Increased Synovial CD14 mRNA Expression and Proportion of CD14high Subsets in Early-Stage Hip Osteoarthritis: Propensity Matched Score Analysis
Abstract
:1. Introduction
2. Results
2.1. Patients’ Clinical and Radiographic Data in EOA and LOA before and after Propensity Matching
2.2. Differences in Synovial CD14 Expression in Patients with Early and Late Osteoarthritis
2.3. Differences in Synovial CD14 Expression and Pain Intensity
2.4. Differences in the Proportion of CD14+ Cell Subsets in Patients with Early (EOA) and Late (LOA) Hip Osteoarthritis
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. Clinical Assessment
4.3. RT-PCR Analysis
4.4. Flow Cytometric Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mahmoudian, A.; Lohmander, L.S.; Mobasheri, A.; Englund, M.; Luyten, F.P. Early-stage symptomatic osteoarthritis of the knee—time for action. Nat. Rev. Rheumatol. 2021, 17, 621–632. [Google Scholar] [CrossRef] [PubMed]
- Roos, E.M.; Arden, N.K. Strategies for the prevention of knee osteoarthritis. Nat. Rev. Rheumatol. 2016, 12, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Griffin, D.W.; Kinnard, M.J.; Formby, P.M.; McCabe, M.P.; Anderson, T.D. Outcomes of Hip Arthroscopy in the Older Adult: A Systematic Review of the Literature. Am. J. Sports Med. 2017, 45, 1928–1936. [Google Scholar] [CrossRef] [PubMed]
- Kyin, C.; Maldonado, D.R.; Go, C.C.; Shapira, J.; Lall, A.C.; Domb, B.G. Mid- to Long-Term Outcomes of Hip Arthroscopy: A Systematic Review. Arthroscopy 2021, 37, 1011–1025. [Google Scholar] [CrossRef]
- Maradit Kremers, H.; Schilz, S.R.; Van Houten, H.K.; Herrin, J.; Koenig, K.M.; Bozic, K.J.; Berry, D.J. Trends in Utilization and Outcomes of Hip Arthroscopy in the United States Between 2005 and 2013. J. Arthroplasty 2017, 32, 750–755. [Google Scholar] [CrossRef]
- Hall, M.; van der Esch, M.; Hinman, R.S.; Peat, G.; de Zwart, A.; Quicke, J.G.; Runhaar, J.; Knoop, J.; van der Leeden, M.; de Rooij, M.; et al. How does hip osteoarthritis differ from knee osteoarthritis? Osteoarthr. Cartil. 2022, 30, 32–41. [Google Scholar] [CrossRef]
- Ahedi, H.; Aitken, D.; Blizzard, L.; Cicuttini, F.; Jones, G. Quantification of hip effusion-synovitis and its cross-sectional and longitudinal associations with hip pain, MRI findings and early radiographic hip OA. BMC Musculoskelet. Disord. 2020, 21, 533. [Google Scholar] [CrossRef]
- Mathiessen, A.; Conaghan, P.G. Synovitis in osteoarthritis: Current understanding with therapeutic implications. Arthritis Res. Ther. 2017, 19, 18. [Google Scholar] [CrossRef] [Green Version]
- Philpott, H.T.; Birmingham, T.B.; Pinto, R.; Primeau, C.A.; Arsenault, D.; Lanting, B.A.; Zhu, Y.; Appleton, C.T.; Group, W.K.S. Synovitis Is Associated With Constant Pain in Knee Osteoarthritis: A Cross-sectional Study of OMERACT Knee Ultrasound Scores. J. Rheumatol. 2022, 49, 89–97. [Google Scholar] [CrossRef]
- Sanchez-Lopez, E.; Coras, R.; Torres, A.; Lane, N.E.; Guma, M. Synovial inflammation in osteoarthritis progression. Nat. Rev. Rheumatol. 2022, 18, 258–275. [Google Scholar] [CrossRef]
- Benito, M.J.; Veale, D.J.; FitzGerald, O.; van den Berg, W.B.; Bresnihan, B. Synovial tissue inflammation in early and late osteoarthritis. Ann. Rheum. Dis. 2005, 64, 1263–1267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ene, R.; Sinescu, R.D.; Ene, P.; Cirstoiu, M.M.; Cirstoiu, F.C. Synovial inflammation in patients with different stages of knee osteoarthritis. Rom. J. Morphol. Embryol. 2015, 56, 169–173. [Google Scholar] [PubMed]
