Next Article in Journal
Importance of Matrix Cues on Intervertebral Disc Development, Degeneration, and Regeneration
Next Article in Special Issue
Network-Based Approaches for Disease-Gene Association Prediction Using Protein-Protein Interaction Networks
Previous Article in Journal
Identification of Candidate Genes Regulating Drought Tolerance in Pearl Millet
Previous Article in Special Issue
Effect of Betaine and Arginine on Interaction of αB-Crystallin with Glycogen Phosphorylase b
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Structure-Functional Characteristics of the Svx Protein—The Virulence Factor of the Phytopathogenic Bacterium Pectobacterium atrosepticum

1
Kazan Institute of Biochemistry and Biophysics, FRC Kazan Scientific Center of RAS, 420111 Kazan, Russia
2
Kazan Federal University, 420008 Kazan, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(13), 6914; https://doi.org/10.3390/ijms23136914
Submission received: 20 May 2022 / Revised: 17 June 2022 / Accepted: 20 June 2022 / Published: 21 June 2022
(This article belongs to the Special Issue Recent Advances in Protein-Protein Interactions)

Abstract

The Svx proteins are virulence factors of phytopathogenic bacteria of the Pectobacterium genus. The specific functions of these proteins are unknown. Here we show that most of the phytopathogenic species of Pectobacterium, Dickeya, and Xanthomonas genera have genes encoding Svx proteins, as well as some plant-non-associated species of different bacterial genera. As such, the Svx-like proteins of phytopathogenic species form a distinct clade, pointing to the directed evolution of these proteins to provide effective interactions with plants. To get a better insight into the structure and functions of the Svx proteins, we analyzed the Svx of Pectobacterium atrosepticum (Pba)—an extracellular virulence factor secreted into the host plant cell wall (PCW). Using in silico analyses and by obtaining and analyzing the recombinant Pba Svx and its mutant forms, we showed that this protein was a gluzincin metallopeptidase. The 3D structure model of the Pba Svx was built and benchmarked against the experimental overall secondary structure content. Structure-based substrate specificity analysis using molecular docking revealed that the Pba Svx substrate-binding pocket might accept α-glycosylated proteins represented in the PCW by extensins—proteins that strengthen the PCW. Thus, these results elucidate the way in which the Pba Svx may contribute to the Pba virulence.

1. Introduction

Members of the soft rot Pectobacteriaceae (SRP), including Pectobacterium atrosepticum (Pba), cause severe plant diseases [1]. These bacteria produce multiple plant cell wall degrading enzymes (PCWDEs), leading to host plant tissue maceration [2]. However, PCWDEs alone are not sufficient to provide full virulence to Pectobacterium species, and additional virulence factors significantly contribute to the manifestation of disease caused by these bacteria, e.g., Nip protein [3,4], type 3 secretion system (T3SS) [5,6], type 6 secretion system (T6SS) [7,8], coronafacic acid [9,10,11], and Svx protein [12].
The Svx protein is one of the “black horses” of plant-pathogen interactions. The homolog of this protein (AvrXca) has been first described as an avirulence factor of Xanthomonas campestis pv. raphani 1067 [13]. The transfer of a gene avrXca of the avirulent strain X. campestis pv. raphani 1067 to virulent strains of X. campestis resulted in the reduced virulence of the latter. However, the avrXca genes were also identified in virulent Xanthomonas strains [13], indicating that different AvrXca proteins may act in different ways in terms of plant-pathogen interactions.
In Pba, the Svx protein has been shown to act as a virulence factor since the knockout of the svx gene reduced the ability of the pathogen to cause disease [12]. The known Svx homologs (Svx of Pectobacterium, AvrXca of Xanthomonas, and AvrL of another SRP genus Dickeya) are secreted proteins [12,13,14]. In Pba and Dickeya dadantii, these proteins are transferred via the type two secretion system (T2SS), as well as most of the PCWDEs, to the environment, including the host plant apoplast [12,14]. Similar to many virulence factors, the production of the Pba Svx protein is induced by quorum sensing and host plant metabolites, including pectic compounds [7,12]. The expression of the Pba svx gene is highly upregulated in planta at both asymptomatic and symptomatic colonization stages [10].
Although information about the regulation of the Svx protein production and its secretion exists, nothing is known about the mechanism of action of this virulence factor. Therefore, the aim of our study was to get a better insight into the mechanism of action of the Pba Svx protein during plant-microbe interactions. We analyzed the diversity of the Svx-like proteins and performed their phylogenetic analysis. By using different in silico approaches, we predicted functional domains within the Pba Svx protein, one of which, the peptidase domain, was verified using the recombinant protein and its mutant forms. Furthermore, the 3D structure model of the Pba Svx protein was built and benchmarked against the experimental overall secondary structure content of the protein. The structure-based substrate specificity analysis using molecular docking distinguished a potential target of the Pba Svx protein among the host plant proteins.

2. Results

2.1. Phylogenetic Analysis of the Svx-like Proteins

A phylogenetic analysis was performed to characterize the diversity of the Svx-like proteins and assess possible relationships between the features of their primary structure and the ecology of the bacteria producing them. Using the DELTA-BLAST algorithm [15,16], we identified 69 Svx-like proteins that had a coverage level higher than 76% and an identity of 40.81% to 97.64% (E-value < 7–128) with the Pba Svx protein (WP_011092533.1). These proteins were found in Gammaproteobacteria (genera Pectobacterium, Dickeya, Xanthomonas, Zymobacter, Samsonia, Vibrio, Teredinibacter, Microbulbifer), Alphaproteobacteria (genera Asticcacaulis, Sphingomonas, Novosphingobium, Sphingobium), and Deltaproteobacteria (genera Corallococcus, Cystobacter, Stigmatella, Pyxidicoccus) (Figure 1).
The Svx proteins of phytopathogenic species of Gammaproteobacteria (Pectobacterium species, Dickeya species, Xanthomonas species, and Samsonia erythrinae), along with a similar protein of a plant endophytic Gammaproteobacterium Zymobacter palmae [1,17,18,19,20], formed a separate clade G (Figure 1). Svx-like proteins were found in all species of the Pectobacterium and Dickeya (except D. poaceiphila) genera. The genomes of some Dickeya species contain two slightly distinct genes encoding the Svx-like proteins. Within the Xanthomonas genera, in most (X. campestris, X. transculens, X. arboricola, X. dyei, X. hortorum, X. cucurbitae, X. floridensis, X. sacchari, X. sontii, X. citri, X. codiaei, X. nasturtii, X. melonis, X. pisi, X. vesicatoria, X. cannabis), but not all species, genes encoding Svx-like proteins were revealed.
The Svx-like proteins of free-living Alphaproteobacteria formed two other clades (A-1 and A-2) (Figure 1). The fourth clade (DG) was represented by the proteins of Deltaproteobacteria and non-phytopathogenic species of Gammaproteobacteria. Thus, the Svx-like proteins of Gammaproteobacteria split into phylogenetically distant groups (G and DG): the proteins of phytopathogenic and one plant endophytic Gammaproteobacteria constituted the first clade (G), while those of non-phytopathogenic/non-plant endophytic Gammaproteobacteria—Vibrio quintilis (inhabitant of sea water, [21]), Vibrio mangrovi (inhabitant of the rhizosphere of mangrove-associated wild rice, [22]), Microbulbifer rhizospaerae (inhabitant of the rhizosphere of halophilic plants, [23]), and Teredinibacter turnerae (symbiont of mollusk, [24])—located in the fourth clade (DG). Based on multi-protein phylogeny [25] and 16S rRNA sequence, Pectobacterium, Dickeya, and Samsonia are phylogenetically closer to Vibrio, Teredinibacter, and Microbulbifer than to Xanthomonas species. Despite that, the Svx proteins of Pectobacterium, Dickeya, and Samsonia were phylogenetically closer to the Svx proteins of Xanthomonas species than to those of the Vibrio, Teredinibacter, and Microbulbifer species.
The differences between the Svx-like proteins of the G and DG clades were related to the presence of insertions and deletions in the representatives of the DG clade. In some of the proteins of the DG clade, additional functional domains were revealed. In addition to the metallopeptidase domain and left-handed parallel beta-helix (LbH) domain (acyltransferase-like domain) revealed in the Svx-like proteins of all clades, in the Svx-like proteins of Vibrio mangrove, two fibronectin type III-like domains were found, while in the Svx-like proteins of Teredinibacter turnerae, a cellulose-binding II/carbohydrate binding (CBM 35) domain was present (Figure S1).
In almost all of the revealed Svx-like proteins (except for Zymobacter palmae), signal peptides were found, indicating that these proteins were either extracellular or plasma membrane-localized. The Svx-like proteins of Pectobacterium, Dickeya, Samsonia, Xanthomonas, Vibrio, Teredinibacter, Novosphingobium, and Stigmatella have Sec/SPI type signal peptides, while the Svx-like proteins of Sphingobium possess Tat/SPI type signal peptides. Both Sec/SPI and Tat/SPI signal peptides are usually characteristic of extracellular proteins. In the Svx-like proteins of Sphingomonas, Asticcacaulis, Cystobacter, Corallococcus, Pyxidicoccus, and Microbulbifer, the Sec/SPII signal peptides characteristic of membrane lipoproteins [27] were revealed.

