Genetic Heterogeneity of Single Circulating Tumour Cells in Colorectal Carcinoma
Abstract
1. Introduction
2. Results
2.1. Validation of the Real-Time qPCR Experiment at the Single-Cell Level
2.2. Multi-marker mRNA Profiling of the Single CTCs, Matched Tumours and Colon Cancer Cell Lines
2.3. Genetic Heterogeneities of the Single CTCs
2.4. Correlation of the Gene Expression of Single CTCs and the Tumour Stages
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Patient Enrolment and Sample Processing
4.3. CTC Enrichment and Identification
4.4. Single CTC Isolation, RNA Extraction and Complementary DNA (cDNA) Conversion
4.5. RNA Extraction from Frozen Tumour Tissues and Reverse Transcription
4.6. Quantitative Real-Time Polymerase Chain Reaction (qRT PCR)
4.7. Statistical Analyses
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| CTCs | Circulating tumour cells |
| CRC | Colorectal carcinoma |
| qPCR | Quantitative polymerase chain reaction |
| EMT | Epithelium–mesenchymal transition |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
| mRNA | Messenger RNA |
| PCA | Principal component analysis |
| gDNA | Genomic DNA |
| WNT | Wingless-related integration site |
References
- Mostert, B.; Sieuwerts, A.M.; Kraan, J.; Bolt-de Vries, J.; van der Spoel, P.; van Galen, A.; Peeters, D.J.; Dirix, L.Y.; Seynaeve, C.M.; Jager, A.; et al. Gene expression profiles in circulating tumor cells to predict prognosis in metastatic breast cancer patients. Ann. Oncol. 2015, 26, 510–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burz, C.; Pop, V.V.; Buiga, R.; Daniel, S.; Samasca, G.; Aldea, C.; Lupan, I. Circulating tumor cells in clinical research and monitoring patients with colorectal cancer. Oncotarget 2018, 9, 24561–24571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pecot, C.V.; Bischoff, F.Z.; Mayer, J.A.; Wong, K.L.; Pham, T.; Bottsford-Miller, J.; Stone, R.L.; Lin, Y.G.; Jaladurgam, P.; Roh, J.W.; et al. A novel platform for detection of CK+ and CK− CTCs. Cancer Discov. 2011, 1, 580–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van der Toom, E.E.; Verdone, J.E.; Gorin, M.A.; Pienta, K.J. Technical challenges in the isolation and analysis of circulating tumor cells. Oncotarget 2016, 7, 62754–62766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, M.C.; Doyle, G.V.; Terstappen, L.W. Significance of Circulating Tumor Cells Detected by the CellSearch System in Patients with Metastatic Breast Colorectal and Prostate Cancer. J. Oncol. 2010, 2010, 617421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicolazzo, C.; Raimondi, C.; Gradilone, A.; Emiliani, A.; Zeuner, A.; Francescangeli, F.; Belardinilli, F.; Seminara, P.; Loreni, F.; Magri, V.; et al. Circulating Tumor Cells in Right- and Left-Sided Colorectal Cancer. Cancers 2019, 11, 1042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teeuwssen, M.; Fodde, R. Cell Heterogeneity and Phenotypic Plasticity in Metastasis Formation: The Case of Colon Cancer. Cancers 2019, 11, 1368. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Fusi, A.; Klopocki, E.; Schmittel, A.; Tinhofer, I.; Nonnenmacher, A.; Keilholz, U. Negative enrichment by immunomagnetic nanobeads for unbiased characterization of circulating tumor cells from peripheral blood of cancer patients. J. Transl. Med. 2011, 9, 70. [Google Scholar] [CrossRef] [Scilit]
