Gluconacetobacter diazotrophicus Changes The Molecular Mechanisms of Root Development in Oryza sativa L. Growing Under Water Stress
Abstract
:1. Introduction
2. Results
2.1. Plant Development
2.2. Gas Exchange
2.3. Chlorophyll Fluorescence
2.4. Photosynthetic Pigments
2.5. Phytohormones and Osmoprotective Solutes
2.6. RT-qPCR Analysis of Root Growth and Developmental Genes
3. Discussion
4. Materials and Methods
4.1. Growth Conditions and Strains
4.2. Experimental Design and Treatments
4.3. Analysis of Agronomical, Physiological, Biochemical, and Molecular Parameters
4.3.1. Plant Morphological Parameters
4.3.2. Gas Exchange and Chlorophyll Fluorescence
4.3.3. Plant Biochemical Parameters
4.3.4. Plant Molecular Parameters
4.3.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
PGPB | Plant growth promoting bacteria |
ATP | Adenosine triphosphate |
RT-qPCR | Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction |
COG | Clusters of orthologous groups |
SDS | Sodium dodecyl sulfate |
IST | Induced Systemic Tolerance |
Appendix A
Gene ID | Biological Function /Process | Root Phenotype | Primers | Reference |
---|---|---|---|---|
Os09g0488000 | De-novo UDPN-acetylglucosamine | Increased length of PR and AR at high temperature | F-5′ GAGGGGTTGCTACAAGGTCA3′ R-5′ AGAAGTAGAGCCCCATCTGG3′ | [39] |
Os01g0921200 | N-glycosylation | Increased length of PR, AR, LR | F-5′ GTGTGTGGTGCTTTCTTGGT3′ R-5′ GAAAGGAGAGGGTAGCGGTT3′ | [40] |
Os07g0209000 | N-glycosylation | Increased length of PR, AR, LR | F-5′ CAGCATCAGTGGCAGCATAA3′ R-5′ GACTCTTCGGCCTCTGATCT3′ | [41] |
Os02g0550600 | Sugar signaling | Increased length of PR, AR and LR | F-5′ TTCTTCGGATCACAGCCTGT3′ R-5′ TTGAGGAGCGATGGGAAGAG3′ | [42] |
Os02g0117500 | Glutamate (Glu) receptors in Glu-activated ion channels | Increased length of PR, AR and LR | F-5′ CCTGAGGAATTTGCGTACGG3′ R-5′ TTTGTCGACTCGGATCAGCT3′ | [43] |
Os11g0544800 | tRNA-dependent amidotransferase | Increased length of PR and AR | F-5′ CACATCACAGCGAAGGGAAC3′ R-5′ AGAACAGGGATAGAGGCTGC3′ | [44] |
Os03g0305500 | Arginine biosynthetic pathway | Precocious PR and AR growth | F-5′ TGTAGAGCTGCCAGTCGTAG3′ R-5′ GAGGAAGGAGACCAAGCTGT3′ | [45] |
Os02g0559800 | Activates nitrogen signaling | Increased length of PR and AR | F-5′ GCGGCTGAGGTCACTGAG3′ R-5′ GTCGTCGTTGTCTCCTCCG3′ | [46] |
Os01g0898300 | Ion homeostasis | Increased length of PR, AR and LR | F-5′ GTCCATCAGTGCCTGCATTT3′ R-5′ TGGCGTGTTCTTGATCCTCT3′ | [47] |
Os01g0128000 | Pi signaling and GA biosynthesis | Increased length of LR | F-5′ CCATGGCAGGCAATGTAGTT3′ R-5′ CATGGGAGTGATGAGCAAGC3′ | [48] |
Os04g0671900 | Auxin signaling | Increased length of PR and AR | F-5′ TTGGGCTCAACATCGTTTGG3′ R-5′ CCCTCAAGAACACTGCAACC3′ | [49] |
Os06g0181700 | Ethylene signaling | Increased length of PR in sf2857 | F-5′ ATCTGGTCCACGTACTGCTC3′ R-5′ GTGATTCCGTCCCTTCCCG3′ | [50] |
Os02g0274100 | Salicylic acid biosynthesis | Increased length of PR and AR | F-5′ CAGTTCCCAACCACAACAGG3′ R-5′ TGCTTGAAATTGTCCGGACG3′ | [51] |
Os05g0389000 | GA Biosynthesis | Increased length of PR | F-5′ GTGACAGGTTGACTTGCTGG3′ R-5′ AGCTCCATACACATTGCCCT3′ | [52] |
Os03g0149100 | Auxin signaling | Increased AR or CR | F-5′ CTGCAGCGTCATCACCTG3′ R-5′ CCGCCGTCACTATCTCCTAC3′ | [53] |
Os06g0597000 | Auxin signaling | Decreased number of AR and no LR; | F-5′ GTGTACACGCGTTGCTTACT3′ R-5′ CAAAGCTCGTCGACTTGGTC3′ | [54] |