2.2. Identification and Experimental Verification of the Peptidase Domain of the Svx Protein of P. atrosepticum

The analysis of the primary structure of the Pba Svx protein with I-Tasser [28,29] and Phyre 2 [30,31] servers revealed the peptidase domain in the region of 43–445 amino acids. The revealed peptidase domain was similar to the peptidase domains of gluzincin extracellular metallopeptidases, whose catalytic sites are formed by the conservative zinc-binding motif HEXXHX(8,28)E (X–denotes any amino acid) [32]. The alignment of the amino acid sequence of the Pba Svx protein with other bacterial gluzincin metallopeptidases showed that the Pba Svx protein possessed the HEXXHX(8,28)E motif (Figure 2), supporting the predicted peptidase activity of the Pba Svx protein.
In order to verify whether the Pba Svx protein is a metallopeptidase, the recombinant protein was obtained. The enzymatic assay with azocasein as a substrate proved that the Pba Svx protein possessed peptidase activity, which was most pronounced at a pH of 7.5 and 40 °C (Figure 3).
So as to confirm that zinc-binding motif HEXXHX(8,28)E determined the peptidase activity of the Pba Svx protein, the influence of Zn2+ ions (ZnSO4) and metal chelator ethylenediaminetetraacetic acid (EDTA) on the peptidase activity of the Pba Svx protein was determined. Additionally, we obtained two mutant Svx proteins: SvxΔE141A and SvxΔE167A, in which glutamic acid residues of the HEXXHX(8,28)E motif were substituted for alanine, and the activity of mutant enzymes was compared to that of the wild type (Figure 4).
The addition of 1 mM ZnSO4 to the Pba Svx protein preparation increased its peptidase activity by 20%, while the presence of 1 mM EDTA totally inhibited the peptidase activity (Figure 4). The addition of 1 mM or 2 mM ZnSO4 gradually restored the peptidase activity of Pba Svx protein in the presence of 1 mM EDTA. The mutant proteins SvxΔE141A and SvxΔE167A displayed 3.1- and 3.5-fold lower peptidase activity, respectively, compared to that of the wild-type protein (Figure 4). Thus, our results showed that the Pba Svx protein was a gluzincin metallopeptidase, whose active site was formed by the conservative zinc-binding motif HEXXHX(22)E.

2.3. Study of the Secondary Structure of the Svx Protein of P. atrosepticum

To characterize the secondary structure of the Pba Svx, in silico analyses of its amino acid sequence were performed using the PSIPRED [43,44] and AlphaFold 2 [45,46] servers, and its solution conformation was studied using far-UV circular dichroism (CD) spectroscopy. The in silico analyses revealed alpha-helices, beta-sheets, turns, and unordered structures within the Pba Svx protein (Table 1). The CD spectra of the Pba Svx protein displayed a positive peak around 195 nm and a negative peak around 215 nm, both of which are characteristic of the beta-sheet structural motifs (Figure 5). A broad negative ellipticity between 208 and 222 nm and small distinct minima at 210 and 222 nm indicated that the Pba Svx protein possessed some alpha-helical structures under the experimental conditions. No concentration-dependent changes in the CD spectra of the Pba Svx protein were observed within the studied range (0.1–0.4 mg/mL) (Figure 5).
In order to determine the content of the secondary structures in the Pba Svx protein, the Dichroweb internet server was used. The CONTINLL method [47,48] was chosen to estimate the content of the secondary structures in the Pba Svx protein since it gave the best fitting of the estimated curve to the experimental points with a normalized root mean square deviation (NRMSD) ≤ 0.1. Under the studied conditions, beta-sheets were the main type (32.3 ± 0.98%) of regular conformations of the Pba Svx protein (Table 1). The alpha-helices contributed less to the secondary structure of the Pba Svx protein (17.0 ± 0.49). Turns and unordered structures constituted 21.2 ± 0.28 and 29.5 ± 0.86%, respectively, of the Pba Svx protein (Table 1). Thus, the results of the in silico and CD-spectroscopy analyses were in good agreement, indicating that the Svx protein was predominantly composed of beta-sheet structures with some alpha-helices (Table 1).

2.4. Prediction of Possible Substrates of the Svx Protein of P. atrosepticum

So as to propose possible substrates of the Pba Svx protein, its spatial structure was built using the AlphaFold 2 service (Supplementary File S1) [45,46]. The model contained two structural domains: a peptidase domain formed by α-helices and β-strands and a bacterial transferase hexapeptide (acyltransferase-like, PF00132) domain formed by a left-handed parallel β-helix (Figure 6).
The quality of the Alpha Fold 2 structure is high, with the predicted local-distance difference test (pLDDT) above 70% for the majority of the residues (Figure S2). For further analysis, we used only the metallopeptidase domain of this structure. After structure minimization, the quality of the obtained model was checked using the PROCHECK server [49,50]. The G-scores were as follows: −0.29 for the overall score, −0.25 for dihedrals, and −0.37 for covalent bonds, which reveals the high quality of the model. Eighty percent of the backbone phi-psi angles were located in the most favored regions of the Ramachandran plot, around 19% of the angles occupied allowed regions, while less than 1% of the angles were located at the border of allowed and disallowed regions; the residues located at the border were found in flexible loops. The content of the secondary structures in the computer model was in good agreement with that estimated using CD-spectroscopy and predicted by the PSIPRED algorithm (Table 1).
The search for the structural homologs of the Pba Svx protein over gluzincin family metallopeptidases showed that the peptidase domain of the Pba Svx protein had the closest folding to the peptidase domain of the O-glycopeptidase ZmpB of Clostridium perfringens (Figure S3). ZmpB is a member of the M60 family (PF13402) that includes viral enhancins and enhancin-like peptidases from animal host mucosa-associated prokaryotic and eukaryotic microbes [51]. The active site of M60 peptidases contains a catalytic site and a substrate binding site. The former includes the zinc-binding motif HEXXHX(8,28)E, which is located on two alpha-helices. The latter is a carbohydrate binding site located next to the catalytic site and formed by amino acid residues that take part in recognition of N-acetyl-galactosamine in glycoprotein substrates (such as mucin) [39,52].
The Pba Svx active site contains amino acid residues similar to those found in ZmpB glycopeptidase in both the zinc-binding motif (HEXXHX(8,28)E) and the carbohydrate-binding site (Figure 7). In addition, the amino acid residues W136, G137, and N171 of the carbohydrate-binding site are highly conserved (>80%) among Svx-homologs, implying that they also bind substrates in the majority of the Svx proteins, including the Pba Svx. Therefore, from a structural point of view, it is reasonable to presume that Pba Svx is a glycopeptidase hydrolyzing the glycosylated proteins. Moreover, since this protein is secreted by Pba into the host plant apoplast, the substrates of the Pba Svx are likely to be the glycosylated proteins of the plant cell wall.
Plant cell wall (PCW) proteins can be O-glycosylated or N-glycosylated [53]. O-glycosylated PCW proteins can be split into two major groups according to their glycosylation pattern. The first group includes extensins, hydroxyproline-rich glycoproteins, and their chimeras, the glycosylation motif of which is formed by α-galactose linked to serine followed by four hydroxyprolines (Ser-Hyp-Hyp-Hyp-Hyp) glycosylated with β-arabinose chains [53]. The second group contains arabinogalactans, in which the first carbohydrate residue of the glycosylation motif—the galactose—is attached to the hydroxyproline residue by the β-linkage [54]. In various N-glycosylated PCW proteins, the N-acetyl-glucosamine of the glycosylation motif is attached to the asparagine residue by the β-linkage [54].
The glycopeptidases from the M60 family, including ZmpB, interact with mammal O-glycosylated proteins (e.g., mucin), in which a conserved O-glycosylation motif—N-acetyl-galactosamine residue α-linked with serine/threonine residue—is recognized by the enzymes [39]. Since galactose is structurally related to N-acetyl-galactosamine, we proposed that the Pba Svx protein can bind to serine amino acid O-glycosylated with α-galactose and break down the peptide bond between serine and hydroxyproline residues in extensins or extensin-like domain-containing proteins. In order to determine whether the Pba Svx can indeed accommodate α-galactosylated peptides, the molecular docking of the Pba Svx protein with α-Gal-1-SAPGG was performed. The α-Gal-1-SAPGG ligand was built based on the structure of the ligand previously used for the study of ZmpB-substrate interaction [39].
In the X-ray structure of the ZmpB-O-glycozylated peptide complex, the N-atom of the glycosylated amino acid was the closest one to Zn2+, located at a distance of 3.8 Å from the ion [39]. In the Pba Svx, the binding pocket for α-galacatose was formed by the W136, H140, N171, and L113 residues; the N-atom of the serine residue was located at 2.1 from Zn2+ (Figure 8). The calculated dissociation constant of the Pba Svx-α-Gal-1-SAPGG complex was around 90 mM. The interactions between the Pba Svx substrate binding site and the ligand α-Gal-1-SAPGG were mainly determined by the recognition of the carbohydrate part of the substrate (Figure 8). The Pba Svx did not form contacts with the pentapeptide portion of the α-Gal-1-SAPGG ligand (similar to ZmpB, [39]), suggesting that the Pba Svx protein did not display specificity to the peptide moiety (Figure 8).
To check whether the Pba Svx protein had the potential to hydrolyze not only α-glycosylated proteins but also two other groups of PCW glycosylated proteins (arabinogalactans β-glycosylated with galactose and proteins β-glycosylated with N-acetyl-glucosamine), we performed an analysis of the interactions between the Pba Svx protein and β-glycosylated amino acid residues. Since the Pba Svx protein had an affinity for the α-galactosyl moiety of glycosylated peptides/proteins rather than for their peptide moiety (Figure 8 and Figure 9A), we assumed that the binding of other glycosylated species by the Pba Svx protein would retain the orientation of the sugar moiety in the carbohydrate-binding site. To have a preliminary structure-based vision of the interactions of the Pba Svx with β-galactosylated hydroxyproline (characteristic of arabinogalactans) or asparagine β-linked to N-acetyl-glucosamine, the sugar parts of these ligands were superimposed with the α-galactosyl moiety of α-Gal-1-SAPGG. The O- and N-atoms in the β-anomeric positions of β-galactose and β-N-acetyl-galactosamine overlapped with the Pba Svx protein, respectively (Figure 9B,C). The aglycon linked to the β-anomers overlapped with the Pba Svx protein, forming large clashes; with this, the formation of clashes was predominantly due to the H140 position, which is important for the Zn2+ binding. Thus, the topology of the Pba Svx protein’s carbohydrate binding site allows it to bind α-glycosylated amino acid residues; however, the affinity for β-glycosylated amino acid residues is expected to be low, if present. Therefore, we conclude that the Pba Svx protein can possibly recognize α-galactosylated amino acid residues of extensins and hydrolyze these structural PCW glycoproteins.