- Lapin, M.; Tjensvoll, K.; Oltedal, S.; Buhl, T.; Gilje, B.; Smaaland, R.; Nordgård, O. MINDEC-An Enhanced Negative Depletion Strategy for Circulating Tumour Cell Enrichment. Sci. Rep. 2016, 6, 28929. [Google Scholar] [CrossRef] [Scilit]
- Onstenk, W.; Sieuwerts, A.M.; Mostert, B.; Lalmahomed, Z.; Bolt-de Vries, J.B.; van Galen, A.; Smid, M.; Kraan, J.; Van, M.; de Weerd, V.; et al. Molecular characteristics of circulating tumor cells resemble the liver metastasis more closely than the primary tumor in metastatic colorectal cancer. Oncotarget 2016, 7, 59058–59069. [Google Scholar] [CrossRef] [Scilit]
- Hong, S.P.; Chan, T.E.; Lombardo, Y.; Corleone, G.; Rotmensz, N.; Bravaccini, S.; Rocca, A.; Pruneri, G.; McEwen, K.R.; Coombes, R.C.; et al. Single-cell transcriptomics reveals multi-step adaptations to endocrine therapy. Nat. Commun. 2019, 10, 3840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorges, T.M.; Kuske, A.; Röck, K.; Mauermann, O.; Müller, V.; Peine, S.; Verpoort, K.; Novosadova, V.; Kubista, M.; Riethdorf, S.; et al. Accession of Tumor Heterogeneity by Multiplex Transcriptome Profiling of Single Circulating Tumor Cells. Clin. Chem. 2016, 62, 1504–1515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mostert, B.; Sieuwerts, A.M.; Bolt-de Vries, J.; Kraan, J.; Lalmahomed, Z.; van Galen, A.; van der Spoel, P.; de Weerd, V.; Ramírez-Moreno, R.; Smid, M.; et al. mRNA expression profiles in circulating tumor cells of metastatic colorectal cancer patients. Mol. Oncol. 2015, 9, 920–932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steinert, G.; Schölch, S.; Niemietz, T.; Iwata, N.; García, S.A.; Behrens, B.; Voigt, A.; Kloor, M.; Benner, A.; Bork, U.; et al. Immune escape and survival mechanisms in circulating tumor cells of colorectal cancer. Can. Res. 2014, 74, 1694–1704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reinhardt, F.; Franken, A.; Meier-Stiegen, F.; Driemel, C.; Stoecklein, N.H.; Fischer, J.C.; Niederacher, D.; Ruckhaeberle, E.; Fehm, T.; Neubauer, H. Diagnostic leukapheresis enables reliable transcriptomic profiling of single circulating tumor cells to characterize inter-cellular heterogeneity in terms of endocrine resistance. Cancers 2019, 11, 903. [Google Scholar] [CrossRef] [Scilit]
- Zhong, X.; Zhang, H.; Zhu, Y.; Liang, Y.; Yuan, Z.; Li, J.; Li, J.; Li, X.; Jia, Y.; He, T.; et al. Circulating tumor cells in cancer patients: Developments and clinical applications for immunotherapy. Mol. Cancer 2020, 19, 15. [Google Scholar] [CrossRef] [Scilit]
- Micalizzi, D.S.; Maheswaran, S.; Haber, D.A. A conduit to metastasis: Circulating tumor cell biology. Genes Dev. 2017, 31, 1827–1840. [Google Scholar] [CrossRef] [Scilit]
