Evidence for the Involvement of Pleckstrin Homology Domain-Containing Proteins in the Transport of Enterocin DD14 (EntDD14); a Leaderless Two-Peptide Bacteriocin
Abstract
1. Introduction
2. Results
2.1. In Silico Characterization of DdE and DdF Proteins
2.2. PH Domain-Containing Proteins DdE and DdF Are Essential for EntDD14 Transport
2.3. Loss of DdE or DdF Protein Leads to Overexpression of the EntDD14 Operon
2.4. EntDD14 Accumulated inside the Cytoplasm Induces Cell Toxicity
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Growth Conditions
4.2. Construction of the ΔddE and ΔddF Strains
4.3. Complementation of the E. faecalis ΔddF Mutant Strain
4.4. Antimicrobial Activity against L. innocua
4.5. RNA Isolation and RT-qPCR
4.6. Intracellular Protein Extraction
4.7. Purification of the Leaderless Two-Peptides EntDD14
4.8. Detection of EntDD14 by MALDI-TOF/MS
4.9. Evaluation of the Effect on the Producer Strains by Ent DD14 Intracellular Accumulation
4.10. Confocal Laser Scanning Microscopy
4.11. Bioinformatics
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Drider, D.; Rebuffat, S. Prokariotic Antimicrobial Peptides: From Genes to Applications; Springer: Berlin/Heidelberg, Germany, 2011. [Google Scholar]
- Hammami, R.; Fernandez, B.; Lacroix, C.; Fliss, I. Anti-infective properties of bacteriocins: An update. Cell. Mol. Life Sci. 2013, 70, 2947–2967. [Google Scholar] [CrossRef]
- Flaherty, R.A.; Freed, S.D.; Lee, S.W. The wide world of ribosomally encoded bacterial peptides. PLoS Pathog. 2014, 10, e1004221. [Google Scholar] [CrossRef][Green Version]
- Alvarez-Sieiro, P.; Montalbán-López, M.; Mu, D.; Kuipers, O.P. Bacteriocins of lactic acid bacteria: Extending the family. Appl. Microbiol. Biotechnol. 2016, 100, 2939–2951. [Google Scholar] [CrossRef]
- Beis, K.; Rebuffat, S. Multifaceted abc transporters associated to microcin and bacteriocin export. Res. Microbiol. 2019, 170, 399–406. [Google Scholar] [CrossRef]
- Soltani, S.; Hammami, R.; Cotter, P.D.; Rebuffat, S.; Said, L.B.; Gaudreau, H.; Bedard, F.; Biron, E.; Drider, D.; Fliss, I. Bacteriocins as a new generation of antimicrobials: Toxicity aspects and regulations. FEMS Microbiol. Rev. 2021, 45, fuaa039. [Google Scholar] [CrossRef]
- Ortega, M.A.; van der Donk, W.A. New insights into the biosynthetic logic of ribosomally synthesized and post-translationally modified peptide natural products. Cell Chem. Biol. 2016, 23, 31–44. [Google Scholar] [CrossRef]
- Zheng, S.; Sonomoto, K. Diversified transporters and pathways for bacteriocin secretion in gram-positive bacteria. Appl. Microbiol. Biotechnol. 2018, 102, 4243–4253. [Google Scholar] [CrossRef]
- Cintas, L.M.; Casaus, P.; Håvarstein, L.S.; Hernández, P.E.; Nes, I.F. Biochemical and genetic characterization of enterocin p, a novel sec-dependent bacteriocin from Enterococcus faecium p13 with a broad antimicrobial spectrum. Appl. Environ. Microbiol. 1997, 63, 4321–4330. [Google Scholar] [CrossRef] [PubMed]
- Smits, S.H.J.; Schmitt, L.; Beis, K. Self-immunity to antibacterial peptides by abc transporters. FEBS Lett. 2020, 594, 3920–3942. [Google Scholar] [CrossRef] [PubMed]
- Ra, R.; Beerthuyzen, M.M.; de Vos, W.M.; Saris, P.E.J.; Kuipers, O.P. Effects of gene disruptions in the nisin gene cluster of Lactococcus lactis on nisin production and producer immunity. Microbiology 1999, 145, 1227–1233. [Google Scholar] [CrossRef] [PubMed]