- Koyama, T.; Uchida, K.; Fukushima, K.; Ohashi, Y.; Uchiyama, K.; Inoue, G.; Takahira, N.; Takaso, M. Elevated levels of TNF-alpha, IL-1beta and IL-6 in the synovial tissue of patients with labral tear: A comparative study with hip osteoarthritis. BMC Musculoskelet. Disord. 2021, 22, 33. [Google Scholar] [CrossRef] [PubMed]
- Andres-Rodriguez, L.; Borras, X.; Feliu-Soler, A.; Perez-Aranda, A.; Angarita-Osorio, N.; Moreno-Peral, P.; Montero-Marin, J.; Garcia-Campayo, J.; Carvalho, A.F.; Maes, M.; et al. Peripheral immune aberrations in fibromyalgia: A systematic review, meta-analysis and meta-regression. Brain Behav. Immun. 2020, 87, 881–889. [Google Scholar] [CrossRef]
- Chen, O.; Donnelly, C.R.; Ji, R.R. Regulation of pain by neuro-immune interactions between macrophages and nociceptor sensory neurons. Curr Opin Neurobiol 2020, 62, 17–25. [Google Scholar] [CrossRef]
- Dean, B.J.; Gettings, P.; Dakin, S.G.; Carr, A.J. Are inflammatory cells increased in painful human tendinopathy? A systematic review. Br. J. Sports Med. 2016, 50, 216–220. [Google Scholar] [CrossRef]
- Djuric, N.; Lafeber, G.C.M.; Vleggeert-Lankamp, C.L.A. The contradictory effect of macrophage-related cytokine expression in lumbar disc herniations: A systematic review. Eur. Spine J. 2020, 29, 1649–1659. [Google Scholar] [CrossRef] [Green Version]
- Lopes, E.B.P.; Filiberti, A.; Husain, S.A.; Humphrey, M.B. Immune Contributions to Osteoarthritis. Curr. Osteoporos. Rep. 2017, 15, 593–600. [Google Scholar] [CrossRef]
- Miller, R.J.; Malfait, A.M.; Miller, R.E. The innate immune response as a mediator of osteoarthritis pain. Osteoarthritis Cartil. 2020, 28, 562–571. [Google Scholar] [CrossRef]
- Zhang, H.; Cai, D.; Bai, X. Macrophages regulate the progression of osteoarthritis. Osteoarthr. Cartil. 2020, 28, 555–561. [Google Scholar] [CrossRef]
- Landmann, R.; Muller, B.; Zimmerli, W. CD14, new aspects of ligand and signal diversity. Microbes Infect. 2000, 2, 295–304. [Google Scholar] [CrossRef]
- Takano, S.; Uchida, K.; Inoue, G.; Miyagi, M.; Aikawa, J.; Iwase, D.; Iwabuchi, K.; Matsumoto, T.; Satoh, M.; Mukai, M.; et al. Nerve growth factor regulation and production by macrophages in osteoarthritic synovium. Clin. Exp. Immunol. 2017, 190, 235–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daghestani, H.N.; Pieper, C.F.; Kraus, V.B. Soluble macrophage biomarkers indicate inflammatory phenotypes in patients with knee osteoarthritis. Arthritis Rheumatol. 2015, 67, 956–965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yokozeki, Y.; Kawakubo, A.; Miyagi, M.; Kuroda, A.; Sekiguchi, H.; Inoue, G.; Takaso, M.; Uchida, K. Reduced TGF-beta Expression and CD206-Positive Resident Macrophages in the Intervertebral Discs of Aged Mice. Biomed. Res. Int. 2021, 2021, 7988320. [Google Scholar] [CrossRef] [PubMed]
- Ostojic, M.; Zevrnja, A.; Vukojevic, K.; Soljic, V. Immunofluorescence Analysis of NF-kB and iNOS Expression in Different Cell Populations during Early and Advanced Knee Osteoarthritis. Int. J. Mol. Sci. 2021, 22, 6461. [Google Scholar] [CrossRef]
- Uchida, K.; Takano, S.; Matsumoto, T.; Nagura, N.; Inoue, G.; Itakura, M.; Miyagi, M.; Aikawa, J.; Iwase, D.; Minatani, A.; et al. Transforming growth factor activating kinase 1 regulates extracellular matrix degrading enzymes and pain-related molecule expression following tumor necrosis factor-alpha stimulation of synovial cells: An in vitro study. BMC Musculoskelet. Disord. 2017, 18, 283. [Google Scholar] [CrossRef] [Green Version]