Os04g0615000 | Auxin signaling | Increased length of PR and AR; Increased number of AR | F-5′ ATAAATGCACCGTCAGCTCG3′ R-5′ CCTGGCGTTTATCTTGGAGC3′ | [55] |
Os07g0497100 | Auxin signaling; Chromatin remodeling | Increased number and length of CR | F-5′ TGCAGGTGTTCTTCCATCCA3′ R-5′ TGGCATCAGATGTGGACAGT3′ | [56] |
Os01g0940000 | Cytokinin signaling | Increased length of PR and CR; Increased numbers of CR | F-5′ GTCTCATGCAGCACGTTGAT3′ R-5′ GTCGTCAAGATGGAGTCCCT3′ | [57] |
Os03g0633500 | Auxin signaling | Decreased length of PR and AR; Decreased number of LR | F-5′ CCTTTCATGATTCGGAGGCG3′ R-5′ AGATGACCTGGAGTACGTGC3′ | [58] |
Os04g0379900 | Fatty acid desaturation | Increased length and number of LR | F-5′ GGCTGCCATGACTTCTCAAC3′ R-5′ CATTCACTGCCACCCCAAAA3′ | [59] |
Os10g0402200 | DNA replication | Increased length of PR and LR at high temperature | F-5′ GCCTCAACAAGCTCCTGAAG3′ R-5′ ACATTCCGGGATCTTGCAGA3′ | [60] |
Os10g0561800 | Auxin signaling | Increased length of PR; Increased length and number of RH | F-5′ CCACCTCCGTCTGCTTCA3′ R-5′ ACCCTCAATCCCAAGCAGAA3′ | [61] |
Os0048I04.3 | Ubiquitin | Constitutive | F-5′TGGTCAGTAATCAGCCAGTTTGG3′ R-5′GCACCACAAATACTTGACGAACAG3′ | [62] |
Gene ID | Biological Function /Process | Organism | Primers | Reference |
---|---|---|---|---|
Os04g02780 | Auxin Biosynthesis | O. sativa L. | F-5′ CAAGCTCCGAGATCTGGACGAGC3′ R-5′ TAATACGACTCACTATAGGGCGAA3′ | [49] |
Os05g0178100 | GA Biosynthesis | O. sativa L. | F-5′ CGCTACTCGAATCATGCTCA3′ R-5′ AGAGCAAGGCCGTGTATCAG3′ | [52] |
OsIPT4 | Cytokinin Biosynthesis | O. sativa L. | F-5′ TGGATGTGGTGACGAACAAGGTGA3′ R-5′ GATCTACGTCGACCCAGAGGAAGC3′ | [57] |
GDI2456 | Auxin Biosynthesis | G. diazotrophicus | F-5′ GTATCCCAGCCACGGCTATTTC3′ R-5′ GATAGTTCGGATGACCTG3′ | This study |
GDI2364 | GA Biosynthesis | G. diazotrophicus | F-5′ GAGGAACGCAAAACTTCCTG3′ R-5′ CGGACTGTTGCAGATGAAGA 3′ | This study |
GDI2697 | Cytokinin Biosynthesis | G. diazotrophicus | F-5′ AGCAGTTGATGCGATGACAG3′ R-5′ AAGCAGCATGATCTCGTTCC3′ | This study |
23S rRNA | 23S (Constitutive) | G. diazotrophicus | F-5′ AAAGCCGGATCAATCCGTTA3′ R-5′ AAGCCGTAGTCGATGGAAAC3′ | [6] |
References
- Glick, B.R. Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol. Res. 2014, 169, 30–39. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, A.; Fischer, D.; Kinzel, L.; Chowdhury, S.P.; Hofmann, A.; Baldani, J.I.; Rothballer, M. Assessment of the structural and functional diversities of plant microbiota: Achievements and challenges—A review. J. Adv. Res. 2019, in press. [Google Scholar] [CrossRef] [PubMed]
- Filgueiras, L.; Silva, R.; Almeida, I.; Vidal, M.; Baldani, J.I.; Meneses, C.H.S.G. Gluconacetobacter diazotrophicus mitigates drought stress in Oryza sativa L. Plant Soil. 2019. [Google Scholar] [CrossRef]
- Vandenkoornhuyse, P.; Quaiser, A.; Duhamel, M.; Le Van, A.; Dufresne, A. The importance of the microbiome of the plant holobiont. New Phytol. 2015, 206, 1196–1206. [Google Scholar] [CrossRef]
- Ngumbi, E.; Kloepper, J. Bacterial-mediated drought tolerance: Current and future prospects. Appl. Soil Ecol. 2016, 105, 109–125. [Google Scholar] [CrossRef]
- Meneses, C.; Gonçalves, T.; Alquéres, S.; Rouws, L.; Serrato, R.; Vidal, M.; Baldani, J.I. Gluconacetobacter diazotrophicus exopolysaccharide protects bacterial cells against oxidative stress in vitro and during rice plant colonization. Plant Soil. 2017, 416, 133–147. [Google Scholar] [CrossRef]
