Effects of BDNF and PEC Nanoparticles on Osteocytes
Abstract
:1. Introduction
2. Results
2.1. Selection of the PECNP+BDNF Loading
2.2. Proliferation
2.3. Real-Time Reverse Transcriptase Polymerase Chain Reaction (Real-Time RT-PCR)
3. Discussion
4. Materials and Methods
4.1. PEC-NP
4.2. Cell Culture
4.3. BrdU Assay
4.4. BDNF Enzyme-Linked Immunosorbent Assay (ELISA)
4.5. Real-Time Reverse Transcriptase (RT)-Polymerase Chain Reaction (PCR)
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dallas, S.L.; Prideaux, M.; Bonewald, L.F. The Osteocyte: An Endocrine Cell… and More. Endocr. Rev. 2013, 34, 658–690. [Google Scholar] [CrossRef] [Green Version]
- Weinkamer, R.; Kollmannsberger, P.; Fratzl, P. Towards a Connectomic Description of the Osteocyte Lacunocanalicular Network in Bone. Curr. Osteoporos. Rep. 2019, 17, 186–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakashima, T.; Hayashi, M.; Fukunaga, T.; Kurata, K.; Oh-Hora, M.; Feng, J.Q.; Bonewald, L.F.; Kodama, T.; Wutz, A.; Wagner, E.F.; et al. Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nat. Med. 2011, 17, 1231–1234. [Google Scholar] [CrossRef]
- Xiong, J.; Onal, M.; Jilka, R.L.; Weinstein, R.S.; Manolagas, S.C.; O’Brien, C.A. Matrix-embedded cells control osteoclast formation. Nat. Med. 2011, 17, 1235–1241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, B.; Pang, P.T.; Woo, N.H. The yin and yang of neurotrophin action. Nat. Rev. Neurosci. 2005, 6, 603–614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamashiro, T.; Fukunaga, T.; Yamashita, K.; Kobashi, N.; Takano-Yamamoto, T. Gene and protein expression of brain-derived neurotrophic factor and TrkB in bone and cartilage. Bone 2001, 28, 404–409. [Google Scholar] [CrossRef]
- Asaumi, K.; Nakanishi, T.; Asahara, H.; Inoue, H.; Takigawa, M. Expression of neurotrophins and their receptors (TRK) during fracture healing. Bone 2000, 26, 625–633. [Google Scholar] [CrossRef]
- Kilian, O.; Hartmann, S.; Dongowski, N.; Karnati, S.; Baumgart-Vogt, E.; Härtel, F.V.; Noll, T.; Schnettler, R.; Lips, K.S. BDNF and its TrkB receptor in human fracture healing. Ann. Anat. 2014, 196, 286–295. [Google Scholar] [CrossRef] [PubMed]
- Kauschke, V.; Gebert, A.; Călin, M.; Eckert, J.; Scheich, S.; Heiss, C.; Lips, K.S. Effects of new beta-type Ti-40Nb implant materials, brain-derived neurotrophic factor, acetylcholine and nicotine on human mesenchymal stem cells of osteoporotic and non osteoporotic donors. PLoS ONE 2018, 13, e0193468. [Google Scholar] [CrossRef]
- Carragee, E.J.; Chu, G.; Rohatgi, R.; Hurwitz, E.L.; Weiner, B.K.; Yoon, S.T.; Comer, G.; Kopjar, B. Cancer Risk after Use of Recombinant Bone Morphogenetic Protein-2 for Spinal Arthrodesis. J. Bone Jt. Surg. Am. 2013, 95, 1537–1545. [Google Scholar] [CrossRef] [Green Version]
