target for the Treatment of Age-Related Neurodegenerative Diseases Such as Alzheimer’s and Parkinson’s Diseases: A Narrative Review. Cells 2023, 12, 660–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaviani, M.; Nikooyeh, B.; Zand, H.; Yaghmaei, P.; Neyestani, T.R. Effects of Vitamin D Supplementation on Depression and Some Involved Neurotransmitters. J. Affect. Disord. 2020, 269, 28–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mark, K.A.; Dumas, K.J.; Bhaumik, D.; Schilling, B.; Davis, S.; Oron, T.R.; Sorensen, D.J.; Lucanic, M.; Brem, R.B.; Melov, S.; et al. Vitamin D Promotes Protein Homeostasis and Longevity via the Stress Response Pathway Genes Skn-1, Ire-1, and Xbp-1. Cell Rep. 2016, 17, 1227–1237. [Google Scholar] [CrossRef] [Scilit]
- Koduah, P.; Paul, F.; Dörr, J.M. Vitamin D in the Prevention, Prediction and Treatment of Neurodegenerative and Neuroinflammatory Diseases. EPMA J. 2017, 8, 313–325. [Google Scholar] [CrossRef] [Scilit]
- Banerjee, A.; Khemka, V.K.; Ganguly, A.; Roy, D.; Ganguly, U.; Chakrabarti, S. Vitamin D and Alzheimer’s Disease: Neurocognition to Therapeutics. Int. J. Alzheimer’s Dis. 2015, 2015, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Jia, J.; Hu, J.; Huo, X.; Miao, R.; Zhang, Y.; Ma, F. Effects of Vitamin D Supplementation on Cognitive Function and Blood Aβ-Related Biomarkers in Older Adults with Alzheimer’s Disease: A Randomised, Double-Blind, Placebo-Controlled Trial. J. Neurol. Neurosurg. Psychiatry 2019, 90, 1347–1352. [Google Scholar] [CrossRef] [Scilit]
- Morello, M.; Landel, V.; Lacassagne, E.; Baranger, K.; Annweiler, C.; Féron, F.; Millet, P. Vitamin D Improves Neurogenesis and Cognition in a Mouse Model of Alzheimer’s Disease. Mol. Neurobiol. 2018, 55, 6463–6479. [Google Scholar] [CrossRef] [Scilit]
- Araújo de Lima, L.; Oliveira Cunha, P.L.; Felicio Calou, I.B.; Tavares Neves, K.R.; Facundo, H.T.; Socorro de Barros Viana, G. Effects of Vitamin D (VD3) Supplementation on the Brain Mitochondrial Function of Male Rats, in the 6-OHDA-Induced Model of Parkinson’s Disease. Neurochem. Int. 2022, 154, 105280. [Google Scholar] [CrossRef] [Scilit]
- Bargsted, L.; Hetz, C.; Matus, S. ERp57 in Neurodegeneration and Regeneration. Neural Regen. Res. 2016, 11, 232–233. [Google Scholar] [CrossRef] [Scilit]
- Ghemrawi, R.; Khair, M. Endoplasmic Reticulum Stress and Unfolded Protein Response in Neurodegenerative Diseases. Int. J. Mol. Sci. 2020, 21, 6127. [Google Scholar] [CrossRef] [Scilit]
- Montibeller, L.; de Belleroche, J. Amyotrophic Lateral Sclerosis (ALS) and Alzheimer’s Disease (AD) Are Characterised by Differential Activation of ER Stress Pathways: Focus on UPR Target Genes. Cell Stress Chaperones 2018, 23, 897–912. [Google Scholar] [CrossRef] [Scilit]
- Gezen-Ak, D.; Dursun, E. Molecular Basis of Vitamin D Action in Neurodegeneration: The Story of a Team Perspective. Hormones 2019, 18, 17–21. [Google Scholar] [CrossRef] [Scilit]
- Grindel, B.J.; Rohe, B.; Safford, S.E.; Bennett, J.J.; Farach-Carson, M.C. Tumor Necrosis Factor-α Treatment of HepG2 Cells Mobilizes a Cytoplasmic Pool of ERp57/1,25D 3-MARRS to the Nucleus. J. Cell. Biochem. 2011, 112, 2606–2615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, W.; Beilhartz, G.; Roy, Y.; Richard, C.L.; Curtin, M.; Brown, L.; Cadieux, D.; Coppolino, M.; Farach-Carson, M.C.; Nemere, I.; et al. Nuclear Translocation of the 1,25D3-MARRS (Membrane Associated Rapid Response to Steroids) Receptor Protein and NFκB in Differentiating NB4 Leukemia Cells. Exp. Cell Res. 2010, 316, 1101–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eufemi, M.; Coppari, S.; Altieri, F.; Grillo, C.; Ferraro, A.; Turano, C. ERp57 Is Present in STAT3-DNA Complexes. Biochem. Biophys. Res. Commun. 2004, 323, 1306–1312. [Google Scholar] [CrossRef] [Scilit]
