Effects of Graphene Oxide Nanofilm and Chicken Embryo Muscle Extract on Muscle Progenitor Cell Differentiation and Contraction
Abstract
:1. Introduction
1.1. Muscle Precursor Cells
1.2. Growth Factors
1.3. Niches
2. Results
2.1. GO Characterization
2.2. GO Nanofilm Characterization
2.3. Chicken Embryo Muscle Extract Analysis
2.4. Assessment of Proper Concentration of Chicken Embryo Muscle Extract Supplement for in Vitro Experiment
2.5. Cell Morphology
2.6. Cytotoxicity and Viability of Muscle Cells
2.7. Expression of Genes
3. Discussion
4. Materials and Methods
4.1. Characterization of Graphene Oxide and Preparation of a Graphene Oxide Nanofilm
4.2. Chicken Embryo Muscle Extract Preparation
4.3. Primary Cell Cultures of Muscle Progenitor Cells
4.4. Cell Morphology
4.5. Cell Differentiation
4.6. LDH Assay
4.7. MTT Assay
4.8. Gene Expression
4.9. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gates, C.B.; Karthikeyan, T.; Fu, F.; Huard, J. Regenerative Medicine for the Musculoskeletal System Based on Muscle-derived Stem Cells. J. Am. Acad. Orthop. Surg. 2008, 16, 68–76. [Google Scholar] [CrossRef]
- Knight, M.A.F.; Evans, G.R.D. Tissue engineering: Progress and challenges. Plast. Reconstr. Surg. 2004, 114, 26–37. [Google Scholar] [CrossRef]
- Scaal, M.; Marcelle, C. Chick muscle development. Int. J. Dev. Biol. 2018, 62, 123–132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horsley, V.; Pavlath, G.K. Forming a Multinucleated Cell: Molecules That Regulate Myoblast Fusion. Cells Tissues. Organs. 2004, 176, 67–78. [Google Scholar] [CrossRef] [PubMed]
- Asfour, H.; Allouh, M.; Said, R. Myogenic regulatory factors: The orchestrators of myogenesis after 30 years of discovery. Exp. Biol. Med. 2018, 243, 118–128. [Google Scholar] [CrossRef] [PubMed]
- Valdez, M.R.; Richardson, J.A.; Klein, W.H.; Olson, E.N. Failure of Myf5 to support myogenic differentiation without myogenin, MyoD, and MRF4. Dev. Biol. 2000, 219, 287–298. [Google Scholar] [CrossRef]
- Luo, W.; Li, E.; Nie, Q.; Zhang, X. Myomaker, regulated by MYOD, MYOG and miR-140-3P, promotes chicken myoblast fusion. Int. J. Mol. Sci. 2015, 16, 26186–26201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Endo, T. Molecular mechanisms of skeletal muscle development, regeneration, and osteogenic conversion. Bone 2015, 80, 2–13. [Google Scholar] [CrossRef]
- Bentzinger, C.F.; Wang, Y.X.; Rudnicki, M.A. Building Muscle: Molecular Regulation of Myogenesis. Cold Spring Harb. Perspect. Biol. 2012, 4, a008342. [Google Scholar] [CrossRef]
- Buckingham, M.; Relaix, F. PAX3 and PAX7 as upstream regulators of myogenesis. Semin. Cell Dev. Biol. 2015, 44, 115–125. [Google Scholar] [CrossRef]
- Chal, J.; Pourquié, O. Making muscle: Skeletal myogenesis in vivo and in vitro. Development 2017, 144, 2104–2122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henderson, C.E.; Huchet, M.; Changeux, J.P. Denervation increases a neurite-promoting activity in extracts of skeletal muscle. Nature 1983, 302, 609–611. [Google Scholar] [CrossRef]