- Daguet, I.; Bergeron-Vezina, K.; Harvey, M.P.; Martel, M.; Coulombe-Leveque, A.; Leonard, G. Decreased Initial Peak Pain Sensation with Aging: A Psychophysical Study. J. Pain Res. 2020, 13, 2333–2341. [Google Scholar] [CrossRef]
- Gibson, S.J.; Farrell, M. A review of age differences in the neurophysiology of nociception and the perceptual experience of pain. Clin. J. Pain 2004, 20, 227–239. [Google Scholar] [CrossRef]
- Lautenbacher, S.; Peters, J.H.; Heesen, M.; Scheel, J.; Kunz, M. Age changes in pain perception: A systematic-review and meta-analysis of age effects on pain and tolerance thresholds. Neurosci. Biobehav. Rev. 2017, 75, 104–113. [Google Scholar] [CrossRef]
- Luo, Q.; Xiao, P.; Li, X.; Deng, Z.; Qing, C.; Su, R.; Xu, J.; Guo, Y.; Huang, Z.; Li, J. Overexpression of CD64 on CD14(++)CD16(-) and CD14(++)CD16(+) monocytes of rheumatoid arthritis patients correlates with disease activity. Exp. Ther. Med. 2018, 16, 2703–2711. [Google Scholar] [CrossRef]
- Rossol, M.; Kraus, S.; Pierer, M.; Baerwald, C.; Wagner, U. The CD14(bright) CD16+ monocyte subset is expanded in rheumatoid arthritis and promotes expansion of the Th17 cell population. Arthritis Rheum. 2012, 64, 671–677. [Google Scholar] [CrossRef] [PubMed]
- Tsukamoto, M.; Seta, N.; Yoshimoto, K.; Suzuki, K.; Yamaoka, K.; Takeuchi, T. CD14(bright)CD16+ intermediate monocytes are induced by interleukin-10 and positively correlate with disease activity in rheumatoid arthritis. Arthritis Res. Ther. 2017, 19, 28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dande, A.; Kocsis, B.; Lorinczy, D. Thermal analysis of synovial fluids in different stages of osteoarthritis and after bacterial infections. J. Therm. Anal. Calorim. 2020, 142, 797–808. [Google Scholar] [CrossRef] [Green Version]
- Kovalenko, B.; Bremjit, P.; Fernando, N. Classifications in Brief: Tonnis Classification of Hip Osteoarthritis. Clin. Orthop. Relat. Res. 2018, 476, 1680–1684. [Google Scholar] [CrossRef] [PubMed]
- Agricola, R.; Heijboer, M.P.; Roze, R.H.; Reijman, M.; Bierma-Zeinstra, S.M.; Verhaar, J.A.; Weinans, H.; Waarsing, J.H. Pincer deformity does not lead to osteoarthritis of the hip whereas acetabular dysplasia does: Acetabular coverage and development of osteoarthritis in a nationwide prospective cohort study (CHECK). Osteoarthritis Cartil. 2013, 21, 1514–1521. [Google Scholar] [CrossRef] [Green Version]
- Agricola, R.; Waarsing, J.H.; Arden, N.K.; Carr, A.J.; Bierma-Zeinstra, S.M.; Thomas, G.E.; Weinans, H.; Glyn-Jones, S. Cam impingement of the hip: A risk factor for hip osteoarthritis. Nat. Rev. Rheumatol. 2013, 9, 630–634. [Google Scholar] [CrossRef]
- Lefaucheur, J.P.; Drouot, X.; Keravel, Y.; Nguyen, J.P. Pain relief induced by repetitive transcranial magnetic stimulation of precentral cortex. Neuroreport 2001, 12, 2963–2965. [Google Scholar] [CrossRef]
- Smith, T.J.; Staats, P.S.; Deer, T.; Stearns, L.J.; Rauck, R.L.; Boortz-Marx, R.L.; Buchser, E.; Catala, E.; Bryce, D.A.; Coyne, P.J.; et al. Randomized clinical trial of an implantable drug delivery system compared with comprehensive medical management for refractory cancer pain: Impact on pain, drug-related toxicity, and survival. J. Clin. Oncol. 2002, 20, 4040–4049. [Google Scholar] [CrossRef]