- Reddy, I.N.B.L.; Kim, B.K.; Yoon, I.S.; Kim, K.H.; Kwon, T.R. Salt tolerance in Rice: Focus on mechanisms and approaches. Rice Sci. 2017, 24, 123–144. [Google Scholar] [CrossRef]
- Farooq, M.; Wahid, A.; Kobayashi, N.; Fujita, D.; Basra, S.M.A. Plant drought stress: Effects, mechanisms and management. Agron. Sustain. Dev. 2009, 29, 185–212. [Google Scholar] [CrossRef] [Green Version]
- Meng, F.; Xiang, D.; Zhu, J.; Li, Y.; Mao, C. Molecular Mechanisms of Root Development in Rice. Rice 2019, 12. [Google Scholar] [CrossRef] [Green Version]
- Ahn, T.S.; Ka, J.O.; Lee, G.H.; Song, H.G. Microcosm study for revegetation of barren land with wild plants by some plant growth-promoting rhizobacteria. J. Microbiol. Biotechnol. 2007, 17, 52–57. [Google Scholar]
- Awad, N.M.; Turky, A.S.; Abdelhamid, M.T.; Attia, M. Ameliorate of environmental salt stress on the growth of Zea mays L. plants by exopolysaccharides producing bacteria. J. Appl. Sci. Res. 2012, 8, 2033–2044. [Google Scholar]
- Sandhya, V.; Ali, S.Z.; Grover, M.; Reddy, G.; Venkateswaralu, B. Effect of plant growth promoting Pseudomonas spp. on compatible solutes antioxidant status and plant growth of maize under drought stress. Plant Growth Regul. 2010, 62, 21–30. [Google Scholar] [CrossRef]
- Comas, L.H.; Becker, S.R.; Cruz, V.M.; Byrne, P.F.; Dierig, D.A. Root traits contributing to plant productivity under drought. Front. Plant Sci. 2013, 4, 442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barnawal, D.; Bharti, N.; Pandey, S.S.; Pandey, A.; Chanotiya, C.S.; Kalra, A. Plant growth-promoting rhizobacteria enhance wheat salt and drought stress tolerance by altering endogenous phytohormone levels and TaCTR1/TaDREB2 expression. Physiol. Plant. 2017, 161, 502–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Birouste, M.; Zamora-Ledezma, E.; Bossard, C.; Perez-Ramos, I.M.; Roumet, C. Measurement of fine root tissue density: A comparison of three methods reveals the potential of root dry matter content. Plant Soil. 2014, 374, 299–313. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.; Li, Y.; Cui, Y.; Liu, R.; Li, Y.; Chen, Q.; Gu, Y.; Zhao, K.; Xiang, Q.; Xu, K.; et al. An indoleacetic acid-producing Ochrobactrum sp. MGJ11 counteracts cadmium effect on soybean by promoting plant growth. J. Appl. Microbiol. 2017, 122, 987–996. [Google Scholar] [CrossRef]
- Dal Cortivo, C.; Barion, G.; Visioli, G.; Mattarozzi, M.; Mosca, G.; Vamerali, T. Increased root growth and nitrogen accumulation in common wheat following PGPR inoculation: Assessment of plant-microbe interactions by ESEM. Agric. Ecosyst. Environ. 2017, 247, 396–408. [Google Scholar] [CrossRef]
- Lim, C.W.; Baek, W.; Jung, J.; Kim, J.H.; Lee, S.C. Function of ABA in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci. 2015, 16, 15251–15270. [Google Scholar] [CrossRef] [Green Version]
- Maxwell, K.; Johnson, G.N. Chlorophyll fluorescence-a practical guide. J. Exp. Bot. 2000, 51, 659–668. [Google Scholar] [CrossRef]
- Zhang, H.; Kim, M.S.; Krishnamachari, V.; Payton, P.; Sun, Y.; Grimson, M.; Farag, M.A.; Ryu, C.M.; Allen, R.; Melo, I.S.; et al. Rhizobacterial volatile emissions regulate auxin homeostasis and cell expansion in Arabidopsis. Planta 2007, 226, 839–851. [Google Scholar] [CrossRef]