- Diaz, M.; Valdivia, E.; Martínez-Bueno, M.; Fernández, M.; Soler-González, A.S.; Ramírez-Rodrigo, H.; Maqueda, M. Characterization of a new operon, as-48efgh, from the as-48 gene cluster involved in immunity to enterocin as-48. Appl. Environ. Microbiol. 2003, 69, 1229–1236. [Google Scholar] [CrossRef]
- Cintas, L.M.; Casaus, P.; Holo, H.; Hernandez, P.E.; Nes, I.F.; Håvarstein, L.S. Enterocins l50a and l50b, two novel bacteriocins from Enterococcus faecium l50, are related to staphylococcal hemolysins. J. Bacteriol. 1998, 180, 1988–1994. [Google Scholar] [CrossRef]
- Perez, R.H.; Zendo, T.; Sonomoto, K. Circular and leaderless bacteriocins: Biosynthesis, mode of action, applications, and prospects. Front. Microbiol. 2018, 9, 2085. [Google Scholar] [CrossRef] [PubMed]
- Netz, D.J.; Sahl, H.G.; Marcelino, R.; dos Santos Nascimento, J.; de Oliveira, S.S.; Soares, M.B.; do Carmo de Freire Bastos, M. Molecular characterisation of aureocin a70, a multi-peptide bacteriocin isolated from Staphylococcus aureus. J. Mol. Biol. 2001, 311, 939–949. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, J.d.S.; Coelho, M.L.V.; Ceotto, H.; Potter, A.; Fleming, L.R.; Salehian, Z.; Nes, I.F.; Bastos, M.d.C.d.F. Genes involved in immunity to and secretion of aureocin a53, an atypical class ii bacteriocin produced by Staphylococcus aureus a53. J. Bacteriol. 2012, 194, 875–883. [Google Scholar] [CrossRef]
- Al Atya, A.K.; Drider-Hadiouche, K.; Ravallec, R.; Silvain, A.; Vachee, A.; Drider, D. Probiotic potential of Enterococcus faecalis strains isolated from meconium. Front. Microbiol. 2015, 6, 227. [Google Scholar] [CrossRef]
- Caly, D.L.; Chevalier, M.; Flahaut, C.; Cudennec, B.; Al Atya, A.K.; Chataigne, G.; D'Inca, R.; Auclair, E.; Drider, D. The safe enterocin dd14 is a leaderless two-peptide bacteriocin with anti-Clostridium perfringens activity. Int. J. Antimicrob. Agents 2017, 49, 282–289. [Google Scholar] [CrossRef]
- Antonio, M.M.-P.; Eva, V.; Magdalena, R.-R.; Juan, J.S.; Manuel, M.-V.; Mercedes, M.; Manuel, M.-B. Characterization of antimicrobial substances produced by Enterococcus faecalis mrr 10-3, isolated from the uropygial gland of the hoopoe (upupa epops). Appl. Environ. Microbiol. 2006, 72, 4245–4249. [Google Scholar]
- Liu, X.; Vederas, J.C.; Whittal, R.M.; Zheng, J.; Stiles, M.E.; Carlson, D.; Franz, C.M.A.P.; McMullen, L.M.; van Belkum, M.J. Identification of an n-terminal formylated, two-peptide bacteriocin from Enterococcus faecalis 710c. J. Agric. Food Chem. 2011, 59, 5602–5608. [Google Scholar] [CrossRef]
- Ladjouzi, R.; Lucau-Danila, A.; Benachour, A.; Drider, D. A leaderless two-peptide bacteriocin, enterocin dd14, is involved in its own self-immunity: Evidence and insights. Front. Bioeng. Biotechnol. 2020, 8, 644. [Google Scholar] [CrossRef]
- Rebecchi, M.J.; Scarlata, S. Pleckstrin homology domains: A common fold with diverse functions. Annu. Rev. Biophys. Biomol. Struct. 1998, 27, 503–528. [Google Scholar] [CrossRef]
- Lemmon, M.A.; Keleti, D. Ph domains. In Modular Protein Domains; Cesareni, G., Gimona, M., Sudol, M., Yaffe, M., Eds.; Wiley-VCH Verlag: Hoboken, NJ, USA, 2004; pp. 337–363. [Google Scholar]
- Xu, Q.; Bateman, A.; Finn, R.D.; Abdubek, P.; Astakhova, T.; Axelrod, H.L.; Bakolitsa, C.; Carlton, D.; Chen, C.; Chiu, H.J.; et al. Bacterial pleckstrin homology domains: A prokaryotic origin for the ph domain. J. Mol. Biol. 2010, 396, 31–46. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, Y. I-tasser server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef]