- Ohashi, Y.; Uchida, K.; Fukushima, K.; Satoh, M.; Koyama, T.; Tsuchiya, M.; Saito, H.; Uchiyama, K.; Takahira, N.; Inoue, G.; et al. Correlation between CD163 expression and resting pain in patients with hip osteoarthritis: Possible contribution of CD163+ monocytes/macrophages to pain pathogenesis. J. Orthop. Res. 2022, 40, 1365–1374. [Google Scholar] [CrossRef]
- Ohashi, Y.; Uchida, K.; Fukushima, K.; Satoh, M.; Koyama, T.; Tsuchiya, M.; Saito, H.; Takahira, N.; Inoue, G.; Takaso, M. NGF Expression and Elevation in Hip Osteoarthritis Patients with Pain and Central Sensitization. BioMed Res. Int. 2021, 2021, 9212585. [Google Scholar] [CrossRef]
Before Propensity Matching | After Propensity Matching | |||||
---|---|---|---|---|---|---|
EOA (N = 34) | LOA (N = 80) | p | EOA (N = 16) | LOA (N = 16) | p | |
Sex, female/male, N | 25/9 | 69/11 | 0.102 | 12/4 | 12/4 | 1.000 |
Age, years | 43.0 ± 16.0 | 65.9 ± 11.2 | <0.001 | 53.9 ± 8.3 | 54.0 ± 9.1 | 0.956 |
Height, cm | 164.4 ± 8.7 | 154.3 ± 8.6 | <0.001 | 160.7 ± 10.8 | 162.7 ± 6.9 | 0.642 |
Weight, kg | 60.6 ± 9.7 | 58.3 ± 13.7 | 0.221 | 61.3 ± 8.4 | 62.6 ± 15.9 | 0.867 |
BMI, kg/m2 | 22.7 ± 4.1 | 24.5 ± 4.5 | 0.052 | 23.8 ± 2.8 | 23.6 ± 5.6 | 0.590 |
Tönnis grade (0/1/2/3), N | 27/7/0/0 | 0/0/21/59 | <0.001 | 11/5/0/0 | 0/0/3/13 | <0.001 |
α-angle ≥ 60°, N (%) | 11 (32.4) | 2 (12.5) | ||||
LCE angle ≤ 25°, N (%) | 14 (41.2) | 10 (62.5) | ||||
Combined, N (%) | 5 (14.7) | 2 (12.5) | ||||
VAS pain ≥5/<5 cm, N | 20/14 | 53/27 | 0.450 | 12/4 | 12/4 | 1.000 |
Primer | Sequence (5′-3′) | Product Size (bp) |
---|---|---|
CD14-F | TCCCTCAATCTGTCGTTCGC | 150 |
CD14-R | ATTCCCGTCCAGTGTCAGGT | |
GAPDH-F | TGTTGCCATCAATGACCCCTT | 202 |
GAPDH-R | CTCCACGACGTACTCAGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ohashi, Y.; Uchida, K.; Fukushima, K.; Satoh, M.; Koyama, T.; Tsuchiya, M.; Saito, H.; Uchiyama, K.; Takahira, N.; Inoue, G.; et al. Increased Synovial CD14 mRNA Expression and Proportion of CD14high Subsets in Early-Stage Hip Osteoarthritis: Propensity Matched Score Analysis. Int. J. Mol. Sci. 2022, 23, 13622. https://doi.org/10.3390/ijms232113622
Ohashi Y, Uchida K, Fukushima K, Satoh M, Koyama T, Tsuchiya M, Saito H, Uchiyama K, Takahira N, Inoue G, et al. Increased Synovial CD14 mRNA Expression and Proportion of CD14high Subsets in Early-Stage Hip Osteoarthritis: Propensity Matched Score Analysis. International Journal of Molecular Sciences. 2022; 23(21):13622. https://doi.org/10.3390/ijms232113622
Chicago/Turabian StyleOhashi, Yoshihisa, Kentaro Uchida, Kensuke Fukushima, Masashi Satoh, Tomohisa Koyama, Maho Tsuchiya, Hiroki Saito, Katsufumi Uchiyama, Naonobu Takahira, Gen Inoue, and et al. 2022. "Increased Synovial CD14 mRNA Expression and Proportion of CD14high Subsets in Early-Stage Hip Osteoarthritis: Propensity Matched Score Analysis" International Journal of Molecular Sciences 23, no. 21: 13622. https://doi.org/10.3390/ijms232113622
APA StyleOhashi, Y., Uchida, K., Fukushima, K., Satoh, M., Koyama, T., Tsuchiya, M., Saito, H., Uchiyama, K., Takahira, N., Inoue, G., & Takaso, M. (2022). Increased Synovial CD14 mRNA Expression and Proportion of CD14high Subsets in Early-Stage Hip Osteoarthritis: Propensity Matched Score Analysis. International Journal of Molecular Sciences, 23(21), 13622. https://doi.org/10.3390/ijms232113622