- Yin, Q.; Johnson, J.; Prevette, D.; Oppenheim, R. Cell death of spinal motoneurons in the chick embryo following deafferentation: Rescue effects of tissue extracts, soluble proteins, and neurotrophic agents. J. Neurosci. 1994, 14, 7629–7640. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, R.; Vaca, K.; McManaman, J.; Appel, S. Selective effects of skeletal muscle extract fractions on motoneuron development in vitro. J. Neurosci. 1986, 6, 439–447. [Google Scholar] [CrossRef] [PubMed]
- Manthorpe, M.; Skaper, S.D.; Williams, L.R.; Varon, S. Purification of adult rat sciatic nerve ciliary neuronotrophic factor. Brain Res. 1986, 367, 282–286. [Google Scholar] [CrossRef]
- Yablonka-Reuveni, Z. Development and postnatal regulation of adult myoblasts. Microsc. Res. Tech. 1995, 30, 366–380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Slater, C.R. Control of myogenesis in vitro by chick embryo extract. Dev. Biol. 1976, 50, 264–284. [Google Scholar] [CrossRef]
- Ichio, I.; Kimura, I.; Ozawa, E. Promotion of Myoblast Proliferation by Hypoxanthine and RNA in Chick Embryo Extract. Dev. Growth Differ. 1985, 27, 101–110. [Google Scholar] [CrossRef]
- Huang, J.; Wang, K.; Shiflett, L.A.; Brotto, L.; Bonewald, L.F.; Wacker, M.J.; Dallas, S.L.; Brotto, M. Fibroblast growth factor 9 (FGF9) inhibits myogenic differentiation of C2C12 and human muscle cells. Cell Cycle 2019, 18, 3562–3580. [Google Scholar] [CrossRef] [Green Version]
- Goel, A.J.; Rieder, M.K.; Arnold, H.H.; Radice, G.L.; Krauss, R.S. Niche Cadherins Control the Quiescence-to-Activation Transition in Muscle Stem Cells. Cell Rep. 2017, 21, 2236–2250. [Google Scholar] [CrossRef] [Green Version]
- Lewitus, D.Y.; Landers, J.; Branch, J.R.; Smith, K.L.; Callegari, G.; Kohn, J.; Neimark, A.V. Biohybrid carbon nanotube/agarose fibers for neural tissue engineering. Adv. Funct. Mater. 2011, 21, 2624–2632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahadian, S.; Ramón-Azcón, J.; Chang, H.; Liang, X.; Kaji, H.; Shiku, H.; Nakajima, K.; Ramalingam, M.; Wu, H.; Matsue, T.; et al. Electrically regulated differentiation of skeletal muscle cells on ultrathin graphene-based films. Rsc. Adv. 2014, 4, 9534–9541. [Google Scholar] [CrossRef]
- Pinto, A.M.; Gonçalves, I.C.; Magalhães, F.D. Graphene-based materials biocompatibility: A review. Colloids Surf. B Biointerfaces 2013, 111, 188–202. [Google Scholar] [CrossRef] [PubMed]
- Kiew, S.F.; Kiew, L.V.; Lee, H.B.; Imae, T.; Chung, L.Y. Assessing biocompatibility of graphene oxide-based nanocarriers: A review. J. Control. Release 2016, 226, 217–228. [Google Scholar] [CrossRef]
- Kurantowicz, N.; Strojny, B.; Sawosz, E.; Jaworski, S.; Kutwin, M.; Grodzik, M.; Wierzbicki, M.; Lipińska, L.; Mitura, K.; Chwalibog, A. Biodistribution of a High Dose of Diamond, Graphite, and Graphene Oxide Nanoparticles After Multiple Intraperitoneal Injections in Rats. Nanoscale Res. Lett. 2015, 10, 398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strojny, B.; Kurantowicz, N.; Sawosz, E.; Grodzik, M.; Jaworski, S.; Kutwin, M.; Wierzbicki, M.; Hotowy, A.; Lipińska, L.; Chwalibog, A. Long term influence of carbon nanoparticles on health and liver status in rats. PLoS ONE 2015, 10, 1–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Yin, J.; Peng, C.; Hu, W.; Zhu, Z.; Li, W.; Fan, C.; Huang, Q. Distribution and biocompatibility studies of graphene oxide in mice after intravenous administration. Carbon N. Y. 2011, 49, 986–995. [Google Scholar] [CrossRef]