- Wang, Y.; Virtanen, J.; Xue, Z.; Zhang, Y. I-tasser-mr: Automated molecular replacement for distant-homology proteins using iterative fragment assembly and progressive sequence truncation. Nucleic Acids Res. 2017, 45, W429–W434. [Google Scholar] [CrossRef] [PubMed]
- Sousa, J.S.; Calisto, F.; Langer, J.D.; Mills, D.J.; Refojo, P.N.; Teixeira, M.; Kühlbrandt, W.; Vonck, J.; Pereira, M.M. Structural basis for energy transduction by respiratory alternative complex iii. Nat. Commun. 2018, 9, 1728. [Google Scholar] [CrossRef]
- Sun, C.; Benlekbir, S.; Venkatakrishnan, P.; Wang, Y.; Hong, S.; Hosler, J.; Tajkhorshid, E.; Rubinstein, J.L.; Gennis, R.B. Structure of the alternative complex iii in a supercomplex with cytochrome oxidase. Nature 2018, 557, 123–126. [Google Scholar] [CrossRef] [PubMed]
- Sureshan, V.; Deshpande, C.N.; Boucher, Y.; Koenig, J.E.; Midwest Center for Structural Genomics; Stokes, H.W.; Harrop, S.J.; Curmi, P.M.G.; Mabbutt, B.C. Integron gene cassettes: A repository of novel protein folds with distinct interaction sites. PLoS ONE 2013, 8, e52934. [Google Scholar] [CrossRef]
- Lee, C.-H.; MacKinnon, R. Structures of the human hcn1 hyperpolarization-activated channel. Cell 2017, 168, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Lin, D.Y.; Huang, S.; Chen, J. Crystal structures of a polypeptide processing and secretion transporter. Nature 2015, 523, 425–430. [Google Scholar] [CrossRef]
- Hohl, M.; Briand, C.; Grütter, M.G.; Seeger, M.A. Crystal structure of a heterodimeric ABC transporter in its inward-facing conformation. Nat. Struct. Mol. Biol. 2012, 19, 395–402. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Yang, J.G.; Zhitnitsky, D.; Lewinson, O.; Rees, D.C. Structural basis for heavy metal detoxification by an atm1-type abc exporter. Science 2014, 343, 1133–1136. [Google Scholar] [CrossRef]
- Kumaran, D.; Eswaramoorthy, S.; Furey, W.; Navaza, J.; Sax, M.; Swaminathan, S. Domain organization in clostridium botulinum neurotoxin type e is unique: Its implication in faster translocation. J. Mol. Biol. 2009, 386, 233–245. [Google Scholar] [CrossRef]
- Rempel, S.; Gati, C.; Nijland, M.; Thangaratnarajah, C.; Karyolaimos, A.; de Gier, J.W.; Guskov, A.; Slotboom, D.J. A mycobacterial ABC transporter mediates the uptake of hydrophilic compounds. Nature 2020, 580, 409–412. [Google Scholar] [CrossRef]
- Nöll, A.; Thomas, C.; Herbring, V.; Zollmann, T.; Barth, K.; Mehdipour, A.R.; Tomasiak, T.M.; Brüchert, S.; Joseph, B.; Abele, R.; et al. Crystal structure and mechanistic basis of a functional homolog of the antigen transporter tap. Proc. Natl. Acad. Sci. USA 2017, 114, E438–E447. [Google Scholar] [CrossRef]
- Thurlow, L.R.; Thomas, V.C.; Hancock, L.E. Capsular polysaccharide production in Enterococcus faecalis and contribution of cpsf to capsule serospecificity. J. Bacteriol. 2009, 191, 6203–6210. [Google Scholar] [CrossRef] [PubMed]
- Trieu-Cuot, P.; Carlier, C.; Poyart-Salmeron, C.; Courvalin, P. Shuttle vectors containing a multiple cloning site and a laczα gene for conjugal transfer of DNA from Escherichia coli to gram-positive bacteria. Gene 1991, 102, 99–104. [Google Scholar] [CrossRef]