- Antunes, B.P.; Becker, R.G.; Brunetto, A.T.; Pavei, B.S.; De Farias, C.B.; Rivero, L.F.D.R.; Santos, J.F.C.; De-Oliveira, B.M.; Gregianin, L.J.; Roesler, R.; et al. Expressão de neurotrofinas e de seus receptores no osteossarcoma primário. Rev. Col. Bras. Cir. 2019, 46, e2094. [Google Scholar] [CrossRef] [PubMed]
- Tajbakhsh, A.; Rezaee, M.; Afzaljavan, F.; Rivandi, M.; Hassanian, S.M.; A Ferns, G.; Pasdar, A.; Avan, A.; Mokhtari-Zaer, A. Therapeutic Potentials of BDNF/TrkB in Breast Cancer; Current Status and Perspectives. J. Cell. Biochem. 2017, 118, 2502–2515. [Google Scholar] [CrossRef]
- Ai, L.-S.; Sun, C.-Y.; Zhang, L.; Zhou, S.-C.; Chu, Z.-B.; Qin, Y.; Wang, Y.-D.; Zeng, W.; Yan, H.; Guo, T.; et al. Inhibition of BDNF in Multiple Myeloma Blocks Osteoclastogenesis via Down-Regulated Stroma-Derived RANKL Expression Both In Vitro and In Vivo. PLoS ONE 2012, 7, e46287. [Google Scholar] [CrossRef] [PubMed]
- Ai, L.-S.; Sun, C.-Y.; Wang, Y.-D.; Zhang, L.; Chu, Z.-B.; Qin, Y.; Gao, F.; Yan, H.; Guo, T.; Chen, L.; et al. Gene silencing of the BDNF/TrkB axis in multiple myeloma blocks bone destruction and tumor burden in vitro and in vivo. Int. J. Cancer 2013, 133, 1074–1084. [Google Scholar] [CrossRef]
- Sun, C.-Y.; Chu, Z.-B.; She, X.-M.; Zhang, L.; Chen, L.; Ai, L.-S.; Hu, Y. Brain-derived neurotrophic factor is a potential osteoclast stimulating factor in multiple myeloma. Int. J. Cancer 2011, 130, 827–836. [Google Scholar] [CrossRef] [PubMed]
- Ternes, S.; Trinkaus, K.; Bergen, I.; Knaack, S.; Gelinsky, M.; Kilian, O.; Heiss, C.; Lips, K.S. Impact of acetylcholine and nicotine on human osteoclastogenesis in vitro. Int. Immunopharmacol. 2015, 29, 215–221. [Google Scholar] [CrossRef]
- Kauschke, V.; Hessland, F.M.; Vehlow, D.; Müller, M.; Heiss, C.; Lips, K.S. High Concentrations of Polyelectrolyte Complex Nanoparticles Decrease Activity of Osteoclasts. Molecules 2019, 24, 2346. [Google Scholar] [CrossRef] [Green Version]
- Kauschke, V.; Schneider, M.; Jauch, A.; Schumacher, M.; Kampschulte, M.; Rohnke, M.; Henss, A.; Bamberg, C.; Trinkaus, K.; Gelinsky, M.; et al. Effects of a Pasty Bone Cement Containing Brain-Derived Neurotrophic Factor-Functionalized Mesoporous Bioactive Glass Particles on Metaphyseal Healing in a New Murine Osteoporotic Fracture Model. Int. J. Mol. Sci. 2018, 19, 3531. [Google Scholar] [CrossRef] [Green Version]
- Ida-Yonemochi, H.; Yamada, Y.; Yoshikawa, H.; Seo, K. Locally Produced BDNF Promotes Sclerotic Change in Alveolar Bone after Nerve Injury. PLoS ONE 2017, 12, e0169201. [Google Scholar] [CrossRef] [Green Version]
- Vehlow, D.; Schmidt, R.; Gebert, A.; Siebert, M.; Lips, K.S.; Müller, M. Polyelectrolyte Complex Based Interfacial Drug Delivery System with Controlled Loading and Improved Release Performance for Bone Therapeutics. Nanomaterials 2016, 6, 53. [Google Scholar] [CrossRef] [Green Version]