- Gururani, M.A.; Upadhyaya, C.P.; Baskar, V.; Venkatesh, J.; Nookaraju, A.; Park, S.W. Plant growth promoting rhizobacteria enhance abiotic stress tolerance in Solanum tuberosum through inducing changes in the expression of ROS scavenging enzymes and improved photosynthetic performance. J. Plant Growth Regul. 2012, 32, 245–258. [Google Scholar] [CrossRef]
- Rascio, N.; Dalla, V.F.; La Roccaa, N. Metal accumulation and damage in rice (cv. Vilone Nano) seedlings exposed to cadmium. Environ Exp. Bot. 2008, 62, 267–278. [Google Scholar] [CrossRef]
- Tanaka, A.; Ito, H.; Tanaka, R.; Tanaka, N.K.; Yoshida, K.; Okada, K. Chlorophyll a oxygenase (CAO) is involved in chlorophyll b formation from chlorophyll a. Proc. Natl. Acad. Sci. USA 1998, 95, 12719–12723. [Google Scholar] [CrossRef] [Green Version]
- Rizvi, A.; Khan, M.S. Heavy metal induced oxidative damage and root morphology alterations of maize (Zea mays L.) plants and stress mitigation by metal tolerant nitrogen fixing Azotobacter chroococcum. Ecotoxicol. Environ. 2018, 157, 9–20. [Google Scholar] [CrossRef]
- Kaushal, M.; Wani, S.P. Plant-growth-promoting rhizobacteria: Drought stress alleviators to ameliorate crop production in drylands. Ann. Microbiol. 2018, 66, 35–42. [Google Scholar] [CrossRef]
- Fahad, S.; Hussain, S.; Bano, A.; Saud, S.; Hassan, S.; Shan, D.; Khan, F.A.; Khan, F.; Chen, Y.; Wu, C. Potential role of phytohormones and plant growth-promoting rhizobacteria in abiotic stresses: Consequences for changing environment. Environ. Sci. Pollut. Res. 2015, 22, 4907–4921. [Google Scholar] [CrossRef]
- Ahmed, A.; Hasnain, S. Auxins as one of the factors of plant growth improvement by plant growth promoting rhizobacteria. Pol. J. Microbiol. 2014, 63, 261–266. [Google Scholar] [CrossRef]
- Wu, H.M.; Hazak, O.; Cheung, A.Y.; Yalovsky, S. RAC/ROP GTPases and auxin signaling. Plant Cell. 2011, 23, 1208–1218. [Google Scholar] [CrossRef] [Green Version]
- Parray, J.A.; Jan, S.; Kamili, A.N.; Qadri, R.A.; Egamberdieva, D.; Ahmad, P. Current perspectives on plant growth-promoting rhizobacteria. J. Plant Growth Regul. 2016, 35, 877–902. [Google Scholar] [CrossRef]
- Cavalcante, V.A.; Döbereiner, J. A new acid tolerant nitrogen-fixing bacterium associated with sugarcane. Plant Soil. 1998, 108, 23–31. [Google Scholar] [CrossRef] [Green Version]
- Reis, V.M.; Olivares, F.L.; Döbereiner, J. Improved methodology for isolation of Acetobacter diazotrophicus and confirmation of its endophytic habitat. World J. Microbiol. Biotechnol. 1994, 10, 101–104. [Google Scholar] [CrossRef]
- Hurek, T.; Reinhold, H.B.; Van, M.M.; Kellenberger, E. Root colonization and systematic spreading of Azoarcus sp. strain BH72 in grasses. J. Bacteriol. 1994, 176, 1913–1923. [Google Scholar] [CrossRef] [Green Version]
- Baldani, J.I.; Reis, V.M.; Videira, S.S.; Boddey, L.H.; Baldani, V.L.D. The art of isolating nitrogen-fixing bacteria from non-leguminous plants using N-free semi-solid media: A practical guide for microbiologists. Plant Soil. 2014, 384, 413–431. [Google Scholar] [CrossRef]
- Konrad, M.L.F.; Silva, J.A.B.; Furlani, P.R.; Machado, E.C. Trocas gasosas e fluorescência da clorofila em seis cultivares de cafeeiro sob estresse de alumínio. Bragantia 2005, 64, 30–37. [Google Scholar] [CrossRef]