- Shi, X.; Chang, H.; Chen, S.; Lai, C.; Khademhosseini, A.; Wu, H. Regulating cellular behavior on few-layer reduced graphene oxide films with well-controlled reduction states. Adv. Funct. Mater. 2012, 22, 751–759. [Google Scholar] [CrossRef]
- Ku, S.H.; Park, C.B. Myoblast differentiation on graphene oxide. Biomaterials 2013, 34, 2017–2023. [Google Scholar] [CrossRef]
- Lee, T.J.; Park, S.; Bhang, S.H.; Yoon, J.K.; Jo, I.; Jeong, G.J.; Hong, B.H.; Kim, B.S. Graphene enhances the cardiomyogenic differentiation of human embryonic stem cells. Biochem. Biophys. Res. Commun. 2014, 452, 174–180. [Google Scholar] [CrossRef]
- Weaver, C.L.; Cui, X.T. Directed Neural Stem Cell Differentiation with a Functionalized Graphene Oxide Nanocomposite. Adv. Healthc. Mater. 2015, 4, 1408–1416. [Google Scholar] [CrossRef] [PubMed]
- Tenorio, D.L.; Valencia, C.H.; Valencia, C.; Zuluaga, F.; Valencia, M.E.; Mina, J.H.; Tovar, C.D.G. Evaluation of the biocompatibility of cs-graphene oxide compounds in vivo. Int. J. Mol. Sci. 2019, 20, 1572. [Google Scholar]
- Belaid, H.; Nagarajan, S.; Teyssier, C.; Barou, C.; Barés, J.; Balme, S.; Garay, H.; Huon, V.; Cornu, D.; Cavaillès, V.; et al. Development of new biocompatible 3D printed graphene oxide-based scaffolds. Mater. Sci. Eng. C 2020, 110, 110595. [Google Scholar] [CrossRef] [PubMed]
- Marín, J.A.T.; Londoño, S.R.; Delgado, J.; Porras, D.P.N.; Zapata, M.E.V.; Hernandez, J.H.M.; Valencia, C.H.; Tovar, C.D.G. Biocompatible and antimicrobial electrospun membranes based on nanocomposites of chitosan/poly (Vinyl alcohol)/graphene oxide. Int. J. Mol. Sci. 2019, 20, 2987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciriza, J.; Saenz Del Burgo, L.; Virumbrales-Muñoz, M.; Ochoa, I.; Fernandez, L.J.; Orive, G.; Hernandez, M.R.; Pedraz, J.L. Graphene oxide increases the viability of C2C12 myoblasts microencapsulated in alginate. Int. J. Pharm. 2015, 493, 260–270. [Google Scholar] [CrossRef]
- Kim, M.J.; Lee, J.H.; Shin, Y.C.; Jin, L.; Hong, S.W.; Han, D.-W.; Kim, Y.-J.; Kim, B. Stimulated myogenic differentiation of C2C12 murine myoblasts by using graphene oxide. J. Korean Phys. Soc. 2015, 67, 1910–1914. [Google Scholar] [CrossRef]
- Ryoo, S.R.; Kim, Y.K.; Kim, M.H.; Min, D.H. Behaviors of NIH-3T3 fibroblasts on graphene/carbon nanotubes: Proliferation, focal adhesion, and gene transfection studies. Acs Nano 2010, 4, 6587–6598. [Google Scholar] [CrossRef]
- Lee, J.H.; Lee, Y.; Shin, Y.C.; Kim, M.J.; Park, J.H.; Hong, S.W.; Kim, B.; Oh, J.W.; Park, K.D.; Han, D.W. In situ forming gelatin/graphene oxide hydrogels for facilitated C2C12 myoblast differentiation. Appl. Spectrosc. Rev. 2016, 51, 527–539. [Google Scholar] [CrossRef]
- Patel, A.; Xue, Y.; Mukundan, S.; Rohan, L.C.; Sant, V.; Stolz, D.B.; Sant, S. Cell-Instructive Graphene-Containing Nanocomposites Induce Multinucleated Myotube Formation. Ann. Biomed. Eng. 2016, 44, 2036–2048. [Google Scholar] [CrossRef]
- Langelaan, M.L.P.; Boonen, K.J.M.; Kang Yuen, R.-C.; van der Schaft, D.W.J.; Post, M.J.; Baaijens, F.P.T. Advanced maturation by electrical stimulation: Differences in response between C2C12 and primary muscle progenitor cells. J. Tissue Eng. Regen. Med. 2011, 5, 529–539. [Google Scholar] [CrossRef]