- Kato, Y.; Windle, J.J.; Koop, B.A.; Mundy, G.R.; Bonewald, L.F. Establishment of an Osteocyte-like Cell Line, MLO-Y4. J. Bone Miner. Res. 2010, 12, 2014–2023. [Google Scholar] [CrossRef] [PubMed]
- Boggs, M.E.; Thompson, W.R.; Farach-Carson, M.C.; Duncan, R.L.; Beebe, T.P. Co-culture of osteocytes and neurons on a unique patterned surface. Biointerphases 2011, 6, 200–209. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Li, X.; Fu, J.; Li, Y.; Gao, L.; Yang, L.; Zhang, P.; Shen, J.; Wang, H. Acetylcholine affects osteocytic MLO-Y4 cells via acetylcholine receptors. Mol. Cell. Endocrinol. 2014, 384, 155–164. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; Pang, P.T.; Feng, L.; Lu, B. Cyclic AMP controls BDNF-induced TrkB phosphorylation and dendritic spine formation in mature hippocampal neurons. Nat. Neurosci. 2005, 8, 164–172. [Google Scholar] [CrossRef]
- Li, T.; Jiang, L.; Zhang, X.; Chen, H. In-vitro effects of brain-derived neurotrophic factor on neural progenitor/stem cells from rat hippocampus. NeuroReport 2009, 20, 295–300. [Google Scholar] [CrossRef]
- Kashiwai, K.; Kajiya, M.; Matsuda, S.; Ouhara, K.; Takeda, K.; Takata, T.; Kitagawa, M.; Fujita, T.; Shiba, H.; Kurihara, H. Distinction Between Cell Proliferation and Apoptosis Signals Regulated by Brain-Derived Neurotrophic Factor in Human Periodontal Ligament Cells and Gingival Epithelial Cells. J. Cell. Biochem. 2015, 117, 1543–1555. [Google Scholar] [CrossRef]
- Liu, Q.; Lei, L.; Yu, T.; Jiang, T.; Kang, Y. Effect of Brain-Derived Neurotrophic Factor on the Neurogenesis and Osteogenesis in Bone Engineering. Tissue Eng. Part A 2018, 24, 1283–1292. [Google Scholar] [CrossRef]
- Naegelin, Y.; Dingsdale, H.; Säuberli, K.; Schädelin, S.; Kappos, L.; Barde, Y.-A. Measuring and Validating the Levels of Brain-Derived Neurotrophic Factor in Human Serum. eNeuro 2018, 5. [Google Scholar] [CrossRef] [Green Version]
- Tian, B.; Yang, C.; Wang, J.; Hou, X.; Zhao, S.; Li, Y.; Yang, P. Peripheral blood brain-derived neurotrophic factor level and tyrosine kinase B expression on T lymphocytes in systemic lupus erythematosus: Implications for systemic involvement. Cytokine 2019, 123, 154764. [Google Scholar] [CrossRef]
- Hou, Y.; Liang, W.; Zhang, J.; Li, Q.; Ou, H.; Wang, Z.; Li, S.; Huang, X.; Zhao, C. Schizophrenia-associated rs4702 G allele-specific downregulation of FURIN expression by miR-338-3p reduces BDNF production. Schizophr. Res. 2018, 199, 176–180. [Google Scholar] [CrossRef]
- Muller, M.; Vehlow, D.; Torger, B.; Urban, B.; Woltmann, B.; Hempel, U. Adhesive Drug Delivery Systems Based on Polyelectrolyte Complex Nanoparticles (PEC NP) for Bone Healing. Curr. Pharm. Des. 2018, 24, 1341–1348. [Google Scholar] [CrossRef] [PubMed]