- Ting, D.T.; Wittner, B.S.; Ligorio, M.; Vincent Jordan, N.; Shah, A.M.; Miyamoto, D.T.; Aceto, N.; Bersani, F.; Brannigan, B.W.; Xega, K.; et al. Single-cell RNA sequencing identifies extracellular matrix gene expression by pancreatic circulating tumor cells. Cell Rep. 2014, 8, 1905–1918. [Google Scholar] [CrossRef] [Scilit]
- Sullivan, J.P.; Nahed, B.V.; Madden, M.W.; Oliveira, S.M.; Springer, S.; Bhere, D.; Chi, A.S.; Wakimoto, H.; Rothenberg, S.M.; Sequist, L.V.; et al. Brain tumor cells in circulation are enriched for mesenchymal gene expression. Cancer Discov. 2014, 4, 1299–1309. [Google Scholar] [CrossRef] [Scilit]
- Miyamoto, D.T.; Zheng, Y.; Wittner, B.S.; Lee, R.J.; Zhu, H.; Broderick, K.T.; Desai, R.; Fox, D.B.; Brannigan, B.W.; Trautwein, J.; et al. RNA-Seq of single prostate CTCs implicates noncanonical Wnt signaling in antiandrogen resistance. Science 2015, 349, 1351–1356. [Google Scholar] [CrossRef] [Scilit]
- Kondo, Y.; Hayashi, K.; Kawakami, K.; Miwa, Y.; Hayashi, H.; Yamamoto, M. KRAS mutation analysis of single circulating tumor cells from patients with metastatic colorectal cancer. BMC Cancer 2017, 17, 311. [Google Scholar]
- Lang, J.E.; Ring, A.; Porras, T.; Kaur, P.; Forte, V.A.; Mineyev, N.; Tripathy, D.; Press, M.F.; Campo, D. RNA-Seq of Circulating Tumor Cells in Stage II-III Breast Cancer. Ann. Surg. Oncol. 2018, 25, 2261–2270. [Google Scholar]
- Boral, D.; Vishnoi, M.; Liu, H.N.; Yin, W.; Sprouse, M.L.; Scamardo, A.; Hong, D.S.; Tan, T.Z.; Thiery, J.P.; Chang, J.C.; et al. Molecular characterization of breast cancer CTCs associated with brain metastasis. Nat. Commun. 2017, 8, 196. [Google Scholar] [PubMed]
- Jie, X.X.; Zhang, X.Y.; Xu, C.J. Epithelial-to-mesenchymal transition, circulating tumor cells and cancer metastasis: Mechanisms and clinical applications. Oncotarget 2017, 8, 81558–81571. [Google Scholar] [PubMed]
- Wong, S.C.; Chan, C.M.; Ma, B.B.; Hui, E.P.; Ng, S.S.; Lai, P.B.; Cheung, M.T.; Lo, E.S.; Chan, A.K.; Lam, M.Y.; et al. Clinical significance of cytokeratin 20-positive circulating tumor cells detected by a refined immunomagnetic enrichment assay in colorectal cancer patients. Clin. Cancer Res. 2009, 15, 1005–1012. [Google Scholar]
- Welinder, C.; Jansson, B.; Lindell, G.; Wenner, J. Cytokeratin 20 improves the detection of circulating tumor cells in patients with colorectal cancer. Cancer Lett. 2015, 358, 43–46. [Google Scholar] [PubMed]
- Moon, A.; Kim, M.S.; Kim, T.G.; Kim, S.H.; Kim, H.E.; Chen, Y.Q.; Kim, H.R. H-ras, but not N-ras, induces an invasive phenotype in human breast epithelial cells: A role for MMP-2 in the H-ras-induced invasive phenotype. Int. J. Cancer 2000, 85, 176–181. [Google Scholar]
- Powell, E.; Piwnica-Worms, D.; Piwnica-Worms, H. Contribution of p53 to metastasis. Cancer Discov. 2014, 4, 405–414. [Google Scholar]
- Godar, S.; Ince, T.A.; Bell, G.W.; Feldser, D.; Donaher, J.L.; Bergh, J.; Liu, A.; Miu, K.; Watnick, R.S.; Reinhardt, F.; et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell 2008, 134, 62–73. [Google Scholar]