- Burch, N.; Arnold, A.S.; Item, F.; Summermatter, S.; Santos, G.B.S.; Christe, M.; Boutellier, U.; Toigo, M.; Handschin, C. Electric pulse stimulation of cultured murine muscle cells reproduces gene expression changes of trained mouse muscle. PLoS ONE 2010, 5, e10970. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boshkovikj, V.; Webb, H.K.; Pham, V.T.H.; Fluke, C.J.; Crawford, R.J.; Ivanova, E.P. Three-dimensional reconstruction of surface nanoarchitecture from two-dimensional datasets. Amb. Express 2014, 4, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langer, R.; Sydlik, S.A.; Jhunjhunwala, S.; Webber, M.J.; Anderson, D.G. In Vivo Compatibility of Graphene Oxide with Differing Oxidation States. Acs Nano 2015, 9, 3866–3874. [Google Scholar]
- Shin, Y.C.; Lee, J.H.; Kim, M.J.; Hong, S.W.; Kim, B.; Hyun, J.K.; Choi, Y.S.; Park, J.C.; Han, D.W. Stimulating effect of graphene oxide on myogenesis of C2C12 myoblasts on RGD peptide-decorated PLGA nanofiber matrices. J. Biol. Eng. 2015, 9, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ionita, M.; Vasile, E.; Crica, L.E.; Voicu, S.I.; Pandele, A.M.; Dinescu, S.; Predoiu, L.; Galateanu, B.; Hermenean, A.; Costache, M. Synthesis, characterization and in vitro studies of polysulfone/graphene oxide composite membranes. Compos. Part. B Eng. 2015, 72, 108–115. [Google Scholar] [CrossRef]
- Patel, A.; Xue, Y.; Hartley, R.; Sant, V.; Eles, J.R.; Cui, X.T.; Stolz, D.B.; Sant, S. Hierarchically aligned fibrous hydrogel films through microfluidic self-assembly of graphene and polysaccharides. Biotechnol. Bioeng. 2018, 115, 2654–2667. [Google Scholar] [CrossRef]
- Chal, J.; Oginuma, M.; Al Tanoury, Z.; Gobert, B.; Sumara, O.; Hick, A.; Bousson, F.; Zidouni, Y.; Mursch, C.; Moncuquet, P.; et al. Differentiation of pluripotent stem cells to muscle fiber to model Duchenne muscular dystrophy. Nat. Biotechnol. 2015, 33, 962–969. [Google Scholar] [CrossRef] [Green Version]
- Zhou, T.; Zhang, B.; Wei, P.; Du, Y.; Zhou, H.; Yu, M.; Yan, L.; Zhang, W.; Nie, G.; Chen, C.; et al. Energy metabolism analysis reveals the mechanism of inhibition of breast cancer cell metastasis by PEG-modified graphene oxide nanosheets. Biomaterials 2014, 35, 9833–9843. [Google Scholar] [CrossRef]
- Pedersen, B.K.; Åkerström, T.C.A.; Nielsen, A.R.; Fischer, C.P. Role of myokines in exercise and metabolism. J. Appl. Physiol. 2007, 103, 1093–1098. [Google Scholar] [CrossRef] [Green Version]
- Pedersen, B.K. Muscle as a secretory organ. Compr. Physiol. 2013, 3, 1337–1362. [Google Scholar]
- Tsukamoto, S.; Shibasaki, A.; Naka, A.; Saito, H.; Iida, K. Lactate Promotes Myoblast Differentiation and Myotube Hypertrophy via a Pathway Involving MyoD In Vitro and Enhances Muscle Regeneration In Vivo. Int. J. Mol. Sci. 2018, 19, 3649. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, N.R.W.; Passey, S.L.; Player, D.J.; Khodabukus, A.; Ferguson, R.A.; Sharples, A.P.; Mudera, V.; Baar, K.; Lewis, M.P. Factors affecting the structure and maturation of human tissue engineered skeletal muscle. Biomaterials 2013, 34, 5759–5765. [Google Scholar] [CrossRef]