3. Discussion

Our study provides the first data on the functions of a representative of a large but uncharacterized protein family—the Svx-like proteins. The genes encoding Svx-like proteins are widely distributed among phytopathogenic bacteria of the Pectobacterium, Dickeya, and Xanthomonas genera and are also present in a plant endophyte and several species of plant-non-associated bacteria (both free-living and associated with animals) from the Gammaproteobacteria, Alphaproteobacteria, and Deltaproteobacteria classes. According to the bioinformatic analysis, almost all (except one) of the revealed Svx-like proteins are either extracellular or plasma membrane-localized since they possess Sec/SPI or Tat/SPI or Sec/SPII signal peptides. For some of these proteins, their extracellular localization has been previously shown experimentally [12,14].
The Svx-like proteins of phytopathogenic species form a distinct clade on a phylogram. As such, Svx-like proteins from closer relatives with different eco-niches (Pectobacterium/Dickeya and Vibrio/Teredinibacter/Microbulbifer) appeared phylogenetically more distant than the Svx-like proteins from more distant relatives (Pectobacterium/Dickeya and Xanthomonas) with a common eco-niche—the host plant. The fact that the Svx-like proteins of Gammaproteobacteria split into two separate phylogenetic clades corresponding to the proteins of (1) phytopathogens (clade G in Figure 1) and (2) plant-non-associated bacteria (clade DG in Figure 1) points to the directed evolution of these proteins in plant pathogens for providing effective interactions with the host plants. Therefore, the Svx-like proteins from plant-non-associated bacteria can presumably be “designed” to implement functions other than those of the Svx-like proteins from phytopathogenic species. Thus, the Svx-like proteins are likely to be “multifaced” proteins that participate in distinct physiological/biochemical processes depending on the lifestyle of the bacteria producing them.
To get better insight into the structure and functions of the Svx-like proteins, we analyzed the Svx of Pba. The Pba Svx has been previously shown to be required for full virulence and to be transferred via T2SS, while the corresponding gene svx has been demonstrated to be upregulated by quorum sensing and plant metabolites [7,10,12,14]. In our study, in silico analysis predicted two domains of the Pba Svx protein: a peptidase domain and a transferase-like domain with an unknown function. The peptidase domain of the Pba Svx had a catalytic site formed by the conservative zinc-binding motif HEXXHX(8,28)E typical of the gluzincin extracellular metallopeptidases [32]. By obtaining and analyzing the recombinant Pba Svx protein and its two mutant forms with the amino acid substitutions (ΔE141A and ΔE167A) in the HEXXHX(8,28)E motif, we confirmed that the Pba Svx protein was a gluzincin metallopeptidase.
In addition, we found that Pba Svx has carbohydrate-binding residues typical of M60 family glycopeptidases (PF13402) that catalyze the hydrolysis of glycoproteins [39]. Therefore, we presumed that Pba Svx is a glycopeptidase that breaks down glycosylated PCW proteins since Pba Svx is secreted by bacteria into the host plant apoplast. To check our hypothesis, we built the spatial structure of the Pba Svx and performed molecular docking with the proposed substrates—the fragments of the glycosylated PCW proteins.
The tertiary structure of the peptidase domain of the Pba Svx was the most similar to that of the peptidase domain of the O-glycopeptidase ZmpB of Clostridium perfringens, which recognized N-acetyl-galactosamine residues attached to the polypeptide chain. Therefore, we performed the molecular docking of the Pba Svx protein with a ligand similar to that used for the study of ZmpB-substrate interaction, except that N-acetyl-galactosamine attached to threonine was substituted for the galactose attached to serine since there are no known PCW proteins in which N-acetyl-galactosamine directly bound to the polypeptide chain. In turn, α-galactose linked to serine of the polypeptide chain is a characteristic feature of some O-glycosylated PCW proteins, namely extensins or proteins with extensin domains.
The performed analysis showed that Pba Svx protein could accommodate an α-galactose glycosylated peptide typical of extensins with millimolar affinity, which is in agreement with the affinity of different lectins to the terminal α-galactose in glycolipids [55]. The binding of α-galactosylated peptide by Pba Svx occurred mostly due to the interactions with the sugar moiety.
Then, we investigated whether the PCW glycoproteins with a β-linkage between aglycon and glycoside could be the potential substrates of the Pba Svx. The structural-based analysis showed that both β-galactosylated hydroxyproline (a characteristic of O-glycosylated arabinogalactans) and asparagine β-linked to N-acetyl-glucosamine (a characteristic of N-glycosylated PCW proteins) brought the peptide away from Zn2+ and led to the overlapping of the ligand’s peptide part with the electron density of the Pba Svx. This means that the topology of the carbohydrate binding site of the Pba Svx protein hardly enables this enzyme to hydrolyze peptide linkage adjacent to the amino acid residue attached to the carbohydrate residue by the β-linkage. Thus, the extensins are the most probable substrates of the Pba Svx among the PCW glycosylated proteins.
Extensins are structural PCW proteins that interact with each other as well as with lignin and polysaccharides substituted with aromatic components, making the PCW more rigid [53]. Therefore, it is reasonable to conclude that the destruction of extensins promotes disease development caused by Pba. Moreover, some extensins (designated as LRX), containing an additional N-terminal domain composed of leucine-rich repeats (LRR), are considered important sensors that trace the state of PCW and transmit the signals via partner proteins [56,57]. Thus, breaking down or modifying extensins may not only weaken PCW but also influence the signaling processes of the host plant, leading to the repression of defense reactions or the induction of susceptible responses [58].
In plant pathogenic bacteria, metallopeptidases that are able to degrade extensins have been previously described: the Prt1 from Pectobacterium carotovorum and the gp120-degrading enzyme from Xanthomonas campestris [59,60]. Prt1 interacts with non-glycosylated ligands and catalyzes the hydrolysis of a wide range of proteins, such as casein, collagen, bovine serum albumin, ribonuclease A, potato lectin, and plant extensins [59]. In turn, gp120-degrading metallopeptidase from X. campestris shows specific enzymatic activity toward particular glycosylated proteins, such as potato and tomato extensins and glycoproteins gpS-3 and gp120, but does not catalyze the hydrolysis of casein or gp45 [60]. Our findings show that the Pba Svx protein’s carbohydrate binding site is organized in such a way that it can interact with α-glycosylated peptides (including extensins); thus, Pba Svx can also catalyze the hydrolysis of non-glycosylated substrates like azocasein.
When taken together, our results show that Pba Svx is a gluzincin metallopeptidase. Furthermore, in silico studies indicate that its substrate-binding pocket may accept α-glycosylated protein substrates represented in the PCW by extensins and proteins containing an extensin domain. Our future work will be focused on the physiological action of the Pba Svx protein, characterization of the Svx proteins from other species, and getting better insights into the functions of the second revealed functional domain—the acyltransferase-like one. It should be noted that this domain lacks the amino acid residues required for acyltransferase activity, so it is unlikely to have catalytic activity. It is possible that the acyltransferase-like domain of the Pba Svx provides the formation of the protein multimers or takes part in substrate recognition.