- Chen, C.; Zhao, S.; Karnad, A.; Freeman, J.W. The biology and role of CD44 in cancer progression: Therapeutic implications. J. Hematol. Oncol. 2018, 11, 64. [Google Scholar]
- Dhar, M.; Lam, J.N.; Walser, T.; Dubinett, S.M.; Rettig, M.B.; Di Carlo, D. Functional profiling of circulating tumor cells with an integrated vortex capture and single-cell protease activity assay. Proc. Natl. Acad. Sci. USA 2018, 115, 9986–9991. [Google Scholar] [PubMed]
- Sahlberg, S.H.; Spiegelberg, D.; Glimelius, B.; Stenerlöw, B.; Nestor, M. Evaluation of cancer stem cell markers CD133, CD44, CD24: Association with AKT isoforms and radiation resistance in colon cancer cells. PLoS ONE 2014, 9, e94621. [Google Scholar]
- Patel, V.N.; Bebek, G.; Mariadason, J.M.; Wang, D.; Augenlicht, L.H.; Chance, M.R. Prediction and testing of biological networks underlying intestinal cancer. PLoS ONE 2010, 5, e12497. [Google Scholar]
- Markowitz, S.D.; Bertagnolli, M.M. Molecular origins of cancer: Molecular basis of colorectal cancer. N. Engl. J. Med. 2009, 361, 2449–2460. [Google Scholar]
- Yu, M.; Ting, D.T.; Stott, S.L.; Wittner, B.S.; Ozsolak, F.; Paul, S.; Ciciliano, J.C.; Smas, M.E.; Winokur, D.; Gilman, A.J.; et al. RNA sequencing of pancreatic circulating tumour cells implicates WNT signalling in metastasis. Nature 2012, 487, 510–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ebrahimi, F.; Gopalan, V.; Wahab, R.; Lu, C.T.; Smith, R.A.; Lam, A.K. Deregulation of miR-126 expression in colorectal cancer pathogenesis and its clinical significance. Exp. Cell Res. 2015, 339, 333–341. [Google Scholar] [PubMed]
- Agnoletto, C.; Corrà, F.; Minotti, L.; Baldassari, F.; Crudele, F.; Cook, W.; Di Leva, G.; d’Adamo, A.P.; Gasparini, P.; Volinia, S. Heterogeneity in Circulating Tumor Cells: The Relevance of the Stem-Cell Subset. Cancers 2019, 11, 483. [Google Scholar] [CrossRef] [Scilit]
- Lin, E.; Rivera-Báez, L.; Fouladdel, S.; Yoon, H.J.; Guthrie, S.; Wieger, J.; Deol, Y.; Keller, E.; Sahai, V.; Simeone, D.M.; et al. High-throughput microfluidic labyrinth for the label-free isolation of circulating tumor cells. Cell Syst. 2017, 5, 295–304.e4. [Google Scholar]
- Blassl, C.; Kuhlmann, J.D.; Webers, A.; Wimberger, P.; Fehm, T.; Neubauer, H. Gene expression profiling of single circulating tumor cells in ovarian cancer-Establishment of a multi-marker gene panel. Mol. Oncol. 2016, 10, 1030–1042. [Google Scholar]
- Lam, A.K.; Hamid, F.B.; Gopalan, V. Liquid biopsy: Detection of circulating tumor cells in esophageal squamous cell carcinoma. Methods Mol. Biol. 2020, 2129, 193–202. [Google Scholar]
- Wahab, R.; Gopalan, V.; Islam, F.; Mamoori, A.; Lee, K.T.; Lu, C.T.; Lam, A.K. Expression of GAEC1 mRNA and protein and its association with clinical and pathological parameters of patients with colorectal adenocarcinoma. Exp. Mol. Pathol. 2018, 104, 71–75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gopalan, V.; Ebrahimi, F.; Islam, F.; Vider, J.; Qallandar, O.B.; Pillai, S.; Lu, C.T.; Lam, A.K. Tumour suppressor properties of miR-15a and its regulatory effects on BCL2 and SOX2 proteins in colorectal carcinomas. Exp. Cell Res. 2018, 370, 245–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Genes | Accession no. | Forward (5ʹ-3ʹ) | Reverse (5ʹ-3ʹ) | Amplicon Size (*bp) | |