- Coelho, M.L.V.; Coutinho, B.G.; Cabral da Silva Santos, O.; Nes, I.F.; Bastos, M.d.C.d.F. Immunity to the Staphylococcus aureus leaderless four-peptide bacteriocin aureocin a70 is conferred by auri, an integral membrane protein. Res. Microbiol. 2014, 165, 50–59. [Google Scholar] [CrossRef] [PubMed]
- Iwatani, S.; Yoneyama, F.; Miyashita, S.; Zendo, T.; Nakayama, J.; Sonomoto, K. Identification of the genes involved in the secretion and self-immunity of lacticin q, an unmodified leaderless bacteriocin from Lactococcus lactis qu 5. Microbiology 2012, 158, 2927–2935. [Google Scholar] [CrossRef] [PubMed]
- Iwatani, S.; Horikiri, Y.; Zendo, T.; Nakayama, J.; Sonomoto, K. Bifunctional gene cluster lnqbcdef mediates bacteriocin production and immunity with differential genetic requirements. Appl. Environ. Microbiol. 2013, 79, 2446–2449. [Google Scholar] [CrossRef]
- Blomberg, N.; Baraldi, E.; Nilges, M.; Saraste, M. The PH superfold: A structural scaffold for multiple functions. Trends Biochem. Sci. 1999, 24, 441–445. [Google Scholar] [CrossRef]
- Lemmon, M.A. Pleckstrin homology (PH) domains. In Handbook of Cell Signaling; Bradshaw, R.A., Dennis, E.A., Eds.; Academic Press: Cambridge, MA, USA, 2010. [Google Scholar]
- Abriouel, H.; Valdivia, E.; Martınez-Bueno, M.; Maqueda, M.; Gálvez, A. A simple method for semi-preparative-scale production and recovery of enterocin as-48 derived from Enterococcus faecalis subsp. liquefaciens a-48-32. J. Microbiol. Methods 2003, 55, 599–605. [Google Scholar] [CrossRef]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L.L. Predicting transmembrane protein topology with a hidden markov model: Application to complete genomes11 edited by f. Cohen. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [PubMed]





| Protein | Size a | Accession No | % I b | % P c | Bacteria | Accession No | 
|---|---|---|---|---|---|---|
| YdbS d | 159 | NP_388340.1 | 100 | 100 | Bacillus subtilis ssp. subtilis 168 | NC_000964.3 | 
| YdbS | 159 | VEH76774.1 | 68 | 79 | Bacillus licheniformis NCTC10341 | LR134392.1 | 
| Lin0881 | 160 | WP_003761286.1 | 40 | 58 | Listeria innocua Clip11262 | NC_003212.1 | 
| SA1878 | 159 | WP_001287087.1 | 23 | 43 | Staphylococcus aureus ssp. aureus N315 | NC_002745.2 | 
| NCgl0612 | 149 | WP_003860754.1 | 24 | 47 | Corynebacterium glutamicum ATCC 13032 | NC_003450.3 | 
| MT_RS06490 | 177 | WP_003406264.1 | 25 | 48 | Mycobacterium tuberculosis CDC1551 | NC_002755.2 | 
| DdE | 141 | - | 17 | 47 | Enterococcus faecalis 14 | CP021161.1 | 
| YdbT d | 493 | NP_388341.1 | 100 | 100 | Bacillus subtilis ssp. subtilis 168 | NC_000964.3 | 
| YdbT | 493 | VEH76775.1 | 52 | 72 | Bacillus licheniformis NCTC10341 | LR134392.1 | 
| Lin0882 | 494 | WP_010990663.1 | 31 | 51 | Listeria innocua Clip11262 | NC_003212.1 | 
| SA1877 | 527 | WP_001294626.1 | 23 | 46 | Staphylococcus aureus ssp. aureus N315 | NC_002745.2 | 
| NCgl0613 | 471 | WP_011013786.1 | 17 | 45 | Corynebacterium glutamicum ATCC 13032 | NC_003450.3 | 
| MT_RS06485 | 487 | WP_003898781.1 | 17 | 38 | Mycobacterium tuberculosis CDC1551 | NC_002755.2 | 
| DdF | 458 | - | 18 | 44 | Enterococcus faecalis 14 | CP021161.1 | 
| Protein | PHb2 Domain | Size a | % β-Sheet | % α-Helix | % Coil | 
|---|---|---|---|---|---|
| DdE | 67–138 | 72 | 41.67 | 43.05 | 15.28 | 
| DdF | 54–133 | 80 | 57.50 | 13.75 | 28.75 | 
| 222–295 | 74 | 58.11 | 13.51 | 28.38 | |