- Wellburn, A.R. The spectral determination of chlorophylls a and b, as well as total Carotenoids, using various solvents with spectrophotometers of different resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- Terra, L.A.; Soares, C.P.; Meneses, C.H.S.G.; Sfeir, T.Z.M.; Souza, E.M.; Silveira, V.; Vidal, S.M.; Baldani, J.I.; Schwab, S. Transcriptome and proteome profiles of the diazotroph Nitrospirillum amazonense strain CBAmC in response to the sugarcane apoplast fluid. Plant Soil. 2019, 124. [Google Scholar] [CrossRef]
- Holmes, A.; Birse, L.; Jackson, J.W.; Holden, N.J. An optimized method for the extraction of bacterial mRNA from plant roots infected with Escherichia coli O157:H7. Front. Microb. 2014, 5, 1–7. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Jiang, H.; Wang, S.; Dang, L.; Wang, S.; Chen, H.; Wu, Y.; Jiang, X.; Wu, P. A novel short-root gene encodes a glucosamine-6-phosphate acetyltransferase required for maintaining normal root cell shape in rice. Plant Physiol. 2005, 138, 232–242. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Xu, Y.; Li, Z.; Zhang, S.; Lim, J.M.; Lee, K.O.; Li, C.; Qian, Q.; Jiang, A.; Qi, Y. OsMOGS is required for N-glycan formation and auxin-mediated root development in rice (Oryza sativa L.). Plant J. 2014, 78, 632–645. [Google Scholar] [CrossRef] [Green Version]
- Qin, C.; Li, Y.; Gan, J.; Wang, W.; Zhang, H.; Liu, Y.; Wu, P. OsDGL1, a homolog of an oligosaccharyltransferase complex subunit, is involved in N-glycosylation and root development in rice. Plant Cell. Physiol. 2013, 54, 129–137. [Google Scholar] [CrossRef]
- Jia, L.; Zhang, B.; Mao, C.; Li, J.; Wu, Y.; Wu, P.; Wu, Z. OsCYT-INV1 for alkaline/neutral invertase is involved in root cell development and reproductivity in rice (Oryza sativa L.). Planta 2008, 228, 51–59. [Google Scholar] [CrossRef]
- Li, J.; Zhu, S.; Song, X.; Shen, Y.; Chen, H.; Yu, J.; Yi, K.; Liu, Y.; Karplus, V.J.; Wu, P.; et al. A rice glutamate receptor-like gene is critical for the division and survival of individual cells in the root apical meristem. Plant Cell. 2006, 18, 340–349. [Google Scholar] [CrossRef] [Green Version]
- Qin, C.; Cheng, L.; Zhang, H.; He, M.; Shen, J.; Zhang, Y.; Wu, P. OsGatb, the subunit of tRNA-dependent amidotransferase, is required for primary root development in rice. Front. Plant Sci. 2014, 7, 599–605. [Google Scholar] [CrossRef] [Green Version]
- Xia, J.; Yamaji, N.; Che, J.; Shen, R.F.; Ma, J.F. Normal root elongation requires arginine produced by argininosuccinate lyase in rice. Plant J. 2014, 78, 215–226. [Google Scholar] [CrossRef]
- Koiwai, H.; Tagiri, A.; Katoh, S.; Katoh, E.; Ichikawa, H.; Minami, E.; Nishizawa, Y. RING-H2 type ubiquitin ligase EL5 is involved in root development through the maintenance of cell viability in rice. Plant J. 2007, 51, 92–104. [Google Scholar] [CrossRef]
- Jia, L.; Wu, Z.; Hao, X.; Carrie, C.; Zheng, L.; Whelan, J.; Wu, Y.; Wang, S.; Wu, P.; Mao, C. Identification of a novel mitochondrial protein, SHORT POSTEMBRYONIC ROOTS 1 (SPR1), involved in root development and iron homeostasis in Oryza sativa. New Phytol. 2011, 189, 843–855. [Google Scholar] [CrossRef]