- Brzóska, E.; Przewoźniak, M.; Grabowska, I.; Jańczyk-Ilach, K.; Moraczewski, J. Pax3 and Pax7 expression during myoblast differentiation in vitro and fast and slow muscle regeneration in vivo. Cell Biol. Int. 2009, 33, 483–492. [Google Scholar] [CrossRef] [PubMed]
- Jabaily, J.; Singer, M. Neurotrophic and hepatotrophic stimulation of proliferation of embryonic chick muscle cells in vitro: Assay and partial characterization of mitogenic activity in chick embryonic organ and tissue extracts. Dev. Biol. 1978, 64, 189–202. [Google Scholar] [CrossRef]
- Popiela, H. Trophic effects of adult peripheral nerve extract on muscle cell growth and differentiation in vitro. Exp. Neurol. 1978, 62, 405–416. [Google Scholar] [CrossRef]
- Shahini, A.; Vydiam, K.; Choudhury, D.; Rajabian, N.; Nguyen, T.; Lei, P.; Andreadis, S.T. Efficient and high yield isolation of myoblasts from skeletal muscle. Stem Cell Res. 2018, 30, 122–129. [Google Scholar] [CrossRef]
- Relaix, F.; Rocancourt, D.; Mansouri, A.; Buckingham, M. A Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature 2005, 435, 948–953. [Google Scholar] [CrossRef] [Green Version]
- Seale, P.; Ishibashi, J.; Scimè, A.; Rudnicki, M.A. Pax7 is necessary and sufficient for the myogenic specification of CD45+:Sca1+ stem cells from injured muscle. PLoS Biol. 2004, 2, 0664. [Google Scholar] [CrossRef] [Green Version]
- Berkes, C.A.; Tapscott, S.J. MyoD and the transcriptional control of myogenesis. Semin. Cell Dev. Biol. 2005, 16, 585–595. [Google Scholar] [CrossRef]
- Hernández-Hernández, J.M.; García-González, E.G.; Brun, C.E.; Rudnicki, M.A. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin. Cell Dev. Biol. 2017, 72, 10–18. [Google Scholar] [CrossRef]
- Velleman, S.G.; Song, Y. Development and growth of the avian pectoralis major (Breast) muscle: Function of syndecan-4 and glypican-1 in adult myoblast proliferation and differentiation. Front. Physiol. 2017, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Sin, J.; Andres, A.M.; Taylo, D.J.; Weston, T.; Hiraumi, Y.; Stotland, A.; Kim, B.J.; Huang, C.; Doran, K.S.; Gottlieb, R.A. Mitophagy is required for mitochondrial biogenesis and myogenic differentiation of C2C12 myoblasts. Autophagy 2016, 12, 369–380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thomas, K.; Engler, A.J.; Meyer, G.A. Extracellular matrix regulation in the muscle satellite cell niche. Connect. Tissue Res. 2015, 56, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thorsteinsdottir, S.; Deries, M.; Cachaço, A.S.; Bajanca, F. The extracellular matrix dimension of skeletal muscle development. Dev. Biol. 2011, 354, 191–207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huxley, H.E. Muscle Contraction. Eur. News 1986, 17, 5–7. [Google Scholar] [CrossRef]
- Lee, E.J.; Nam, J.H.; Choi, I. Fibromodulin modulates myoblast differentiation by controlling calcium channel. Biochem. Biophys. Res. Commun. 2018, 503, 580–585. [Google Scholar] [CrossRef]
- Kim, I.; Je, H.D.; Gallant, C.; Zhan, Q.; Van Riper, D.; Badwey, J.A.; Singer, H.A.; Morgan, K.G. Ca2+-calmodulin-dependent protein kinase II-dependent activation of contractility in ferret aorta. J. Physiol. 2000, 526, 367–374. [Google Scholar] [CrossRef]
- Novák, P.; Soukup, T. Calsequestrin distribution, structure and function, its role in normal and pathological situations and the effect of thyroid hormones. Physiol. Res. 2011, 60, 439–452. [Google Scholar] [CrossRef]
