Inhibitory Influence of Panax notoginseng Saponins on Aspirin Hydrolysis in Human Intestinal Caco-2 Cells
Abstract
:1. Introduction
2. Results
2.1. Cytotoxicology of Drugs in the Caco-2 Cell Line
2.2. Transport of Aspirin across Monolayers after PNS Addition
2.3. Aspirin Hydrolysis after PNS Addition
2.4. Inhibitory Potential of PNS on hCE1 and hCE2
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. Cytotoxicology of Drugs in the Caco-2 Cell Line
4.4. Transport of Aspirin across Monolayers after PNS Addition
4.5. Aspirin Hydrolysis after PNS Addition
4.6. ELISA Analysis for hCE1 and hCE2
4.7. qRT-PCR for hCE1 and hCE2
- hCE1-F, AGAGGAGCTCTTGGAGACGACAT;
- hCE1-R, ACTCCTGCTTGTTAATTCCGACC;
- hCE2-F, CCATGGTGATGAGCTTCCTTTTGT;
- hCE2-R, AGGTATTGCTCCTCCTGGTCGAA;
- GAPDH-F, CTCCTCCACCTTTGACGCTG;
- GAPDH-R, TCCTCTTGTGCTCTTGCTGG.
4.8. HPLC Analysis
4.9. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Debotton, N.; Dahan, A. Applications of polymers as pharmaceutical excipients in solid oral dosage forms. Med. Res. Rev. 2017, 37, 52–97. [Google Scholar] [CrossRef] [PubMed]
- Poolea, S.K.; Poole, C.F. Separation methods for estimating octanol-water partition coefficients. J. Chromatogr. B 2003, 797, 3–19. [Google Scholar] [CrossRef]
- Ohura, K.; Nishiyama, H.; Saco, S.; Kurokawa, K.; Imai, T. Establishment and characterization of a novel Caco-2 subclone with a similar low expression level of human carboxylesterase 1 to human small intestine. Drug Metab. Dispos. 2016, 44, 1890–1898. [Google Scholar] [CrossRef] [PubMed]
- Imai, T.; Imoto, M.; Sakamoto, H.; Hashimoto, M. Identification of esterases expressed in Caco-2 cells and effects of their hydrolyzing activity in predicting human intestinal absorption. Drug Metab. Dispos. 2005, 33, 1185–1190. [Google Scholar] [CrossRef] [PubMed]
- Silva, R.M.D.; Sheela, V.S.; Gaitani, C.M.D.; Oliveira, A.R.M.D.; Bueno, P.C.P.; Cavalheiro, A.J.; Lopes, N.P.; Veronika, B.V. Evaluation of the intestinal absorption mechanism of casearin X in Caco-2 cells with modified carboxylesterase activity. J. Nat. Prod. 2016, 79, 1084–1090. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Zeng, S. Transport characteristics of zolmitriptan in a human intestinal epithelial cell line Caco-2. J. Pharm. Pharmacol. 2007, 59, 655–660. [Google Scholar] [CrossRef] [PubMed]
- Yee, S. In vitro permeability across Caco-2 cells (colonic) can predict in vivo (small intestinal) absorption in man-fact or myth. Pharm. Res. 1997, 14, 763–766. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.; Yang, X.; Yang, X.; Wang, K. Studies of intestinal permeability of 36 flavonoids using Caco-2 cell monolayer model. Int. J. Pharmaceut. 2009, 367, 58–64. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Li, W.; Chen, C.Z.; Yi, Z.H.; Zhou, Y.Y. Is aspirin use associated with age-related macular degeneration? A meta analysis. J. Clin. Pharm. Ther. 2015, 40, 144–154. [Google Scholar] [CrossRef] [PubMed]
- Halvorsen, S.; Andreotti, F.; Berg, G.; Cattaneo, M.; Coccheri, S.; Marchioli, R.; Morais, J.; Verheugt, F.; Caterina, R. Aspirin therapy in primary cardiovascular disease prevention: A position paper of the European society of cardiology working group on thrombosis. J. Am. Coll. Cardiol. 2014, 64, 319–327. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.F.; Yang, J.; Du, F.J.; Gao, X.M.; Ma, X.T.; Huang, Y.H.; Xu, F.; Niu, W.; Wang, F.Q.; Mao, Y.; et al. Absorption and disposition of ginsenosides after oral administration of Panax notoginseng extract to rats. Drug Metab. Dispos. 2009, 37, 2290–2298. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.Y.; Huang, P.; Yu, Z.S.; Xing, D.H.; Ouyang, S.; Xing, G.Q. Efficacy and safety of Panax notoginseng saponin therapy for acute intracerebral hemorrhage, meta-analysis, and mini review of potential mechanisms of action. Front. Neurol. 2015, 5, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Izzo, A.A.; Hoon-Kim, S.; Radhakrishnan, R.; Williamson, E.M. A critical approach to evaluating clinical efficacy, adverse events and drug interactions of herbal remedies. Phytother. Res. 2016, 30, 691–700. [Google Scholar] [CrossRef] [PubMed]