|---|---|---|---|---|---|
| Epithelial | EPCAM | NM_002354.3 | CGCAGCTCAGGAAGAATGTG | TGAAGTACACTGGCATTGACG | 88 |
| CK20 | NM_019010.3 | CAGTCCCATCTCAGCATGAAAG | CCTCCAGAGAGCTCAACAGC | 109 | |
| Oncogenes | KRAS | NM_033360.3 | AGGCCTGCTGAAAATGACTGAATAT | GCTGTATCGTCAAGGCACTCTT | 80 |
| NRAS | NM_002524.4 | TTGAGGTTCTTGCTGGTGTG | TTAGCTGGATTGTCAGTGCG | 92 | |
| HRAS | NM_005343.4 | TACCGGAAGCAGGTGGTCAT | GATGGCAAACACACACAGGA | 135 | |
| Proliferation | BRAF | NM_004333.6 | TCTTCATGAAGACCTCACAGT | CCAGACAACTGTTCAAACTGA | 96 |
| Cell survival | AKT1 | NM_005163.2 | AAGTACTCTTTCCAGACCC | TTCTCCAGCTTGAGGTC | 197 |
| Tumour suppressor | TP53 | NM_000546.5 | ACCTATGGAAACTACTTCCTG | ACCATTGTTCAATATCGTCC | 99 |
| FOXO3 | NM_001455.4 | GAATGTTGTTGGTTTGAACG | ATTTGGCAAAGGGTTTTCTC | 156 | |
| *EMT | SNAI1 | NM_005985.4 | AACAATGTCTGAAAAGGGAC | ATAGTTCTGGGAGACACATC | 95 |
| SLUG | NM_003068.5 | CATGCCTGTCATACCACAAC | GGTGTCAGATGGAGGAGGG | 169 | |
| SOX2 | NM_003106.4 | GATCCTGGACTTCTTTTTGG | TCTATACAAGGTCCATTCCC | 87 | |
| TWIST1 | NM_057179.3 | ATCATTTGTAACAACCCAGG | CAAATGATAGAGTCAGCACC | 160 | |
| NANOG | NM_024865.4 | CTATCCATCCTTGCAAATGTC | GTTCTGGTCTTCTGTTTCTTG | 198 | |
| Stemness | CD133 | NM_006017.3 | CACTACCAAGGACAAGGCGTTC | CAACGCCTCTTTGGTCTCCTTG | 151 |
| CD44 | NM_000610.4 | CCAGAAGGAACAGTGGTTTGGC | ACTGTCCTCTGGGCTTGGTGTT | 151 | |
| *ECM-degrading | MMP9 | NM_004994.3 | AAGGATGGGAAGTACTGG | GCCCAGAGAAGAAGAAAAG | 151 |
| Cell cycle regulator | CDKN1A | NM_000389.5 | CAGCATGACAGATTTCTACC | CAGGGTATGTACATGAGGAG | 200 |
| *WNT pathway regulator | APC | NM_001127511.3 | AGAGGTCATCTCAGAACAAG | CATGTTGATTTCTCCCACTC | 86 |
| Housekeeping | GAPDH | NM_002046.7 | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG | 87 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hamid, F.B.; Gopalan, V.; Matos, M.; Lu, C.-T.; Lam, A.K.-y. Genetic Heterogeneity of Single Circulating Tumour Cells in Colorectal Carcinoma. Int. J. Mol. Sci. 2020, 21, 7766. https://doi.org/10.3390/ijms21207766
Hamid FB, Gopalan V, Matos M, Lu C-T, Lam AK-y. Genetic Heterogeneity of Single Circulating Tumour Cells in Colorectal Carcinoma. International Journal of Molecular Sciences. 2020; 21(20):7766. https://doi.org/10.3390/ijms21207766
Chicago/Turabian StyleHamid, Faysal Bin, Vinod Gopalan, Marco Matos, Cu-Tai Lu, and Alfred King-yin Lam. 2020. "Genetic Heterogeneity of Single Circulating Tumour Cells in Colorectal Carcinoma" International Journal of Molecular Sciences 21, no. 20: 7766. https://doi.org/10.3390/ijms21207766
APA StyleHamid, F. B., Gopalan, V., Matos, M., Lu, C.-T., & Lam, A. K.-y. (2020). Genetic Heterogeneity of Single Circulating Tumour Cells in Colorectal Carcinoma. International Journal of Molecular Sciences, 21(20), 7766. https://doi.org/10.3390/ijms21207766