| 382–453 | 72 | 58.33 | 25.00 | 16.67 | 
| PDB | TM-Score a | Characteristic | Role | Organism | Reference | 
|---|---|---|---|---|---|
| DdE structurally close proteins | |||||
| 6f0k | 0.538 | Respiratory alternative complex III | Electron transfer membrane protein | Rhodothermus marinus DSM 4252 | [27] | 
| 6btm | 0.533 | Respiratory alternative complex III | Electron transfer membrane protein | Flavobacterium johnsoniae UW101 | [28] | 
| 3e0s | 0.521 | Uncharacterized protein | Structural genomics/unknown function | Chlorobaculum tepidum | unpublished | 
| 3jrt | 0.518 | Integron cassette protein Vpc_cass2 | Structural genomics/unknown function | Vibrio paracholerae | [29] | 
| 7d3e | 0.511 | DUOX1-DUOXA1 in low-calcium state | Electron transport | Homo sapiens | unpublished | 
| 5u6o | 0.507 | HCN1 hyperpolarization-activated cyclic nucleotide-gated ion channel | Transport protein | Homo sapiens | [30] | 
| DdF structurally close proteins | |||||
| 4ry2 | 0.712 | Peptidase-containing ABC transporter PCAT1 | Transport protein/hydrolase | Hungateiclostridium thermocellum ATCC 27405 | [31] | 
| 3qf4 | 0.434 | Heterodimeric ABC transporter | Transport protein | Thermotoga maritima | [32] | 
| 4mrn | 0.433 | Bacterial Atm1-family ABC transporter | Transport protein | Novosphingobium aromaticivorans DSM 12444 | [33] | 
| 3ffz | 0.423 | Domain organization in butulinum neurotoxin type E | Hydrolase/translocation | Clostridium botulinum | [34] | 
| 6tqe | 0.413 | ABC transporter Rv1819c | Transport protein | Mycobacterium tuberculosis | [35] | 
| 5mkk1 | 0.407 | Heterodimeric ABC transporter TmrAB | Transport protein | Thermus thermophilus HB27 | [36] | 
| Bacteria | Plasmids | Resistance | Characteristics | Reference | 
|---|---|---|---|---|
| Escherichia coli | ||||
| XL1-Blue | – | – | Plasmid-free type strain used for plasmid cloning | Agilent Technologies | 
| XL1-Blue [plT06] | pLT06 | Cm R | Source of the pLT06 plasmid used for mutant strategies | [21] | 
| XL1-Blue [pLT06:ΔddE] | pLT06:ΔddE | Cm R | Derivative of pLT06 by cloning of a 2219 pb DNA fragment harboring flanked regions of ddE gene | This study | 
| XL1-Blue [pLT06:ΔddF] | pLT06:ΔddF | Cm R | Derivative of pLT06 by cloning of a 2019 pb DNA fragment harboring flanked regions of ddF gene | This study | 
| XL1-Blue[pAT18] | pAT18 | Em R | Source of pAT18 used for complementation studies, based on the inducible lac promoter | [21] | 
| XL1-Blue [pAT18:ddF] | pAT18:ddF | Em R | Derivative of pAT18 by cloning of ddF gene under the control of lac promoter | This study | 
| Enterococcus faecalis | ||||
| 14 | – | – | Natural strain isolated from meconium | [17] | 
| 14 ΔddE | – | – | Deletion mutant strain of ddE gene | This study | 
| 14 ΔddF | – | – | Deletion mutant strain of ddF gene | This study | 
| 14 ΔddF-Comp | pAT18:ddF | Em R | Derivative of pAT18 by cloning of ddF gene under the control of lac promoter | This study | 
| Listeria innocua | ||||
| ATCC33090 | – | – | [21] | |
| Oligonucleotide | Sequence 3′-5′ | Utilization | Amplicon Size (pb) | 
|---|---|---|---|
| ddE 1F-PstI | ATTAAACTGCAGTGATATACAATTTATATGAACAA | Amplification of ddE upstream fragment | 1136 | 
| ddE 2R-Stop | CATTCACTAGGATCCTTAGACTTATACAAATTCATTTTTCATTGAA | ||
| ddE 3F-Stop | TAAGTCTAAGGATCCTAGTGAATGAAGAAGAGGTTATTAGATGAA | Amplification of ddE downstream fragment | 1107 | 
| ddE 4R-NcoI | ATTAAACCATGGTATCTATAGCCATAAAAATAGCC | ||