- Gu, M.; Zhang, J.; Li, H.; Meng, D.; Li, R.; Dai, X.; Wang, S.; Liu, W.; Qu, H.; Xu, G. Maintenance of phosphate homeostasis and root development are coordinately regulated by MYB1, an R2R3-type MYB transcription factor in rice. J. Exp. Bot. 2017, 68, 3603–3615. [Google Scholar] [CrossRef] [Green Version]
- Qi, Y.; Wang, S.; Shen, C.; Zhang, S.; Chen, Y.; Xu, Y.; Liu, Y.; Wu, Y.; Jiang, D. OsARF12, a transcription activator on auxin response gene, regulates root elongation and affects iron accumulation in rice (Oryza sativa L.). New Phytol. 2012, 193, 109–120. [Google Scholar] [CrossRef]
- Xiao, G.; Qin, H.; Zhou, J.; Quan, R.; Lu, X.; Huang, R.; Zhang, H. OsERF2 controls rice root growth and hormone responses through tuning expression of key genes involved in hormone signaling and sucrose metabolism. Plant Mol. Biol. 2016, 90, 293–302. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Zhao, H.; Ruan, W.; Deng, M.; Wang, F.; Peng, J.; Luo, J.; Chen, Z.; Yi, K. ABNORMAL INFLORESCENCE MERISTEM1 functions in salicylic acid biosynthesis to maintain proper reactive oxygen species levels for root MERISTEM activity in rice. Plant Cell. 2017, 29, 560–574. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Zhao, Y.; Chu, H.; Wang, L.; Fu, Y.; Liu, P.; Upadhyaya, N.; Chen, C.; Mou, T.; Feng, Y.; et al. SHOEBOX modulates root meristem size in rice through dose-dependent effects of gibberellins on cell elongation and proliferation. PLoS Genet. 2015, 11, e1005464. [Google Scholar] [CrossRef]
- Liu, H.; Wang, S.; Yu, X.; Yu, J.; He, X.; Zhang, S.; Shou, H.; Wu, P. ARL1, a LOB-domain protein required for adventitious root formation in rice. Plant J. 2005, 43, 47–56. [Google Scholar] [CrossRef]
- Ni, J.; Wang, G.; Zhu, Z.; Zhang, H.; Wu, Y.; Wu, P. OsIAA23-mediated auxin signaling defines postembryonic maintenance of QC in rice. Plant J. 2011, 68, 433–442. [Google Scholar] [CrossRef]
- Cho, S.H.; Yoo, S.C.; Zhang, H.; Lim, J.H.; Paek, N.C. Rice narrow leaf1 regulates leaf and adventitious root development. Plant Mol. Biol. 2014, 32, 270–281. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, D.; Gan, T.; Liu, L.; Long, W.; Wang, Y.; Niu, M.; Li, X.; Zheng, M.; Jiang, L.; et al. CRL6, a member of the CHD protein family, is required for crown root development in rice. Plant Physiol. Bioch. 2016, 105, 185–194. [Google Scholar] [CrossRef]
- Gao, S.; Fang, J.; Xu, F.; Wang, W.; Sun, X.; Chu, J.; Cai, B.; Feng, Y.; Chu, C. Cytokinin oxidase/dehydrogenase 4 integrates cytokinin and auxin signaling to control rice crown root formation. Plant Physiol. 2014, 165, 1035–1046. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Z.; Liu, Y.; Liu, S.; Mao, C.; Wu, Y.; Wu, P. A gain-of-function mutation in OsIAA11 affects lateral root development in rice. Mol. Plant. 2012, 5, 154–161. [Google Scholar] [CrossRef] [Green Version]
- Shelley, I.J.; Nishiuchi, S.; Shibata, K.; Inukai, Y. SLL1, which encodes a member of the stearoyl-acyl carrier protein fatty acid desaturase family, is involved in cell elongation in lateral roots via regulation of fatty acid content in rice. Plant Sci. 2013, 207, 12–17. [Google Scholar] [CrossRef]
- Chen, X.; Shi, J.; Hao, X.; Liu, H.; Shi, J.; Wu, Y.; Wu, Z.; Chen, M.; Wu, P.; Mao, C. OsORC3 is required for lateral root development in rice. Plant J. 2013, 74, 339–350. [Google Scholar] [CrossRef]