4. Materials and Methods

4.1. Phylogenetic Analysis

The search of amino acid sequences of the Svx-homologs was performed in the RefSEq Select (Reference protein) NCBI database [61] with the DELTA-BLAST (Domain Enhanced Lookup Time Accelerated BLAST) algorithm [15,16]; the amino acid sequence of the Pectobacterium atrosepticum SCRI1043 Svx protein (WP_011092533.1) was used as a reference sequence. The amino acid sequences of the Svx-like proteins were aligned using the MAFFT algorithm [62,63] and the BLOSUM62 substitution matrix. A phylogenetic tree was constructed using the Poisson model and the minimal evolution algorithm in MegaX [64,65]). The statistical support of the phylogenetic tree was estimated by bootstrap analysis [26], with 1000 replicates. Identification of signal peptides in Svx-homologs was performed using the SignalP 6.0 server [66,67].

4.2. Prediction of Functional Domains

The prediction of functional domains of the Svx-homolog proteins was carried out using servers NCBI Conserved Domain Search [68,69], HMMER [70,71], Phyre2 [30,31], and I-Tasser [28,29].

4.3. Gene Cloning and Protein Purification

The svx gene (ECA0931) without a signal-peptide coding sequence was PCR-amplified from the genomic DNA of Pectobacterium atrosepticum SCRI1043 using the primers SvxNco_R: CAGCTACCATGGCCGCTGAAGCTTGCG and SvxSac_F: GTGCTAGAGCTCTCATCACTTTTCGAACTGCGGGTGGCTCCATTTCGTGCTGTAGACC. The obtained PCR product with C-terminal Strep-tag II was ligated into the pET-51b vector. Cells of Escherichia coli strain BL21 (DE3) (Invitrogen, Waltham, MA, USA) were transformed with the resultant pET51b-Svx plasmid and grown at 37 °C in 2 L of sterile LB:M9 (1:1) media supplemented with 100 µg/mL ampicillin until the culture reached a density of ~0.6 at 600 nm. Recombinant protein synthesis was induced by the addition of isopropyl-β-D-1-thiogalactopyranoside (IPTG) (Thermo Fisher Scientific, Waltham, MA, USA) to a final concentration of 0.5 mM. Cultures were kept overnight at 18 °C with shaking. Bacterial cells were collected, and cell lysis was performed using BugBuster Protein Extraction Reagent (Novagen, Temecula, CA, USA), 0.1 mg/mL of lysozyme (Thermo Fisher Scientific, Waltham, MA, USA), and 0.1 mg/mL of DNaseI (Bio-Rad, Hercules, CA, USA) at 37 °C for 20 min. Cell lysates were centrifuged (12,000× g, 4 °C, 30 min), and the insoluble fraction (inclusion bodies) was washed with the buffer (100 mM Tris-HCl, pH 8.0, 150 mM NaCl) and pelleted again (12,000× g, 4 °C, 30 min). The pellet was dissolved in a denaturing buffer (100 mM Tris-HCl, 150 mM NaCl, 8 M urea). Then, one volume of resuspended inclusion bodies was added dropwise to 20 volumes of the refolding buffer (100 mM Tris-HCl, 150 mM NaCl, 1.25 mM reduced glutathione, 1.25 mM oxidized glutathione, 0.25 M arginine, and 1 mM ZnSO4) at 4 °C for 12 h. The resultant solution was clarified by centrifugation at 10,000× g for 30 min. The refolded protein in parts was loaded on the chromatography column with Strep-Tactin Superflow High Capacity resin (IBA-Lifescienses, Göttingen, Germany). The one-step purification was carried out at 4 °C. The Pba Svx protein was eluted by the buffer (100 mM Tris-HCl, 150 mM NaCl, 10 mM desthiobiotin) and used for enzymatic assays.

4.4. Site-Directed Mutagenesis

Substitution of amino acids in the active site of the Pba Svx protein (yielding mutant proteins SvxΔE141A and SvxΔE167A) was performed using the site-directed mutagenesis. The site-directed mutagenesis was performed as described in QuikChange II Site-Directed Mutagenesis Kit Instruction manual (Agilent Technologies, Santa Clara, CA, USA) [72]) using Q5 High Fidelity DNA polymerase (NEB, Ipswich, MA, USA) for primer-directed replication of both plasmid strands.

4.5. Peptidase Activity Assays

Peptidase activity assays were carried out using azocasein as a substrate (Sigma-Aldrich, St. Louis, MO, USA) according to the previously described method [73]. Ten μg (in 100 μL) of the recombinant Pba Svx protein (or its mutant forms SvxΔE141A and SvxΔE167A) was incubated for 60 min in 250 μL of 0.5% azocasein solution in 100 mM Tris-HCl buffer with a pH range from 7 to 9 and a temperature range from 20 °C to 50 °C. When specified, the reaction mixtures were supplemented with 1 mM or 2 mm ZnSO4 and/or 1 mM EDTA. The reactions were stopped by the addition of 100 μL of 10% trichloroacetic acid (Sigma-Aldrich, St. Louis, MO, USA). The sediment was removed by centrifugation (5000× g, 10 min, 25 °C). Four hundred μL of the supernatant and 133 μL of 1.0 N NaOH were mixed, then the absorbance at 440 nm was measured using the microplate reader CLARIOstar (BMG Labtech GmbH, Ortenberg, Germany). One unit of peptidase activity was defined as the amount of enzyme required to produce an absorbance change of 0.1 per min per 1 mg of the Pba Svx protein.

4.6. Circular Dichroism Spectroscopy

CD spectroscopy was used to analyze the secondary structure of the Pba Svx protein. Far-UV CD measurements were carried out using a Jasco J-1500 spectro-polarimeter (Jasco Corporation, Tokyo, Japan) equipped with a Peltier temperature controller unit. The spectra were registered every 1 nm in the spectral range of 190–250 nm, in quartz cuvettes with a path length of 0.1 cm, with an acquisition time of 1 s per point, at 22 °C. Each spectrum was obtained from an average of 3 scans. The protein concentrations were 0.1, 0.2, and 0.4 mg/mL for far-UV CD. The baseline was corrected in all experiments by using a protein-free 10 mM Tris-HCl, pH 8.0 solution as a control.
The ellipticity reading for each wavelength was presented as mean molar ellipticity by residue (MRE) according to the following equation: MRE = 100 × θ × M/C × n × L. In this equation, θ is the ellipticity in degrees; n, the number of amino acid residues; C, protein concentration (mg/mL); M, molecular mass; and L, the optical path (cm). The value of MRE was expressed in deg·cm2dmol−1. The content of the secondary structures in the protein was estimated by the analysis of the deconvolution of the far-UV CD spectra according to the CONTINLL algorithm [47,48]. Deconvolution was carried out using an online DICHROWEB Web server [74,75], and the reference protein database 7 was set [76].