| ddE 5F | AGATATATTGATATACAATTTATATG | Outer primer; verification of the plasmid integration | – | 
| ddE 6R | ACTATCAAAATATCTCTTACATAC | ||
| ddF 1F-PstI | ATTAAACTGCAGGTCTATTATAGGAGGTAAAAATG | Amplification of ddF upstream fragment | 1016 | 
| ddF 2R-Stop | CATTCACTAGGATCCTTAGACTTATTTCATCTAATAACCTCTTCTTTTA | ||
| ddF 3F-Stop | TAAGTCTAAGGATCCTAGTGAATGTCGTAGGAGGATAGAATGAAC | Amplification of ddF downstream fragment | 1027 | 
| ddF 4R-NcoI | ATTAAACCATGGGGCTTTTTTCATTTCATCATCC | ||
| ddF 5F | AAACGAAAGGGGACTGTAGC | Outer primer; verification of the plasmid integration | – | 
| ddF 6R | TCAATTTTATTATCAGCTTCAGC | ||
| ddF CompF-KpnI | AAAAGGTACCAATAAAAGAAGAGGTTATTAGATG | Cloning of the ddF gene in pAT18 | 1434 | 
| ddF CompR-BamHI | AAAAGGATCCTGTTCATTCTATCCTCCTACG | ||
| oriF | CAATAATCGCATCCGATTGCA | Cloning verification in pLT06 plasmid | – | 
| Ks05R | CCTATTATACCATATTTTGGAC | ||
| PU | GTAAAACGACGGCCAGT | Cloning verification in pAT18 plasmid | – | 
| PR | CAGGAAACAGCTATGAC | ||
| EntAL | ATGGGAGCAATCGCAAAAT | Amplification of internal ddA gene fragment for qPCR | 100 | 
| EntAR | TAATTGCCCATCCTTCTCCA | ||
| EntBL | AAAGTTTGGATGGCCATTTATT | Amplification of internal ddB gene fragment for qPCR | 106 | 
| EntBR | TCAATGTCTTTTTAACCATTTTTCA | ||
| EL | ACAAGAACATATACATTTGTGAAGGA | Amplification of internal ddE gene fragment for qPCR | 95 | 
| ER | AACATATTCTGTTTCAATTACCGTGT | ||
| FL | AGGAAAATGTTGATTTGGTGTTT | Amplification of internal ddF gene fragment for qPCR | 100 | 
| FR | TCCAATGAAGATAACAAGACAAAAA | ||
| HL | TGGTCAAGAAATCAATGAAAATG | Amplification of internal ddH gene fragment for qPCR | 89 | 
| HR | CTAGAGATTGGGTTTGTTCTTCC | ||
| IL | GGGATTTATCGATCGTAAGTTTG | Amplification of internal ddI gene fragment for qPCR | 86 | 
| IR | TTTTAGAAAGAATGTCATCTGCTGT | ||
| JL | AGAAGGAGTTAAACCCGATAAGG | Amplification of internal ddJ gene fragment for qPCR | 87 | 
| JR | TCATATTCTCCCAGATGTCTCAA | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pérez-Ramos, A.; Ladjouzi, R.; Benachour, A.; Drider, D. Evidence for the Involvement of Pleckstrin Homology Domain-Containing Proteins in the Transport of Enterocin DD14 (EntDD14); a Leaderless Two-Peptide Bacteriocin. Int. J. Mol. Sci. 2021, 22, 12877. https://doi.org/10.3390/ijms222312877
Pérez-Ramos A, Ladjouzi R, Benachour A, Drider D. Evidence for the Involvement of Pleckstrin Homology Domain-Containing Proteins in the Transport of Enterocin DD14 (EntDD14); a Leaderless Two-Peptide Bacteriocin. International Journal of Molecular Sciences. 2021; 22(23):12877. https://doi.org/10.3390/ijms222312877
Chicago/Turabian StylePérez-Ramos, Adrián, Rabia Ladjouzi, Abdellah Benachour, and Djamel Drider. 2021. "Evidence for the Involvement of Pleckstrin Homology Domain-Containing Proteins in the Transport of Enterocin DD14 (EntDD14); a Leaderless Two-Peptide Bacteriocin" International Journal of Molecular Sciences 22, no. 23: 12877. https://doi.org/10.3390/ijms222312877
APA StylePérez-Ramos, A., Ladjouzi, R., Benachour, A., & Drider, D. (2021). Evidence for the Involvement of Pleckstrin Homology Domain-Containing Proteins in the Transport of Enterocin DD14 (EntDD14); a Leaderless Two-Peptide Bacteriocin. International Journal of Molecular Sciences, 22(23), 12877. https://doi.org/10.3390/ijms222312877
 
         
                                                


 
       