- Kim, C.M.; Park, S.H.; Je, B.I.; Park, S.H.; Park, S.J.; Piao, H.L.; Eun, M.Y.; Dolan, L.; Han, C.D. OsCSLD1, a cellulose synthase-like D1 gene, is required for root hair morphogenesis in rice. Plant Physiol. 2007, 143, 1220–1230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rossatto, T.; Amaral, M.N.; Benitez, L.C.; Vighi, I.L.; Braga, E.; Magalhães, J.A.M.; Maia, M.; Silva, P.L. Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress. Physiol. Mol. Biol. Plants 2017, 23, 865–875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Compounds | 100% | 70% | 50% | 30% | ||||
---|---|---|---|---|---|---|---|---|
NI | I | NI | I | NI | I | NI | I | |
(a) | ||||||||
IAA | 4.21 ± 1.01 Bc | 7.37 ± 2.19 Ac | 10.22 ± 1.74 Bb | 33.92 ± 3.55 Ab | 15.29 ± 1.22 Ba | 360.23 ± 8.22 Aa | 2.77 ± 0.21 Ad | 3.1 ± 0.85 Ad |
GA1 | 6.44 ± 0.44 Bc | 8.77 ± 1.11 Ac | 10.74 ± 1.12 Bb | 22.41 ± 1.02 Ab | 12.11 ± 3.41 Ba | 81.44 ± 3.41 Aa | 2.28 ± 0.88 Ad | 3.21 ± 0.47 Ad |
GA3 | 8.17 ± 0.99 Bc | 9.11 ± 3.13 Ac | 11.12 ± 3.24 Bb | 37.19 ± 4.24 Ab | 13.54 ± 4.87 Ba | 90.77 ± 4.87 Aa | 5.74 ± 1.77 Ad | 5.07 ± 1.11 Ad |
Cyt | 3.79 ± 0.21 Bc | 7.12 ± 1.91 Ac | 10.31 ± 2.01 Bb | 11.31 ± 2.11 Ab | 16.74 ± 4.74 Ba | 50.33 ± 4.34 Aa | 3.11 ± 0.11 Ad | 3.4 ± 0.98 Ad |
Treh | 4.87 ± 0.44 Bc | 5.77 ± 0.87 Ac | 10.78 ± 2.41 Bb | 20.78 ± 2.11 Ab | 12.94 ± 3.22 Ba | 60.74 ± 3.44 Aa | 4.11 ± 0.77 Ad | 4.55 ± 0.85 Ad |
α-Toc | 3.74 ± 0.41 Bc | 4.99 ± 0.47 Ac | 6.74 ± 0.74 Bb | 19.74 ± 0.44 Ab | 10.27 ± 2.94 Ba | 50.79 ± 2.77 Aa | 3.12 ± 0.84 Ad | 3.80 ± 0.81 Ad |
(b) | ||||||||
IAA | 3.99 ± 1.00 Ba | 6.37 ± 2.47 Aa | 5.74 ± 0.74 Aa | 6.44 ± 3.99 Aa | 6.89 ± 0.11 Aa | 7.10 ± 1.71 Aa | 6.33 ± 0.51 Aa | 5.1 ± 0.66 Aa |
GA1 | 5.82 ± 0.45 Aa | 5.77 ± 1.21 Aa | 5.76 ± 0.82 Aa | 5.73 ± 1.09 Aa | 6.55 ± 0.29 Aa | 7.23 ± 2.78 Aa | 6.79 ± 0.78 Aa | 5.88 ± 0.54 Aa |
GA3 | 9.11 ± 0.89 Aa | 9.78 ± 3.69 Aa | 8.54 ± 0.24 Aa | 10.33 ± 0.24 Aa | 11.45 ± 1.33 Aa | 10.33 ± 1.33 Aa | 10.1 ± 1.12 Aa | 9.89 ± 1.87 Aa |
Cyt | 4.21 ± 0.74 Aa | 7.78 ± 1.96 Aa | 8.63 ± 0.71 Aa | 9.74 ± 0.21 Aa | 10.79 ± 2.44 Aa | 10.87 ± 0.87 Aa | 9.11 ± 0.12 Aa | 8.98 ± 0.25 Aa |
Treh | 4.74 ± 0.55 Aa | 5.32 ± 0.58 Aa | 6.33 ± 0.41 Aa | 7.29 ± 0.31 Aa | 7.55 ± 2.22 Aa | 8.22 ± 0.55 Aa | 8.11 ± 0.45 Aa | 8.55 ± 0.87 Aa |
α-Toc | 3.69 ± 0.75 Aa | 4.00 ± 0.47 Aa | 3.91 ± 0.75 Aa | 4.58 ± 0.82 Aa | 4.55 ± 0.33 Aa | 4.21 ± 1.22 Aa | 4.12 ± 0.78 Aa | 4.80 ± 0.85 Aa |
Gene name | Gene ID | 100% | 70% | 50% | 30% | ||||
---|---|---|---|---|---|---|---|---|---|
NI | I | NI | I | NI | I | NI | I | ||
OsGNA1 | Os09g0488000 | 1.0 ± 0.00 | 6.5 ± 0.11 | 5.5 ± 0.82 | 15.0 ± 0.55 | 9.3 ± 0.88 | 20.3 ± 0.74 | 7.2 ± 0.34 | 11.0 ± 0.11 |
OsMOGS | Os01g0921200 | 1.0 ± 0.00 | 9.3 ± 0.52 | 3.0 ± 0.36 | 17.3 ± 0.90 | 11.2 ± 0.12 | 29.9 ± 1.11 | 9.1 ± 0.88 | 10.2 ± 0.65 |
OsDGL1 | Os07g0209000 | 1.0 ± 0.00 | 10.5 ± 1.11 | 7.0 ± 0.51 | 18.1 ± 0.60 | 13.0 ± 0.82 | 30.2 ± 0.23 | 4.0 ± 0.65 | 7.5 ± 0.44 |
OsCYT-INV1 | Os02g0550600 | 1.0 ± 0.00 | 2.0 ± 0.43 | 2.5 ± 0.66 | 8.6 ± 0.33 | 4.8 ± 0.55 | 15.0 ± 0.66 | 1.0 ± 0.22 | 1.0 ± 0.92 |
OsGLR3.1 | Os02g0117500 | 1.0 ± 0.00 | 17.0 ± 0.72 | 11.0 ± 0.39 | 22.4 ± 1.10 | 15.0 ± 0.13 | 40.7 ± 0.21 | 5.5 ± 0.92 | 2.1 ± 0.36 |
OsGatB | Os11g0544800 | 1.0 ± 0.00 | 8.0 ± 0.33 | 3.0 ± 0.11 | 14.0 ± 0.03 | 4.7 ± 0.54 | 28.0 ± 0.91 | 3.6 ± 0.43 | 2.9 ± 0.73 |