4.7. In Silico Structure Prediction and Protein-Ligand Docking

The prediction of the Pba Svx protein structure was carried out using the AlphaFold 2 service [45,46]). Structure verification was performed based on the data from the PROCHECK server [49,50]. The PSIPRED server [43,44] was used to predict the secondary structure based on the primary structure. Protein-ligand docking was performed with the AutoDock4.2 server [77,78]. The ligand for the Pba Svx protein was built based on the structure of the ligand previously used for the study of the interaction of ZmpB glycopeptidase from Clostridium perfrigens with the substrate (pdb code 5KDS) [39]; thus, N-acetyl-galactosamine moiety linked to threonine was replaced by galactose linked to serine. The affinity of the Pba Svx protein to the ligand was calculated based on the binding energy estimated by docking. In AutoDock4.2, the binding energy was a sum of electrostatic interactions between the protein and the ligand, hydrogen bonds, van der Waals contacts, desolvation energy, and the contribution from ligand conformational entropy.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ijms23136914/s1.

Author Contributions

Conceptualization, N.T. and V.G.; methodology, N.T., T.K., O.M., O.P., E.O. and T.M.; investigation, N.T., T.K., O.M., O.P., E.O. and T.M.; writing—original draft preparation, N.T., O.M., T.K. and V.G.; writing—review and editing, V.G.; visualization, N.T. and O.M.; supervision, V.G.; project administration, V.G.; funding acquisition, V.G. All authors have read and agreed to the published version of the manuscript.

Funding

The obtaining and analysis of the recombinant proteins (including mutant forms), the determination of the secondary structure, and the molecular docking were supported by the Russian Science Foundation (project No. 19-14-00194). Phylogenetic analysis and the modeling of the 3D protein structure were performed within the framework of the government assignment for FRC Kazan Scientific Center of RAS.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