- Guo, G.G.; Patel, K.; Kumar, V.; Shah, M.; Fried, V.A.; Etlinger, J.D.; Sehgal, P.B. Association of the Chaperone Glucose-Regulated Protein 58 (GRP58/ER-60/ERp57) with Stat3 in Cytosol and Plasma Membrane Complexes. J. Interf. Cytokine Res. 2002, 22, 555–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galy, B.; Conrad, M.; Muckenthaler, M. Mechanisms Controlling Cellular and Systemic Iron Homeostasis. Nat. Rev. Mol. Cell Biol. 2023, 2023, 1–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Puig, S.; Ramos-Alonso, L.; Romero, A.M.; Martínez-Pastor, M.T. The Elemental Role of Iron in DNA Synthesis and Repair. Metallomics 2017, 9, 1483–1500. [Google Scholar] [CrossRef] [Scilit]
- Tamer, F.; Yuksel, M.; Karabag, Y. Serum Ferritin and Vitamin D Levels Should Be Evaluated in Patients with Diffuse Hair Loss Prior to Treatment. Adv. Dermatol. Allergol. 2020, 37, 407–411. [Google Scholar] [CrossRef] [Scilit]
- Yoon, H.; Young Bae, N.; Young Gi, M.; Yeon Park, B.; Min Seong, J. The Association between Serum Ferritin and 25-Hydroxyvitamin D and Metabolic Syndrome in Korean Women: The Korea National Health and Nutrition Examination Survey 2010–2012. J. Clin. Biochem. Nutr. 2017, 61, 60–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, E.M.; Tangpricha, V. Vitamin D and Anemia: Insights into an Emerging Association. Curr. Opin. Endocrinol. Diabetes Obes. 2015, 22, 432–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mogire, R.M.; Muriuki, J.M.; Morovat, A.; Mentzer, A.J.; Webb, E.L.; Kimita, W.; Ndungu, F.M.; Macharia, A.W.; Cutland, C.L.; Sirima, S.B.; et al. Vitamin D Deficiency and Its Association with Iron Deficiency in African Children. Nutrients 2022, 14, 1372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, G.; Eder, K.; Ringseis, R. 1,25-Hydroxyvitamin D3 Decreases Endoplasmic Reticulum Stress-Induced Inflammatory Response in Mammary Epithelial Cells. PLoS ONE 2020, 15, e0228945. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ImageJ. Available online: https://imagej.nih.gov/ij/index.html (accessed on 24 October 2023).












| Primer | Sequence 5′→3′ |
|---|---|
| β-actin forward | CCCGCGAGTACAACCTTCTT |
| β-actin reverse | TCATCCATGGCGAACTGGTG |
| CX3CL1 forward | TACCTGTAGCTTTGCTCATC |
| CX3CL1 reverse | GTCTCGTCTCCAAGATGATT |
| DDIT3 forward | AATGAAAGGAAAGTGGCACA |
| DDIT3 reverse | ATTCACCATTCGGTCAATCA |
| DMT-1 forward | GTGGTTACTGGGCTGCATCT |
| DMT-1 reverse | CCCACAGAGGAATTCTTCCT |
| FPN forward | TTCCTTCTCTACCTTGGTCA |
| FPN reverse | AAAGGAGGCTGTTTCCATAG |
| FTH forward | GAGGTGCCCGAATCTTCCTTC |
| FTH reverse | TCAGTGGCCAGTTTGTGCAG |
| HAMP forward | CAGCTGGATGCCCATGTT |
| HAMP reverse | TGCAGCACATCCCACACT |
| HSPA5 forward | GTCCCACAGATTGAAGTCAC |
| HSPA5 reverse | CGATTTCTTCAGGTGTCAGG |
| PDIA3 forward | TGTGGTCACTGTAAGAACCT |
| PDIA3 reverse | ATCCATCTTGGCTATGACGA |
| XBP-1 unspliced forward | TGAGAACCAGGAGTTAAGACA |
| XBP-1 unspliced reverse | AGAGGTGCACGTAGTCTG |
| XBP-1 spliced forward | GCTTAGTCCGCAGCAGGT |
| XBP-1 spliced reverse | GAGTCAATACCGCCAGAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jánosa, G.; Pandur, E.; Pap, R.; Horváth, A.; Sipos, K. Interplay of Vitamin D, Unfolded Protein Response, and Iron Metabolism in Neuroblastoma Cells: A Therapeutic Approach in Neurodegenerative Conditions. Int. J. Mol. Sci. 2023, 24, 16883. https://doi.org/10.3390/ijms242316883
Jánosa G, Pandur E, Pap R, Horváth A, Sipos K. Interplay of Vitamin D, Unfolded Protein Response, and Iron Metabolism in Neuroblastoma Cells: A Therapeutic Approach in Neurodegenerative Conditions. International Journal of Molecular Sciences. 2023; 24(23):16883. https://doi.org/10.3390/ijms242316883
Chicago/Turabian StyleJánosa, Gergely, Edina Pandur, Ramóna Pap, Adrienn Horváth, and Katalin Sipos. 2023. "Interplay of Vitamin D, Unfolded Protein Response, and Iron Metabolism in Neuroblastoma Cells: A Therapeutic Approach in Neurodegenerative Conditions" International Journal of Molecular Sciences 24, no. 23: 16883. https://doi.org/10.3390/ijms242316883
APA StyleJánosa, G., Pandur, E., Pap, R., Horváth, A., & Sipos, K. (2023). Interplay of Vitamin D, Unfolded Protein Response, and Iron Metabolism in Neuroblastoma Cells: A Therapeutic Approach in Neurodegenerative Conditions. International Journal of Molecular Sciences, 24(23), 16883. https://doi.org/10.3390/ijms242316883