- Digel, J.; Abugo, O.; Kobayashi, T.; Gryczynski, Z.; Lakowicz, J.R.; Collins, J.H.; Digel, J.; Abugo, O.; Kobayashi, T.; Gryczynski, Z.; et al. Calcium- and magnesium-dependent interactions between the C-terminus of troponin I and the N-terminal, regulatory domain of troponin C. Arch. Biochem. Biophys. 2001, 387, 243–249. [Google Scholar] [CrossRef]
- Guarnieri, S.; Morabito, C.; Paolini, C.; Boncompagni, S.; Pilla, R.; Fanò-Illic, G.; Mariggiò, M.A. Growth Associated Protein 43 Is Expressed in Skeletal Muscle Fibers and Is Localized in Proximity of Mitochondria and Calcium Release Units. PLoS ONE 2013, 8, e53267. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.K.; Caine, C.; Awano, T.; Herbst, R.; Monani, U.R. Motor neuronal repletion of the NMJ organizer, Agrin, modulates the severity of the spinal muscular atrophy disease phenotype in model mice. Hum. Mol. Genet. 2017, 26, 2377–2385. [Google Scholar] [CrossRef] [PubMed]
- Sewry, C.A.; Nowak, K.J.; Ehmsen, J.T.; Davies, K.E. A and B utrophin in human muscle and sarcolemmal A-utrophin associated with tumours. Neuromuscul. Disord. 2005, 15, 779–785. [Google Scholar] [CrossRef] [PubMed]
- Pietras, Z.; Wojcik, M.A.; Borowski, L.S.; Szewczyk, M.; Kulinski, T.M.; Cysewski, D.; Stepien, P.P.; Dziembowski, A.; Szczesny, R.J. Controlling the mitochondrial antisense–role of the SUV3-PNPase complex and its co-factor GRSF1 in mitochondrial RNA surveillance. Mol. Cell. Oncol. 2018, 5, 1–3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef]
- Orlowska, K.P.; Klosowska, K.; Szczesny, R.J.; Cysewski, D.; Krawczyk, P.S.; Dziembowski, A. A new strategy for gene targeting and functional proteomics using the DT40 cell line. Nucleic Acids Res. 2013, 41, e167. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |
Gene Name | Protein Name | Molecular Weight [kDa] |
---|---|---|
Extracellular matrix component | ||
DCN | Decorin | 61.2 |
LAMB1 | Laminin subunit beta-1 | 59.4 |
COL6A2 | Collagen alpha-2 (VI) chain | 58.7 |
A0A1D5PME9 | Leucine rich repeat containing 15 | 50.3 |
FMOD | Fibromodulin | 44.7 |
OGN | Mimecan/Osteoglycin | 42.8 |
A0A1D5PVT6 | Collagen type XI alpha 1 chain | 36.4 |
LMNB1 | Lamin-B1 | 31.6 |
PLOD1 | Procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 | 22.0 |
COL1A1 | Collagen alpha-1 (I) chain | 16.1 |
COL6A3 | Collagen alpha-3 (VI) chain | 14.6 |
LOC107050758 | Collagen alpha-1 (II) chain | 13.1 |
COL14A1 | Collagen alpha-1 (XIV) chain | 11.2 |
LABM1 | Laminin subunit beta-1 | 10.4 |
Cell structure and communication | ||
PXN | Paxillin | 66.6 |
P09652 | Tubulin beta-4 chain | 61.7 |
PTK7 | Inactive tyrosine-protein | 53.7 |
MAPT | Microtubule-associated protein | 51.3 |
CRYAB | Alpha-crystallin B chain | 50.3 |
MAPRE2 | Microtubule-associated protein RP/EB family member 2 | 41.7 |
CDH13 | Cadherin-13 | 40.4 |
COTL1 | ADF actin binding protein | 36.9 |
DMD | Dystrophin | 24.1 |
ZYX | Zyxin | 20.5 |
WIPF1 | WAS/WASL interacting protein family member 1 | 18.8 |
CTNNA2 | Catenin alpha-2 | 18.4 |
Tubulin alpha chain | 13.0 | |
NHLRC2 | NHL repeat-containing protein 2 | 12.4 |
CAP2 | Adenylyl cyclase-associated protein | 11.7 |