This work has been supported by the Kazan Federal University Strategic Academic Leadership Program.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Van Gijsegem, F.; Hugouvieux-Cotte-Pattat, N.; Kraepiel, Y.; Lojkowska, E.; Moleleki, L.; Gorshkov, V.; Yedidia, I. Molecular Interactions of Pectobacterium and Dickeya with Plants. In Plant Diseases Caused by Dickeya and Pectobacterium Species, 1st ed.; Van Gijsegem, F., van der Wolf, J., Toth, I.K., Eds.; Springer: Cham, Switzerland, 2021; pp. 85–147. [Google Scholar]
  2. Charkowski, A.; Blanco, C.; Condemine, G.; Expert, D.; Franza, T.; Hayes, C.; Hugouvieux-Cotte-Pattat, N.; López Solanilla, E.; Low, D.; Moleleki, L.; et al. The role of secretion systems and small molecules in soft-rot Enterobacteriaceae pathogenicity. Annu. Rev. Phytopathol. 2012, 50, 425–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Mattinen, L.; Tshuikina, M.; Mäe, A.; Pirhonen, M. Identification and characterization of Nip, necrosis-inducing virulence protein of Erwinia carotovora subsp. carotovora. Mol. Plant Microbe Interact. 2004, 17, 1366–1375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Pemberton, C.L.; Whitehead, N.A.; Sebaihia, M.; Bell, K.S.; Hyman, L.J.; Harris, S.J.; Matlin, A.J.; Robson, N.D.; Birch, P.R.; Carr, J.P.; et al. Novel quorum-sensing-controlled genes in Erwinia carotovora subsp. carotovora: Identification of a fungal elicitor homologue in a soft-rotting bacterium. Mol. Plant Microbe Interact. 2005, 18, 343–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Ageichik, A.; Evtushenkov, A.; Nikolaichik, Y. The role of type III secretion system in Erwinia carotovora subsp. atroseptica virulence. Plant Prot. Sci. 2002, 38, 523–527. [Google Scholar] [CrossRef] [Scilit]
  6. Holeva, M.C.; Bell, K.S.; Hyman, L.J.; Avrova, A.O.; Whisson, S.C.; Birch, P.R.; Toth, I.K. Use of a pooled transposon mutation grid to demonstrate roles in disease development for Erwinia carotovora subsp. atroseptica putative type III secreted effector (DspE/a) and helper (HrpN) proteins. Mol. Plant Microbe Interact. 2004, 17, 943–950. [Google Scholar] [CrossRef] [Scilit]
  7. Mattinen, L.; Nissinen, R.; Riipi, T.; Kalkkinen, N.; Pirhonen, M. Host-extract induced changes in the secretome of the plant pathogenic bacterium Pectobacterium atrosepticum. Proteomics 2007, 7, 3527–3537. [Google Scholar] [CrossRef] [Scilit]
  8. Liu, H.; Coulthurst, S.J.; Pritchard, L.; Hedley, P.E.; Ravensdale, M.; Humphris, S.; Burr, T.; Takle, G.; Brurberg, M.B.; Birch, P.R.; et al. Quorum sensing coordinates brute force and stealth modes of infection in the plant pathogen Pectobacterium atrosepticum. PLoS Pathog. 2008, 4, e1000093. [Google Scholar] [CrossRef] [Scilit]
  9. Bell, K.S.; Sebaihia, M.; Pritchard, L.; Holden, M.T.G.; Hyman, L.J.; Holeva, M.C.; Thomson, N.R.; Bentley, S.D.; Churcher, L.J.C.; Mungall, K.; et al. Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc. Natl. Acad. Sci. USA 2004, 101, 11105–11110. [Google Scholar] [CrossRef] [Scilit]
  10. Gorshkov, V.; Gubaev, R.; Petrova, O.; Daminova, A.; Gogoleva, N.; Ageeva, M.; Parfirova, O.; Prokchorchik, M.; Nikolaichik, Y.; Gogolev, Y. Transcriptome profiling helps to identify potential and true molecular switches of stealth to brute force behavior in Pectobacterium atrosepticum during systemic colonization of tobacco plants. Eur. J. Plant Pathol. 2018, 152, 957–976. [Google Scholar] [CrossRef] [Scilit]
  11. Gorshkov, V.; Toporkova, Y.; Tsers, I.; Smirnova, E.; Ogorodnikova, A.; Gogoleva, N.; Parfirova, O.; Petrova, O.; Gogolev, Y. Differential modulation of the lipoxygenase cascade during typical and latent Pectobacterium atrosepticum infections. Ann. Bot. 2022, 129, 271–286. [Google Scholar] [CrossRef] [Scilit]
  12. Corbett, M.; Virtue, S.; Bell, K.; Birch, P.; Burr, T.; Hyman, L.; Lilley, K.; Poock, S.; Toth, I.; Salmond, G. Identification of a new quorum-sensing-controlled virulence factor in Erwinia carotovora subsp. atroseptica secreted via the type II targeting pathway. Mol. Plant Microbe Interact. 2005, 18, 334–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Parker, J.E.; Barber, C.E.; Fan, M.J.; Daniels, M.J. Interaction of Xanthomonas campestris with Arabidopsis thaliana: Characterization of a gene from X. c. pv. raphani that confers avirulence to most A. thaliana accessions. Mol. Plant Microbe Interact. 1993, 6, 216–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Kazemi-Pour, N.; Condemine, G.; Hugouvieux-Cotte-Pattat, N. The secretome of the plant pathogenic bacterium Erwinia chrysanthemi. Proteomics 2004, 4, 3177–3186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Boratyn, G.M.; Schäffer, A.A.; Agarwala, R.; Altschul, S.F.; Lipman, D.J.; Madden, T.L. Domain enhanced lookup time accelerated BLAST. Biol. Direct. 2012, 7, 12–26. [Google Scholar] [CrossRef] [Scilit]
  16. BLAST. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 13 May 2022).
  17. Ma, B.; Hibbing, M.E.; Kim, H.-S.; Reedy, R.M.; Yedidia, I.; Breuer, J.; Breuer, J.; Glasner, J.D.; Perna, N.T.; Kelman, A.; et al. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 2007, 97, 1150–1163. [Google Scholar] [CrossRef] [Scilit]
  18. Hayward, A.C. The Hosts of Xanthomonas. In Xanthomonas; Swings, J.G., Civerolo, E.L., Eds.; Chapman & Hall: London, UK, 1993; pp. 1–119. [Google Scholar]
  19. Sutra, L.; Christen, R.; Bollet, C.; Simoneau, P.; Gardan, L. Samsonia erythrinae gen. nov., sp. nov., isolated from bark necrotic lesions of Erythrina sp., and discrimination of plant-pathogenic Enterobacteriaceae by phenotypic features. Int. J. Syst. Evol. Microbiol. 2001, 51, 1291–1304. [Google Scholar] [CrossRef] [Scilit]
  20. Okamoto, T.; Taguchi, H.; Nakamura, K.; Ikenaga, H.; Kuraishi, H.; Yamasato, K. Zymobacter palmae gen. nov., sp. nov., a new ethanol-fermenting peritrichous bacterium isolated from palm sap. Arch. Microbiol. 1993, 160, 333–337. [Google Scholar] [CrossRef] [Scilit]
  21. Lucena, T.; Ruvira, M.A.; Arahal, D.R.; Macián, M.C.; Pujalte, M.J. Vibrio aestivus sp. nov. and Vibrio quintilis sp. nov., related to Marisflavi and Gazogenes clades, respectively. Syst. Appl. Microbiol. 2012, 35, 427–431. [Google Scholar] [CrossRef] [Scilit]
  22. Rameshkumar, N.; Sproer, C.; Lang, E.; Nair, S. Vibrio mangrovi sp. nov., a diazotrophic bacterium isolated from mangrove-associated wild rice (Poteresia coarctata Tateoka). FEMS Microbiol. Lett. 2010, 307, 35–40. [Google Scholar] [CrossRef] [Scilit]
  23. Camacho, M.; Del Carmen Montero-Calasanz, M.; Redondo-Gómez, S.; Rodríguez-Llorente, I.; Schumann, P.; Klenk, H.P. Microbulbifer rhizosphaerae sp. nov., isolated from the rhizosphere of the halophyte Arthrocnemum macrostachyum. Int. J. Syst. Evol. Microbiol. 2016, 66, 1844–1850. [Google Scholar] [CrossRef] [Scilit]
  24. Distel, D.L.; Morrill, W.; MacLaren-Toussaint, N.; Franks, D.; Waterbury, J. Teredinibacter turnerae gen. nov., sp. nov., a dinitrogen-fixing, cellulolytic, endosymbiotic gamma-proteobacterium isolated from the gills of wood-boring molluscs (Bivalvia: Teredinidae). Int. J. Syst. Evol. Microbiol. 2002, 52, 2261–2269. [Google Scholar] [PubMed]
  25. Williams, K.P.; Gillespie, J.J.; Sobral, B.W.S.; Nordberg, E.K.; Snyder, E.E.; Shallom, J.M.; Dickerman, A.W. Phylogeny of Gammaproteobacteria. J. Bacteriol. 2010, 192, 2305–2314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Felsenstein, J. Confidence limits on phylogenics: An approach using the bootstrap. Evolution 1985, 6, 227–242. [Google Scholar]
  27. Almagro Armenteros, J.J.; Tsirigos, K.D.; Sønderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Yang, J.; Yan, R.; Roy, A.; Xu, D.; Poisson, J.; Zhang, Y. The I-TASSER Suite: Protein structure and function prediction. Nat. Methods 2015, 12, 7–8. [Google Scholar] [CrossRef] [Scilit]
  29. I-TASSER Server for Protein Structure and Function Prediction. Available online: https://zhanglab.ccmb.med.umich.edu/I-TASSER/ (accessed on 13 May 2022).
  30. Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [Scilit]
  31. Phyre2 Protein Fold Recognition Server. Available online: http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index (accessed on 13 May 2022).
  32. Rawlings, N.D.; Barrett, A.J.; Bateman, A. MEROPS: The peptidase database. Nucleic Acids Res. 2010, 38, 227–233. [Google Scholar] [CrossRef]
  33. Vujicić-Zagar, A.; Dulermo, R.; Le Gorrec, M.; Vannier, F.; Servant, P.; Sommer, S.; de Groot, A.; Serre, L. Crystal structure of the IrrE protein, a central regulator of DNA damage repair in deinococcaceae. J. Mol. Biol. 2009, 386, 704–716. [Google Scholar] [CrossRef] [Scilit]
  34. Comellas-Bigler, M.; Lang, R.; Bode, W.; Maskos, K. Crystal structure of the E. coli dipeptidyl carboxypeptidase Dcp: Further indication of a ligand-dependent hinge movement mechanism. J. Mol. Biol. 2005, 349, 99–112. [Google Scholar] [CrossRef] [Scilit]
  35. Ito, K.; Nakajima, Y.; Onohara, Y.; Takeo, M.; Nakashima, K.; Matsubara, F.; Ito, T.; Yoshimoto, T. Crystal structure of aminopeptidase N (proteobacteria alanyl aminopeptidase) from Escherichia coli and conformational change of methionine 260 involved in substrate recognition. J. Biol. Chem. 2006, 281, 33664–33676. [Google Scholar] [CrossRef] [Scilit]
  36. Arndt, J.W.; Hao, B.; Ramakrishnan, V.; Cheng, T.; Chan, S.I.; Chan, M.K. Crystal structure of a novel carboxypeptidase from the hyperthermophilic archaeon Pyrococcus furiosus. Structure 2002, 10, 215–224. [Google Scholar] [CrossRef] [Scilit]
  37. Pannifer, A.D.; Wong, T.Y.; Schwarzenbacher, R.; Renatus, M.; Petosa, C.; Bienkowska, J.; Lacy, D.B.; Collier, R.J.; Park, S.; Leppla, S.H.; et al. Crystal structure of the anthrax lethal factor. Nature 2001, 414, 229–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Xu, Q.; Göhler, A.K.; Kosfeld, A.; Carlton, D.; Chiu, H.J.; Klock, H.E.; Knuth, M.W.; Miller, M.D.; Elsliger, M.A.; Deacon, A.M.; et al. The structure of Mlc titration factor A (MtfA/YeeI) reveals a prototypical zinc metallopeptidase related to anthrax lethal factor. J. Bacteriol. 2012, 194, 2987–2999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Noach, I.; Ficko-Blean, E.; Pluvinage, B.; Stuart, C.; Jenkins, M.L.; Brochu, D.; Buenbrazo, N.; Wakarchuk, W.; Burke, J.E.; Gilbert, M.; et al. Recognition of protein-linked glycans as a determinant of peptidase activity. Proc. Natl. Acad. Sci. USA 2017, 114, 679–688. [Google Scholar] [CrossRef] [Scilit]
  40. Masuyer, G.; Zhang, S.; Barkho, S.; Shen, Y.; Henriksson, L.; Košenina, S.; Dong, M.; Stenmark, P. Structural characterisation of the catalytic domain of botulinum neurotoxin X—High activity and unique substrate specificity. Sci. Rep. 2018, 8, 4518. [Google Scholar] [CrossRef] [Scilit]
  41. Eckhard, U.; Schonauer, E.; Nuss, D.; Brandstetter, H. Structure of collagenase G reveals a chew-and-digest mechanism of bacterial collagenolysis. Nat. Struct. Mol. Biol. 2011, 18, 1109–1114. [Google Scholar] [CrossRef] [Scilit]
  42. English, A.C.; Groom, C.R.; Hubbard, R.E. Experimental and computational mapping of the binding surface of a crystalline protein. Protein Eng. 2001, 14, 47–59. [Google Scholar] [CrossRef] [Scilit]
  43. McGuffin, L.J.; Bryson, K.; Jones, D.T. The PSIPRED protein structure prediction server. Bioinformatics 2000, 16, 404–405. [Google Scholar] [CrossRef] [Scilit]
  44. PSIPRED Workbench. Available online: http://bioinf.cs.ucl.ac.uk/psipred/ (accessed on 13 May 2022).
  45. Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef] [Scilit]
  46. AlphaFold2 TIB Server. Available online: https://alphafold2.biodesign.ac.cn/ (accessed on 13 May 2022).
  47. Provencher, S.W.; Glockner, J. Estimation of globular protein secondary structure from circular dichroism. Biochemistry 1981, 20, 33–37. [Google Scholar] [CrossRef] [Scilit]
  48. Van Stokkum, I.H.M.; Spoelder, H.J.W.; Bloemendal, M.; Van Grondelle, R.; Groen, F.C.A. Estimation of protein secondary structure and error analysis from CD spectra. Anal. Biochem. 1990, 191, 110–118. [Google Scholar] [CrossRef] [Scilit]
  49. Laskowski, R.A.; MacArthur, M.W.; Moss, D.S.; Thornton, J.M. PROCHECK—A program to check the stereochemical quality of protein structures. J. App. Cryst. 1993, 26, 283–291. [Google Scholar] [CrossRef] [Scilit]
  50. SAVESv6.0—Structure Validation Server. Available online: https://saves.mbi.ucla.edu/ (accessed on 13 May 2022).
  51. Nakjang, S.; Ndeh, D.A.; Wipat, A.; Bolam, D.N.; Hirt, R.P. A Novel Extracellular Metallopeptidase Domain Shared by Animal Host-Associated Mutualistic and Pathogenic Microbes. PLoS ONE 2012, 7, e30287. [Google Scholar]
  52. Pluvinage, B.; Ficko-Blean, E.; Noach, I.; Stuart, C.; Thompson, N.; McClure, H.; Buenbrazo, N.; Wakarchuk, W.; Boraston, A.B. Architecturally complex O-glycopeptidases are customized for mucin recognition and hydrolysis. Proc. Natl. Acad. Sci. USA 2021, 118, e2019220118. [Google Scholar] [CrossRef] [Scilit]
  53. Cassab, G.I. Plant cell wall proteins. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49, 281–309. [Google Scholar] [CrossRef] [Scilit]
  54. Nguema-Ona, E.; Vicré-Gibouin, M.; Gotté, M.; Plancot, B.; Lerouge, P.; Bardor, M.; Driouich, A. Cell wall O-glycoproteins and N-glycoproteins: Aspects of biosynthesis and function. Front. Plant Sci. 2014, 5, 499. [Google Scholar] [CrossRef] [Scilit]
  55. Siukstaite, L.; Imberty, A.; Römer, W. Structural Diversities of Lectins Binding to the Glycosphingolipid Gb3. Front. Mol. Biosci. 2021, 8, 704685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Herger, A.; Dünser, K.; Kleine-Vehn, J.; Ringli, C. Leucine-rich repeat extensin proteins and their role in cell wall sensing. Curr. Biol. 2019, 29, R851–R858. [Google Scholar] [CrossRef] [Scilit]