- Stéphane, M.; loret-Linares, C.; Damien, S.; Bergmann, F.G. Is the clinical relevance of drug-food and drug-herb interactions limited to grape fruit juice and Saint-John’s wort? Pharmacol. Res. 2017, 118, 82–92. [Google Scholar]
- Gupta, R.C.; Chang, D.; Nammi, S.; Bensoussan, A.; Bilinski, K.; Roufogalis, B.D. Interactions between antidiabetic drugs and herbs: An overview of mechanisms of action and clinical implications. Diabetol. Metab. Syndr. 2017, 9, 59. [Google Scholar] [CrossRef] [PubMed]
- Izzo, A.A.; Ernst, E. Interactions between herbal medicines and prescribed drugs. Drugs 2009, 69, 1777–1798. [Google Scholar] [CrossRef] [PubMed]
- Mills, E.; Montori, V.M.; Wu, P.; Gallicano, K.; Clarke, M.; Guyatt, G. Interaction of St John’s wort with conventional drugs: Systematic review of clinical trials. Br. Med. J. 2004, 329, 27–30. [Google Scholar] [CrossRef] [PubMed]
- Meng, Q.; Liu, K. Pharmacokinetic interactions between herbal medicines and prescribed drugs: Focus on drug metabolic enzymes and transporters. Curr. Drug Metab. 2014, 15, 791–807. [Google Scholar] [CrossRef] [PubMed]
- Rowland, M.; Riegelman, S.; Harris, P.A.; Sholkoff, S.D. Absorption kinetics of aspirin in man following oral administration of an aqueous solution. J. Pharm. Sci. 1972, 61, 379–385. [Google Scholar] [CrossRef] [PubMed]
- Williams, F.M.; Mutch, E.M.; Nicholson, E.; Wynne, H.; Wright, P.; Lambert, D.; Rawlins, M.D. Human liver and plasma aspirin esterase. J. Pharm. Pharmacol. 1989, 41, 407–409. [Google Scholar] [CrossRef] [PubMed]
- Inoue, M.; Morikawa, M.; Tsuboi, M.; Ito, Y.; Sugiura, M. Comparative study of human intestinal and hepatic esterases as related to enzymatic properties and hydrolizing activity for ester-type drugs. Jpn. J. Pharmacol. 1980, 30, 529–535. [Google Scholar] [CrossRef] [PubMed]
- Tang, M.; Mukundan, M.; Yang, J.; Charpentier, N.; LeCluyse, E.L.; Black, C.; Yang, D.; Shi, D.; Yan, B. Antiplatelet agents aspirin and clopidogrel are hydrolyzed by distinct carboxylesterases, and clopidogrel is transesterificated in the presence of ethyl alcohol. J. Pharmacol. Exp. Ther. 2006, 319, 1467–1476. [Google Scholar] [CrossRef] [PubMed]
- Tian, Z.H.; Pang, H.H.; Du, S.Y.; Lu, Y.; Zhang, L.; Wu, H.C.; Guo, S.; Wang, M.; Zhang, Q. Effect of Panax notoginseng saponins on the pharmacokinetics of aspirin in rats. J. Chromatogr. B. 2017, 1040, 136–143. [Google Scholar] [CrossRef] [PubMed]
- Roger, E.; Lagarce, F.; Garcion, E.; Benoit, J.P. Biopharmaceutical parameters to consider in order to alter the fate of nanocarriers after oral delivery. Nanomedicine 2010, 5, 287–306. [Google Scholar] [CrossRef] [PubMed]
- Hubatsch, I.; Ragnarsson, E.G.E.; Artursson, P. Determination of drug permeability and prediction of drug absorption in Caco-2 monolayers. Nat. Protoc. 2007, 2, 2111–2119. [Google Scholar] [CrossRef] [PubMed]
- Kamiloglu, S.; Capanoglu, E.; Grootaert, C.; Camp, J.V. Anthocyanin absorption and metabolism by human intestinal Caco-2 cells–A review. Int. J. Mol. Sci. 2015, 16, 21555–21574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Okudaira, N.; Tatebayashi, T.; Speirs, G.C.; Komiya, I.; Sugiyama, Y. A study of the intestinal absorption of an ester-type prodrug, ME3229, in rats: Active efflux transport as a cause of poor bioavailability of the active drug. J. Pharmacol. Exp. Ther. 2000, 294, 580–587. [Google Scholar] [PubMed]
- Ruiz-Balaguer, N.; Nacher, A.; Casabo, V.G.; Sanjuan, M.M. Intestinal transport of cefuroxime axetil in rats: Absorption and hydrolysis processes. Int. J. Pharm. 2002, 234, 101–111. [Google Scholar] [CrossRef]
- Yuan, H.; Chen, C.Y.; Chai, G.h.; Du, Y.Z.; Hu, F.Q. Improved transport and absorption through gastrointestinal tract by PEGylated solid lipid nanoparticles. Mol. Pharm. 2013, 10, 1865–1873. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Guo, L.; Zhao, C.; Wu, X.; Wang, R.; Liu, C. Characterization of the intestinal absorption of seven flavonoids from the flowers of trollius chinensis using the Caco-2 cell monolayer model. PLoS ONE 2015, 10, e0119263. [Google Scholar] [CrossRef] [PubMed]
- Zou, L.W.; Dou, T.Y.; Wang, P.; Lei, W.; Weng, Z.M.; Hou, J.; Wang, D.D.; Fan, Y.M.; Zhang, W.D.; Ge, G.B.; et al. Structure-activity relationships of pentacyclic triterpenoids as potent and selective inhibitors against human carboxylesterase 1. Front. Pharmacol. 2017, 8, 435. [Google Scholar] [CrossRef] [PubMed]
- Mai, Z.P.; Zhou, K.; Ge, G.B.; Wang, C.; Huo, X.K.; Dong, P.P.; Deng, S.; Zhang, B.J.; Zhang, H.L.; Huang, S.S.; et al. Protostane triterpenoids from the rhizome of alisma orientale exhibit inhibitory effects on human carboxylesterase 2. J. Nat. Prod. 2015, 78, 2372–2380. [Google Scholar] [CrossRef] [PubMed]
- Zou, L.W.; Li, Y.G.; Wang, P.; Zhou, K.; Hou, J.; Jin, Q.; Hao, D.C.; Ge, G.B.; Yang, L. Design, synthesis, and structure-activity relationship study of glycyrrhetinic acid derivatives as potent and selective inhibitors against human carboxylesterase 2. Eur. J. Med. Chem. 2016, 112, 280–288. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J. The Research of Drug-Drug Interactions Lead by the Inhibitory Effect of Ginsenoside Metabolites and Glabridin toward Carboxylesterases. Master’s Thesis, Liaoning Medical University, Jinzhou, China, June 2016. [Google Scholar]
- Imai, T.; Taketani, M.; Shii, M.; Hosokawa, M.; Chiba, K. Substrate specificity of carboxylesterase isozymes and their contribution to hydrolase activity in human liver and small intestine. Drug Metab. Dispos. 2006, 34, 1734–1741. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Du, S.Y.; Lu, Y.; Liu, C.; Tian, Z.H.; Yang, C.; Wu, H.C.; Wang, Z. Puerarin transport across a Calu-3 cell monolayer-an in vitro model of nasal mucosa permeability and the influence of paeoniflorin and menthol. Drug Des. Dev. Ther. 2016, 10, 2227–2237. [Google Scholar] [CrossRef] [PubMed]
- Ohura, K.; Nozawa, T.; Murakami, K.; Imai, T. Evaluation of transport mechanism of prodrugs and parent drugs formed by intracellular metabolism in Caco-2 cells with modified carboxylesterase activity: Temocapril as a model case. J. Pharm. Sci. 2011, 100, 3985–3994. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |
Condition | Papp (A→B) ± SD (× 10−6 cm/s) | Papp (B→A) ± SD (× 10−6 cm/s) | Efflux Ratio (B→A)/(A→B) |
---|---|---|---|
50 μg/mL | 0.98 ± 0.07 | 1.10 ± 0.08 | 1.12 |
100 μg/mL | 0.98 ± 0.01 | 1.08 ± 0.09 | 1.10 |
150 μg/mL | 0.96 ± 0.05 | 1.02 ± 0.08 | 1.06 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Z.; Wu, Y.; Yang, B.; Zhu, B.; Hu, S.; Lu, Y.; Zhao, B.; Du, S. Inhibitory Influence of Panax notoginseng Saponins on Aspirin Hydrolysis in Human Intestinal Caco-2 Cells. Molecules 2018, 23, 455. https://doi.org/10.3390/molecules23020455
Sun Z, Wu Y, Yang B, Zhu B, Hu S, Lu Y, Zhao B, Du S. Inhibitory Influence of Panax notoginseng Saponins on Aspirin Hydrolysis in Human Intestinal Caco-2 Cells. Molecules. 2018; 23(2):455. https://doi.org/10.3390/molecules23020455
Chicago/Turabian StyleSun, Zongxi, Yali Wu, Bing Yang, Baochen Zhu, Shaonan Hu, Yang Lu, Bo Zhao, and Shouying Du. 2018. "Inhibitory Influence of Panax notoginseng Saponins on Aspirin Hydrolysis in Human Intestinal Caco-2 Cells" Molecules 23, no. 2: 455. https://doi.org/10.3390/molecules23020455