ACTG1 | Actin, cytoplasmic 2 | 11.7 |
SPTB | Spectrin beta chain | 10.4 |
JUP | Plakoglobin | 9.92 |
DBN1 | Drebrin | 9.37 |
ACTN2 | Alpha-actinin-2 | 8.02 |
Contractile apparatus | ||
MYL3 | Myosin light chain | 62.2 |
CALD1 | Caldesmon | 61.4 |
CAMK2D | Calcium/calmodulin-dependent protein kinase type II delta chain | 55.3 |
CNN3 | Calponin | 51.3 |
MYLK | Myosin light chain kinase, smooth muscle | 40.5 |
MYLPF | Myosin regulatory light chain 2, skeletal muscle isoform | 37.0 |
TPM1 | Tropomyosin alpha-1 chain | 20.7 |
CASQ2 | Calsequestrin | 19.5 |
TNNC2 | Troponin C, skeletal muscle | 19.3 |
MYH1B | Myosin-1B | 11.4 |
Neural and neuromuscular communication | ||
NEFM | Neurofilament medium polypeptide | 46.2 |
AGRN | Agrin | 46.1 |
TXLNB | Beta-taxilin | 31.8 |
FABP5 | Fatty acid binding protein 5 | 23.4 |
GAP43 | Neuromodulin | 18.8 |
NCAM1 | Neural cell adhesion molecule | 15.1 |
Metabolism | ||
ATP5C1 | ATP synthase subunit gamma | 53.3 |
GMPR | GMP reductase | 49.9 |
GPD2 | Glycerol-3-phosphate dehydrogenase | 45.5 |
PFKM | ATP-dependent 6-phosphofructokinase | 43.8 |
ADSSL1 | Adenylosuccinate synthetase isozyme 1 | 43.6 |
CKM | Creatine kinase M-type | 43.3 |
AMPD1 | AMP deaminase | 25.2 |
A0A1D5PIQ5 | Mitogen-activated protein kinase | 11.4 |
CKB | Creatine kinase B-type | 5.62 |
Genes | Sequences (5′-3′) |
---|---|
PCNA | forward: TGCACGCATTTGTAGAGACC |
reverse: AGTCAGCTGGACTGGCTCAT | |
FGF2 | forward: GCACTGAAATGTGCAACAG |
reverse: TCCAGGTCCAGTTTTTGGTC | |
LDH-5 | forward: ATGCCCACAACAAGATCAG |
reverse: CCTTTCAGCTTGTCCTCCAC | |
ATP5B | forward: GTTATTCGGTGTTCGCTGGT |
reverse: TAGACCAGAGCGACCTTGG | |
Myf5 | forward: CCAGGAGCTCTTGAGGGAAC |
reverse: AGTCCGCCATCACATCGGAG | |
MyoD | forward: GCTCTCGCAGGAGAAACAG |
reverse: CTGGAGGCAGTATGGGACAT | |
MyoG | forward: GCTGAAGAAGGTGAACGAA |
reverse: CTGCTGGTTGAGGCTGCT | |
Pax3 | forward: CCGTGCTAGATGGAGGAAGC |
reverse: AGACACGGCTTGCGGTATG | |
Pax7 | forward: CAGTAGAGACAGGCCAAGC |
reverse: GGAGTTGGGAAGGAGTAGGG | |
GAPDH | forward: GAGGACCAGGTTGTCTCCTG |
reverse: CCACAACACGGTTGCTGTAT | |
ACTB | forward: GTCCACCTTCCAGCAGATGT |
reverse: ATAAAGCCATGCCAATCTCG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bałaban, J.; Wierzbicki, M.; Zielińska, M.; Szczepaniak, J.; Sosnowska, M.; Daniluk, K.; Cysewski, D.; Koczoń, P.; Chwalibog, A.; Sawosz, E. Effects of Graphene Oxide Nanofilm and Chicken Embryo Muscle Extract on Muscle Progenitor Cell Differentiation and Contraction. Molecules 2020, 25, 1991. https://doi.org/10.3390/molecules25081991
Bałaban J, Wierzbicki M, Zielińska M, Szczepaniak J, Sosnowska M, Daniluk K, Cysewski D, Koczoń P, Chwalibog A, Sawosz E. Effects of Graphene Oxide Nanofilm and Chicken Embryo Muscle Extract on Muscle Progenitor Cell Differentiation and Contraction. Molecules. 2020; 25(8):1991. https://doi.org/10.3390/molecules25081991
Chicago/Turabian StyleBałaban, Jaśmina, Mateusz Wierzbicki, Marlena Zielińska, Jarosław Szczepaniak, Malwina Sosnowska, Karolina Daniluk, Dominik Cysewski, Piotr Koczoń, André Chwalibog, and Ewa Sawosz. 2020. "Effects of Graphene Oxide Nanofilm and Chicken Embryo Muscle Extract on Muscle Progenitor Cell Differentiation and Contraction" Molecules 25, no. 8: 1991. https://doi.org/10.3390/molecules25081991