  57. Dünser, K.; Gupta, S.; Herger, A.; Feraru, M.I.; Ringli, C.; Kleine-Vehn, J. Extracellular matrix sensing by FERONIA and Leucine-Rich Repeat Extensins controls vacuolar expansion during cellular elongation in Arabidopsis thaliana. EMBO J. 2019, 38, e100353. [Google Scholar] [CrossRef] [Scilit]
  58. Gorshkov, V.; Tsers, I. Plant susceptible responses: The underestimated side of plant-pathogen interactions. Biol. Rev. Camb. Philos. Soc. 2022, 97, 45–66. [Google Scholar] [CrossRef] [Scilit]
  59. Feng, T.; Nyffenegger, C.; Højrup, P.; Vidal-Melgosa, S.; Yan, K.P.; Fangel, J.U.; Meyer, A.S.; Kirpekar, F.; Willats, W.G.; Mikkelsen, J.D. Characterization of an extensin-modifying metalloprotease: N-terminal processing and substrate cleavage pattern of Pectobacterium carotovorum Prt1. Appl. Microbiol. Biotechnol. 2014, 98, 10077–10089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Dow, J.; Davies, H.; Daniels, M. A Metalloprotease from Xanthomonas campestris That Specifically Degrades Proline/Hydroxyproline-Rich Glycoproteins of the Plant Extracellular Matrix. Mol. Plant-Microbe Interact. 1998, 11, 1085–1093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. NCBI RefSeq Select. Available online: https://www.ncbi.nlm.nih.gov/refseq/refseq_select (accessed on 13 May 2022).
  62. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. MAFFT Version 7. Available online: https://mafft.cbrc.jp/alignment/software/ (accessed on 13 May 2022).
  64. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Mega Software. Available online: https://www.megasoftware.net/ (accessed on 13 May 2022).
  66. Teufel, F.; Almagro Armenteros, J.J.; Johansen, A.R.; Gíslason, M.H.; Pihl, S.I.; Tsirigos, K.D.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 2022, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. SignalP—6.0—Services—DTU Health Tech. Available online: https://services.healthtech.dtu.dk/service.php?SignalP-6.0 (accessed on 13 May 2022).
  68. Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48, 265–268. [Google Scholar] [CrossRef] [Scilit]
  69. NCBI Conserved Domain Search. Available online: https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 6 May 2022).
  70. Finn, R.D.; Clements, J.; Eddy, S.R. HMMER Web Server: Interactive Sequence Similarity Searching. Nucleic Acids Res. 2011, 39, 29–37. [Google Scholar] [CrossRef] [Scilit]
  71. HMMER. Available online: http://hmmer.org/ (accessed on 13 May 2022).
  72. QuikChange II Site-Directed Mutagenesis Kit Instruction Manual. Available online: https://www.agilent.com/cs/library/usermanuals/Public/200523.pdf (accessed on 13 May 2022).
  73. Akpinar, O.; Penner, M.H. Peptidase activity assays using protein substrates. Curr. Prot. Food Anal. Chem. 2002, 3, C2.2.1–C2.2.10. [Google Scholar] [CrossRef] [Scilit]
  74. Miles, A.J.; Ramalli, S.G.; Wallace, B.A. DichroWeb, a website for calculating protein secondary structure from circular dichroism spectroscopic data. Protein Sci. 2021, 31, 37–46. [Google Scholar] [CrossRef] [Scilit]
  75. DichroWeb—Online Circular Dichroism Analysis. Available online: http://dichroweb.cryst.bbk.ac.uk/html/home.shtml (accessed on 13 May 2022).
  76. Sreerama, N.; Venyaminov, S.Y.; Woody, R.W. Estimation of protein secondary structure from circular dichroism spectra: Inclusion of denatured proteins with native proteins in the analysis. Anal. Biochem. 2000, 287, 243–251. [Google Scholar] [CrossRef] [Scilit]
  77. Forli, S.; Huey, R.; Pique, M.E.; Sanner, M.F.; Goodsell, D.S.; Olson, A.J. Computational protein-ligand docking and virtual drug screening with the AutoDock suite. Nat. Protoc. 2016, 11, 905–919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. AutoDock4. Available online: https://autodocksuite.scripps.edu/autodock4/ (accessed on 13 May 2022).
Figure 1. The phylogenetic tree of the amino acid sequences of Svx-like proteins. The sequences were obtained from the NCBI RefSeq Select Protein Database and aligned using the MAFFT algorithm and the BLOSUM62 substitution matrix. The cladogram was built using the Poisson model and the minimal evolution algorithm in MegaX. The statistical support of the phylogenetic tree was estimated by bootstrap analysis [26], with 1000 replicates. G, A1, A2, and DG designate separate clades described in the text.
Figure 1. The phylogenetic tree of the amino acid sequences of Svx-like proteins. The sequences were obtained from the NCBI RefSeq Select Protein Database and aligned using the MAFFT algorithm and the BLOSUM62 substitution matrix. The cladogram was built using the Poisson model and the minimal evolution algorithm in MegaX. The statistical support of the phylogenetic tree was estimated by bootstrap analysis [26], with 1000 replicates. G, A1, A2, and DG designate separate clades described in the text.
Ijms 23 06914 g001
Figure 2. The alignment of the amino acid sequence of the Svx protein of Pectobacterium atrosepticum (Pba) (UniProt ID: Q6D8P1) with other bacterial gluzincin metallopeptidases with experimentally determined spatial structures: radiation response metallopeptidase IrrE Deinococcus deserti (UniProt ID: CICZ84) MEROPS family M78 [33], dipeptidyl carboxypeptidase Escherichia coli (UniProt ID: P24171) MEROPS family M3 [34], aminopeptidase N Escherichia coli (UniProt ID: P04825) MEROPS family M1 [35], thermostable carboxypeptidase 1 Pyrococcus furiosus (UniProt ID: Q8U3L0) MEROPS family M32 [36], lethal factor Bacillus anthracis (UniProt ID: P15917) MEROPS family M34 [37], protein MtfA Klebsiella pneumoniae (UniProt ID: A6TB8) MEROPS family M90 [38], ZmpB O-glycopeptidase Clostridium perfringens (UniProt ID: A0A0H2YN38) MEROPS family M60 [39], botulinum neurotoxin type X Clostridium botulinum (UniProt ID: P0DPK1) MEROPS family M27 [40], collagenase ColG Hathewaya histolytica (UniProt ID: Q9X721) MEROPS family M9 [41], thermolysin Bacillus thermoproteolyticus (UniProt ID: P00800) MEROPS family M4 [42]. The conservative zinc-binding motif HEXXHX(8,28)E is colored in red (the positions of the last glutamic acid (E) residues are variable in different proteins). The alignment was built using the MAFFT algorithm and the BLOSUM45 substitution matrix.
Figure 2. The alignment of the amino acid sequence of the Svx protein of Pectobacterium atrosepticum (Pba) (UniProt ID: Q6D8P1) with other bacterial gluzincin metallopeptidases with experimentally determined spatial structures: radiation response metallopeptidase IrrE Deinococcus deserti (UniProt ID: CICZ84) MEROPS family M78 [33], dipeptidyl carboxypeptidase Escherichia coli (UniProt ID: P24171) MEROPS family M3 [34], aminopeptidase N Escherichia coli (UniProt ID: P04825) MEROPS family M1 [35], thermostable carboxypeptidase 1 Pyrococcus furiosus (UniProt ID: Q8U3L0) MEROPS family M32 [36], lethal factor Bacillus anthracis (UniProt ID: P15917) MEROPS family M34 [37], protein MtfA Klebsiella pneumoniae (UniProt ID: A6TB8) MEROPS family M90 [38], ZmpB O-glycopeptidase Clostridium perfringens (UniProt ID: A0A0H2YN38) MEROPS family M60 [39], botulinum neurotoxin type X Clostridium botulinum (UniProt ID: P0DPK1) MEROPS family M27 [40], collagenase ColG Hathewaya histolytica (UniProt ID: Q9X721) MEROPS family M9 [41], thermolysin Bacillus thermoproteolyticus (UniProt ID: P00800) MEROPS family M4 [42]. The conservative zinc-binding motif HEXXHX(8,28)E is colored in red (the positions of the last glutamic acid (E) residues are variable in different proteins). The alignment was built using the MAFFT algorithm and the BLOSUM45 substitution matrix.
Ijms 23 06914 g002
Figure 3. The purified recombinant Svx protein of Pectobacterium atrosepticum (66 kDa) (A) and its peptidase activity at different pH values (B) and different temperatures (C). The pH optimum for the enzymatic activity was determined in 100 mM Tris-HCl buffer at 37 °C. The temperature optimum was determined in 100 mM Tris-HCl buffer pH 7.5.
Figure 3. The purified recombinant Svx protein of Pectobacterium atrosepticum (66 kDa) (A) and its peptidase activity at different pH values (B) and different temperatures (C). The pH optimum for the enzymatic activity was determined in 100 mM Tris-HCl buffer at 37 °C. The temperature optimum was determined in 100 mM Tris-HCl buffer pH 7.5.
Ijms 23 06914 g003
Figure 4. Peptidase activity of the wild-type Svx protein of Pectobacterium atrosepticum and its mutant forms SvxΔE141A and SvxΔE167A. The activities of the wild-type protein were measured in the absence (WT) or presence of 1 mM ZnSO4 (WT 1 mM ZnSO4) or 1 mM EDTA (WT 1 mM EDTA) or both 1 mM EDTA and either 1 mM or 2 mM ZnSO4 (WT 1 mM EDTA (1 or 2) mM ZnSO4). The activities of the mutant proteins were measured in the presence of 1 mM ZnSO4 (ΔE141A 1 mM ZnSO4/ΔE167A 1 mM ZnSO4). All reactions were carried out in 100 mM Tris-HCl buffer pH 7.5 at 40 °C.
Figure 4. Peptidase activity of the wild-type Svx protein of Pectobacterium atrosepticum and its mutant forms SvxΔE141A and SvxΔE167A. The activities of the wild-type protein were measured in the absence (WT) or presence of 1 mM ZnSO4 (WT 1 mM ZnSO4) or 1 mM EDTA (WT 1 mM EDTA) or both 1 mM EDTA and either 1 mM or 2 mM ZnSO4 (WT 1 mM EDTA (1 or 2) mM ZnSO4). The activities of the mutant proteins were measured in the presence of 1 mM ZnSO4 (ΔE141A 1 mM ZnSO4/ΔE167A 1 mM ZnSO4). All reactions were carried out in 100 mM Tris-HCl buffer pH 7.5 at 40 °C.
Ijms 23 06914 g004
Figure 5. The circular dichroism spectra of the Svx protein of Pectobacterium atrosepticum in 10 mM Tris-HCl buffer (pH 8.0).
Figure 5. The circular dichroism spectra of the Svx protein of Pectobacterium atrosepticum in 10 mM Tris-HCl buffer (pH 8.0).
Ijms 23 06914 g005
Figure 6. The spatial structure of the Svx protein of Pectobacterium atrosepticum predicted by AlphaFold 2. The built model demonstrated the presence of two functional domains: peptidase and acyltransferase-like.
Figure 6. The spatial structure of the Svx protein of Pectobacterium atrosepticum predicted by AlphaFold 2. The built model demonstrated the presence of two functional domains: peptidase and acyltransferase-like.
Ijms 23 06914 g006
Figure 7. The conserved residues forming the zinc-binding motif HEXXHX(8,28)E and the carbohydrate binding site (W, G, N) in the active sites of the peptidase domains of the Svx protein of Pectobacterium atrosepticum (A) and the O-glycopeptidase ZmpB of Clostridium perfringens (pdb code: 5KDS) (B).
Figure 7. The conserved residues forming the zinc-binding motif HEXXHX(8,28)E and the carbohydrate binding site (W, G, N) in the active sites of the peptidase domains of the Svx protein of Pectobacterium atrosepticum (A) and the O-glycopeptidase ZmpB of Clostridium perfringens (pdb code: 5KDS) (B).
Ijms 23 06914 g007
Figure 8. The structure of the peptidase domain active site of the Svx protein of Pectobacterium atrosepticum with a α-Gal-1-SAPGG ligand. The ligand was built based on the structure of the ligand previously used for the study of ZmpB-substrate interaction (pdb code 5KDS) [39].
Figure 8. The structure of the peptidase domain active site of the Svx protein of Pectobacterium atrosepticum with a α-Gal-1-SAPGG ligand. The ligand was built based on the structure of the ligand previously used for the study of ZmpB-substrate interaction (pdb code 5KDS) [39].
Ijms 23 06914 g008
Figure 9. The orientation of the α-glycosylated (A) and β-glycosylated (B,C) amino acid residues characteristic of the extensin (A) or arabinogalactan (B) O-glycosylation motifs and plant protein N-glycosylation motif (C) in the pocket of the active site of the Svx protein of Pectobacterium atrosepticum. Red ellipses show the sugar residues attached to the amino acid residues in the plant cell wall glycoproteins. These parts of glycoproteins were used as ligands for docking and superposition with the Pba Svx protein.
Figure 9. The orientation of the α-glycosylated (A) and β-glycosylated (B,C) amino acid residues characteristic of the extensin (A) or arabinogalactan (B) O-glycosylation motifs and plant protein N-glycosylation motif (C) in the pocket of the active site of the Svx protein of Pectobacterium atrosepticum. Red ellipses show the sugar residues attached to the amino acid residues in the plant cell wall glycoproteins. These parts of glycoproteins were used as ligands for docking and superposition with the Pba Svx protein.
Ijms 23 06914 g009
Table 1. The percentage of the secondary structure elements of the Svx protein of Pectobacterium atrosepticum calculated based on the circular dichroism spectroscopy data, AlphaFold 2 modeling and PSIPRED.
Table 1. The percentage of the secondary structure elements of the Svx protein of Pectobacterium atrosepticum calculated based on the circular dichroism spectroscopy data, AlphaFold 2 modeling and PSIPRED.
CD, %AlphaFold 2, %PSIPRED, %
Helix (α-helices)17.0 ± 0.4919.118.0
Strand (β-sheets)32.3 ± 0.9824.021.5
Turns21.2 ± 0.2830.060.5
Unordered29.5 ± 0.8626.90
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tendiuk, N.; Konnova, T.; Petrova, O.; Osipova, E.; Mukhametzyanov, T.; Makshakova, O.; Gorshkov, V. Structure-Functional Characteristics of the Svx Protein—The Virulence Factor of the Phytopathogenic Bacterium Pectobacterium atrosepticum. Int. J. Mol. Sci. 2022, 23, 6914. https://doi.org/10.3390/ijms23136914