- Müller, M.; Woltmann, B.; Torger, B.; Hempel, U. Interaction between immobilized polyelectrolyte complex nanoparticles and human mesenchymal stromal cells. Int. J. Nanomed. 2014, 9, 2205–2215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- York, S.L.; Sethu, P.; Saunders, M.M. Impact of Gap Junctional Intercellular Communication on MLO-Y4 Sclerostin and Soluble Factor Expression. Ann. Biomed. Eng. 2015, 44, 1170–1180. [Google Scholar] [CrossRef] [PubMed]
- Yu, C.; Huang, D.; Wang, K.; Lin, B.; Liu, Y.; Liu, S.; Wu, W.; Zhang, H. Advanced oxidation protein products induce apoptosis, and upregulate sclerostin and RANKL expression, in osteocytic MLO-Y4 cells via JNK/p38 MAPK activation. Mol. Med. Rep. 2016, 15, 543–550. [Google Scholar] [CrossRef] [Green Version]
- Papanicolaou, S.E.; Phipps, R.J.; Fyhrie, D.P.; Genetos, D.C. Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology 2009, 46, 389–399. [Google Scholar] [CrossRef]
- Nachlinger, R.J.; Kauschke, V.; Trinkaus, K.; El Khassawna, T.; Heiss, C.; Lips, K.S. Application of donepezil increased collagen 1 expression in mesenchymal stroma cells of an ovine osteoporosis model. J. Musculoskelet. Neuronal Interact. 2018, 18, 354–365. [Google Scholar]
Sample Availability: Samples of the compounds poly (l)-lysine and cellulose sulfate (CS-0.5, CS-3.0) for PECNP used in this report are available from the authors. |
Primer | Sequence | Length [bp] | Accession No. |
---|---|---|---|
BDNF | for GACGACATCACTGGCTGACAC | 100 | NM_007540.4 |
rev GTCCGCGTCCTTATGGTTTTC | |||
OPG | for ACTTCATCGAAAGCACCCTGT | 181 | NM_008764 |
rev TGGTAGGAACAGCAAACCTGA | |||
p75NTR | for TGTGCGAGGACACTGAGC | 98 | NM_033217 |
rev GGGCGTAGACCTTGTGATCC | |||
RANKL | for TCCTGTACTTTCGAGCGCAG | 136 | NM_011613 |
rev TCAGGTAGTGTGTCTTCACTCTC | |||
SOST | for GCCTCCTCCTGAGAACAACC | 143 | NM_024449.6 |
rev GGCCTGGGCCGTCTGTC | |||
TrkB | for ATCTCCGCTCACTTCATGGG | 99 | NM_001025074.1 |
rev AATGTCAGTTGGCGTGGTC | |||
βActin | for TGTTACCAACTGGGACGACA | 165 | NM_0073933.3 |
rev GGGGTGTTGAAGGTCTCAAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Loy, T.L.; Vehlow, D.; Kauschke, V.; Müller, M.; Heiss, C.; Lips, K.S. Effects of BDNF and PEC Nanoparticles on Osteocytes. Molecules 2020, 25, 4151. https://doi.org/10.3390/molecules25184151
Loy TL, Vehlow D, Kauschke V, Müller M, Heiss C, Lips KS. Effects of BDNF and PEC Nanoparticles on Osteocytes. Molecules. 2020; 25(18):4151. https://doi.org/10.3390/molecules25184151
Chicago/Turabian StyleLoy, Thomas Leonhard, David Vehlow, Vivien Kauschke, Martin Müller, Christian Heiss, and Katrin Susanne Lips. 2020. "Effects of BDNF and PEC Nanoparticles on Osteocytes" Molecules 25, no. 18: 4151. https://doi.org/10.3390/molecules25184151
APA StyleLoy, T. L., Vehlow, D., Kauschke, V., Müller, M., Heiss, C., & Lips, K. S. (2020). Effects of BDNF and PEC Nanoparticles on Osteocytes. Molecules, 25(18), 4151. https://doi.org/10.3390/molecules25184151