OsASL1 | Os03g0305500 | 1.0 ± 0.00 | 22.5 ± 0.82 | 8.0 ± 0.81 | 30.9 ± 0.20 | 11.0 ± 0.62 | 50.0 ± 0.17 | 7.2 ± 0.16 | 3.0 ± 0.54 |
OsEL5 | Os02g0559800 | 1.0 ± 0.00 | 17.0 ± 0.21 | 7.5 ± 0.21 | 28.0 ± 0.66 | 20.0 ± 0.11 | 45.0 ± 0.39 | 5.9 ± 0.22 | 2.3 ± 0.11 |
OsSPR1 | Os01g0898300 | 1.0 ± 0.00 | 3.47 ± 0.88 | 6.5 ± 0.22 | 14.0 ± 0.59 | 9.9 ± 0.87 | 18.3 ± 0.73 | 4.2 ± 0.38 | 13.0 ± 0.21 |
OsMYB1 | Os01g0128000 | 1.0 ± 0.00 | 3.33 ± 0.74 | 3.55 ± 0.76 | 20.3 ± 0.88 | 8.27 ± 0.18 | 39.9 ± 0.11 | 10.1 ± 0.31 | 20.2 ± 0.11 |
OsARF12 | Os04g0671900 | 1.0 ± 0.00 | 11.5 ± 1.71 | 4.0 ± 0.59 | 15.1 ± 0.67 | 6.07 ± 0.77 | 20.2 ± 0.44 | 5.05 ± 0.45 | 6.5 ± 0.77 |
OsERF2 | Os06g0181700 | 1.0 ± 0.00 | 4.07 ± 0.43 | 2.8 ± 0.86 | 9.6 ± 0.99 | 5.8 ± 0.74 | 17.0 ± 0.77 | 8.08 ± 0.78 | 9.08 ± 0.82 |
OsAIM1 | Os02g0274100 | 1.0 ± 0.00 | 11.0 ± 0.45 | 8.77 ± 0.87 | 29.4 ± 0.10 | 11.00 ± 0.23 | 30.9 ± 0.91 | 8.5 ± 0.82 | 8.1 ± 0.88 |
SHB | Os05g0389000 | 1.0 ± 0.00 | 10.0 ± 0.11 | 2.0 ± 0.41 | 18.0 ± 0.47 | 4.1 ± 0.11 | 22.0 ± 0.41 | 4.6 ± 0.43 | 4.9 ± 0.44 |
ARL1/CRL1 | Os03g0149100 | 1.0 ± 0.00 | 4.54 ± 0.44 | 3.03 ± 0.43 | 10.9 ± 0.44 | 6.04 ± 0.46 | 34.0 ± 0.87 | 7.8 ± 0.17 | 8.0 ± 0.57 |
OsIAA23 | Os06g0597000 | 1.0 ± 0.00 | 5.0 ± 0.87 | 2.57 ± 0.21 | 2.00 ± 0.66 | 1.89 ± 0.11 | 1.55 ± 0.39 | 1.21 ± 0.22 | 1.11 ± 0.11 |
OsNAL1 | Os04g0615000 | 1.0 ± 0.00 | 5.5 ± 0.81 | 2.5 ± 0.88 | 10.0 ± 0.44 | 7.3 ± 0.71 | 15.3 ± 0.49 | 7.2 ± 0.55 | 10.0 ± 0.01 |
OsCHR4/CRL6 | Os07g0497100 | 1.0 ± 0.00 | 20.2 ± 0.72 | 7.0 ± 0.88 | 28.3 ± 0.97 | 10.2 ± 0.72 | 39.9 ± 0.11 | 9.11 ± 0.18 | 10.4 ± 0.45 |
OsCKX4 | Os01g0940000 | 1.0 ± 0.00 | 15.5 ± 0.11 | 4.04 ± 0.41 | 28.1 ± 0.20 | 6.06 ± 0.42 | 30.4 ± 0.24 | 4.6 ± 0.75 | 5.5 ± 0.54 |
OsIAA11 | Os03g0633500 | 1.0 ± 0.00 | 8.0 ± 0.93 | 7.5 ± 0.86 | 6.6 ± 0.23 | 6.8 ± 0.75 | 6.00 ± 0.96 | 1.0 ± 0.22 | 1.2 ± 0.92 |
OsSLL1 | Os04g0379900 | 1.0 ± 0.00 | 11.0 ± 0.72 | 4.09 ± 0.78 | 20.4 ± 0.10 | 5.0 ± 0.43 | 40.9 ± 0.91 | 4.5 ± 0.12 | 5.1 ± 0.56 |
OsORC3 | Os10g0402200 | 1.0 ± 0.00 | 9.0 ± 0.33 | 4.8 ± 0.11 | 18.0 ± 0.07 | 6.7 ± 0.54 | 23.0 ± 0.74 | 4.6 ± 0.87 | 5.9 ± 0.79 |
OsHOX1 | Os10g0561800 | 1.0 ± 0.00 | 3.33 ± 0.22 | 1.5 ± 0.81 | 9.99 ± 0.29 | 5.05 ± 0.25 | 24.0 ± 0.44 | 4.2 ± 0.15 | 5.0 ± 0.55 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Silva, R.; Filgueiras, L.; Santos, B.; Coelho, M.; Silva, M.; Estrada-Bonilla, G.; Vidal, M.; Baldani, J.I.; Meneses, C. Gluconacetobacter diazotrophicus Changes The Molecular Mechanisms of Root Development in Oryza sativa L. Growing Under Water Stress. Int. J. Mol. Sci. 2020, 21, 333. https://doi.org/10.3390/ijms21010333
Silva R, Filgueiras L, Santos B, Coelho M, Silva M, Estrada-Bonilla G, Vidal M, Baldani JI, Meneses C. Gluconacetobacter diazotrophicus Changes The Molecular Mechanisms of Root Development in Oryza sativa L. Growing Under Water Stress. International Journal of Molecular Sciences. 2020; 21(1):333. https://doi.org/10.3390/ijms21010333
Chicago/Turabian StyleSilva, Renata, Luanna Filgueiras, Bruna Santos, Mariana Coelho, Maria Silva, Germán Estrada-Bonilla, Marcia Vidal, José Ivo Baldani, and Carlos Meneses. 2020. "Gluconacetobacter diazotrophicus Changes The Molecular Mechanisms of Root Development in Oryza sativa L. Growing Under Water Stress" International Journal of Molecular Sciences 21, no. 1: 333. https://doi.org/10.3390/ijms21010333