AMA Style

Tendiuk N, Konnova T, Petrova O, Osipova E, Mukhametzyanov T, Makshakova O, Gorshkov V. Structure-Functional Characteristics of the Svx Protein—The Virulence Factor of the Phytopathogenic Bacterium Pectobacterium atrosepticum. International Journal of Molecular Sciences. 2022; 23(13):6914. https://doi.org/10.3390/ijms23136914

Chicago/Turabian Style

Tendiuk, Natalia, Tatiana Konnova, Olga Petrova, Elena Osipova, Timur Mukhametzyanov, Olga Makshakova, and Vladimir Gorshkov. 2022. "Structure-Functional Characteristics of the Svx Protein—The Virulence Factor of the Phytopathogenic Bacterium Pectobacterium atrosepticum" International Journal of Molecular Sciences 23, no. 13: 6914. https://doi.org/10.3390/ijms23136914

APA Style

Tendiuk, N., Konnova, T., Petrova, O., Osipova, E., Mukhametzyanov, T., Makshakova, O., & Gorshkov, V. (2022). Structure-Functional Characteristics of the Svx Protein—The Virulence Factor of the Phytopathogenic Bacterium Pectobacterium atrosepticum. International Journal of Molecular Sciences, 23(13), 6914. https://doi.org/10.3390/ijms23136914

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop