6,849 Results Found

Brucella abortus is a zoonotic pathogen that causes brucellosis. Because of Brucella’s unique LPS layer and intracellular localization predominately within macrophages, it can often evade immune detection. However, pattern recognition receptors...

In this study we revealed the diversity of active ureolytic bacteria in the rumen by compared ureC amplicons between gDNA and cDNA. Rumen fluid was collected from four Holstein dairy cows with rumen fistulas at 0, 2, and 6 h after morning feeding. To...

Next-generation sequencing (NGS) is a revolutionary advancement allowing large-scale discovery of functional molecular markers that has many applications, including plant breeding. High-quality genomic DNA (gDNA) is a prerequisite for successful NGS...

The presence of contaminating gDNA in RNA preparations is a frequent cause of false positives in RT-PCR-based analysis. However, in some cases, this cannot be avoided, especially when there are no exons–intron junctions in the lncRNA sequences. Due t...

Parvovirus B19 (B19V) is pathogenic to humans and causes various human diseases. However, no antiviral agents or vaccines currently exist for the treatment or prevention of B19V infection. Therefore, developing sensitive and specific methods for B19V...

A cursory look at any textbook image of DNA replication might suggest that the complex machine that is the replisome runs smoothly along the chromosomal DNA. However, many DNA sequences can adopt non-B form secondary structures and these have the pot...

Genetic information, irrespective of cell type (normal or cancerous), is exposed to a range of harmful factors, which can lead to more than 80 different types of DNA damage. Of these, ^oxoG and ^FapyG have been identified as the most abundant in normox...

DNA G-quadruplexes (G4s) are known to be an integral part of the complex regulatory systems in both normal and pathological cells. At the same time, the ability of G4s to impede DNA replication plays a critical role in genome integrity. This review s...

APOBEC3G (A3G) restricts HIV-1 replication primarily by reducing viral cDNA and inducing G-to-A hypermutations in viral cDNA. HIV-1 encodes virion infectivity factor (Vif) to counteract A3G primarily by excluding A3G viral encapsidation. Even though...

Mature B cells notably diversify immunoglobulin (Ig) production through class switch recombination (CSR), allowing the junction of distant “switch” (S) regions. CSR is initiated by activation-induced deaminase (AID), which targets cytosin...

G-quadruplexes (G4s), the most widely studied alternative DNA structures, are implicated in the regulation of the key cellular processes. In recent years, their involvement in DNA repair machinery has become the subject of intense research. Here, we...

Lumican is an extracellular matrix proteoglycan known to regulate toll-like receptor (TLR) signaling in innate immune cells. In experimental settings, lumican suppresses TLR9 signaling by binding to and sequestering its synthetic ligand, CpG-DNA, in...

Nucleic acid amplification methods are widely used in science, medicine and forensics for molecular biological assays and for the detection of genetic material. The newly developed strand displacement chain reaction (SDCR) method is a hybrid amplific...

Tetrahelical DNA structures, such as G-quadruplexes (G4s) or i-motifs (iMs), are adopted by sequences comprising several G/C tracts, exist in equilibria with respective duplexes, and may contribute to genomic instability upon helicase deficiency. To...

DNA mismatch repair (MMR) plays a crucial role in the maintenance of genomic stability. The main MMR protein, MutS, was recently shown to recognize the G-quadruplex (G4) DNA structures, which, along with regulatory functions, have a negative impact o...

In mammals, de novo methylation of cytosines in DNA CpG sites is performed by DNA methyltransferase Dnmt3a. Changes in the methylation status of CpG islands are critical for gene regulation and for the progression of some cancers. Recently, the poten...

The stabilization of G-Quadruplex DNA structures by ligands is a promising strategy for telomerase inhibition in cancer therapy since this enzyme is responsible for the unlimited proliferation of cancer cells. To assess the potential of a compound as...

Alzheimer’s disease (AD) is a leading form of dementia, marked by complex neuropathological features such as amyloid-β (Aβ) plaques and tau tangles. Recent research highlights the significant role of unmethylated cytosine–phosph...

The integration of the HIV-1 genome into the host genome is an essential step in the life cycle of the virus and it plays a critical role in the expression, long-term persistence, and reactivation of HIV expression. To better understand the local gen...

G-quadruplexes are four-stranded guanine-rich structures that have been demonstrated to occur across the genome in humans and other organisms. They provide regulatory functions during transcription, translation and immunoglobulin gene rearrangement,...

The FANCJ helicase unfolds G-quadruplexes (G4s) in human cells to support DNA replication. This action is coupled to the recruitment of REV1 polymerase to synthesize DNA across from a guanine template. The precise mechanisms of these reactions remain...

Pressure is a thermodynamic parameter that can induce structural changes in biomolecules due to a volumetric decrease. Although most proteins are denatured by pressure over 100 MPa because they have the large cavities inside their structures, the dou...

APOBEC3G is the best known of several DNA cytosine deaminases that function to inhibit the replication of parasitic genetic elements including the lentivirus HIV. Several high-resolution structures of the APOBEC3G catalytic domain have been generated...

The bacterial primase—an essential component in the replisome—is a promising but underexploited target for novel antibiotic drugs. Bacterial primases have a markedly different structure than the human primase. Inhibition of primase activi...

It is well known that certain non B-DNA structures, including G-quadruplexes, are key elements that can regulate gene expression. Here, we explore the theory that DNA modifications, such as methylation of cytosine, could act as a dynamic switch by pr...

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-brom...

Curaxins and especially the second-generation derivative curaxin CBL0137 have important antitumor activities in multiple cancers such as glioblastoma, melanoma and others. Although most of the authors suggest that their mechanism of action comes from...

We recently selected DNA aptamers that bind to camptothecin (CPT) and CPT derivatives from a 70-mer oligodeoxyribonucleotide (ODN) library using the Systematic Evolution of Ligands by EXponential enrichment (SELEX) method. The target-binding activity...

CpG-DNA activates the host immune system to resist bacterial infections. In this study, we examined the protective effect of CpG-DNA in mice against Escherichia coli (E. coli) K1 infection. Administration of CpG-DNA increased the survival of mice aft...

G protein-coupled receptors (GPCRs) and their associated proteins represent one of the most diverse cellular signaling systems involved in both physiological and pathophysiological processes. Aging represents perhaps the most complex biological proce...

The information about mtDNA methylation is still limited, thus epigenetic modification remains unclear. The lack of comprehensive information on the comparative epigenomics of mtDNA prompts comprehensive investigations of the epigenomic modification...

DNA G-quadruplexes (G4s) are non-canonical four-stranded DNA structures involved in various biological processes in eukaryotes. Molecularly crowded solutions and monovalent cations have been reported to stabilize in vitro and in vivo G4 formation. Ho...

A cyclic naphthalene diimide (cyclic NDI, 1), carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, o...

Metal ions are used in various situations in living organisms and as a part of functional materials. Since the excessive intake of metal ions can cause health hazards and environmental pollution, the development of new molecules that can monitor meta...

Endosomal toll-like receptor-21 and -9 sense CpG DNA activating production of pro-inflammatory mediators with antimicrobial effects. Here, we investigated the induction of antiviral response of in ovo delivered CpG DNA against infectious laryngotrach...

Antinuclear antibodies, especially anti-DNA antibodies, are known to be a hallmark of systemic lupus erythematosus (SLE) and represent a diverse pool of autoantibodies with different origins, antigenic properties, and physicochemical features. Antibo...

The importance of gene expression regulation in viruses based upon G-quadruplex may point to its potential utilization in therapeutic targeting. Here, we present analyses as to the occurrence of putative G-quadruplex-forming sequences (PQS) in all re...

Reverse gyrase is a topoisomerase that can introduce positive supercoils to its substrate DNA. It is demonstrated in our studies that a highly thermal stable G-quadruplex structure in a mini-plasmid DNA was transformed into its duplex conformation af...

Recent advances have revealed the importance of epigenetic modifications to gene regulation and transcriptional activity. DNA methylation, a determinant of genetic imprinting and the de novo silencing of genes genome-wide, is known to be controlled b...

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,&epsilon...

The combination of mosaic Gag and CAP256 envelope in an HIV vaccine regimen comprising DNA prime and modified vaccinia Ankara (MVA) boost followed by protein boost has previously been shown to generate robust autologous Tier 2 neutralizing antibodies...

Gene V protein (gVp) of the bacteriophages of the Ff family is a non-specific single-stranded DNA (ssDNA) binding protein. gVp binds to viral DNA during phage replication inside host Escherichia coli cells, thereby blocking further replication and si...

In the mammalian genome, cytosine methylation predominantly occurs at CpG sites. In addition, a number of recent studies have uncovered extensive C5 cytosine methylation (5mC) at non-CpG (5mCpH, where H = A/C/T) sites. Little is known about the enzym...

Topoisomerase 1 (Top1) removes transcription-related helical torsions and thus plays an important role in preventing genome instability instigated by the formation of non-canonical DNA secondary structures. The genetically tractable Saccharomyces cer...

A series of arene Ru(II) complexes, [(η⁶-MeC₆H₅)Ru(L)Cl]Cl, (L=o-ClPIP, 1; m-ClPIP, 2 and p-ClPIP, 3) (o-ClPIP=2-(2-chlorophenyl)imidazo[4,5-f][1,10]phenanthroline; m-ClPIP=2-(3-chlorophenyl)imidazo[4,5-f][1,10]phenanthroline; p-ClPIP=2-(4-chloro...

Herein, two novel ruthenium(II) complexes coupled by erianin via a flexible carbon chain, [Ru(phen)₂(L₁-(CH₂)₄-erianin)](ClO₄)₂ (L₁ = 2-(2-(tri-fluoromethyphenyl))-imidazo [4,5f][1–10]phenanthroline (1) and [Ru(phen)₂(L₂-(CH₂)₄-eria)](ClO₄)₂ (L...

Guanine-rich sequences of nucleic acids, including DNA and RNA, are known to fold into non-canonical structures named G-quadruplexes (G4s). Such arrangements of these macromolecular polymers are mainly located in telomeres and in promoter regions of...

APOBEC3 enzymes are polynucleotide deaminases, converting cytosine to uracil on single-stranded DNA (ssDNA) and RNA as part of the innate immune response against viruses and retrotransposons. APOBEC3G is a two-domain protein that restricts HIV. Altho...

Most Cyclin-dependent kinases (Cdks) are redundant for normal cell division. Here we tested whether these redundancies are maintained during cell cycle recovery after a DNA damage-induced arrest in G1. Using non-transformed RPE-1 cells, we find that...

Vincristine is a classical chemotherapeutic agent widely used for its ability to disrupt microtubule polymerization, yet additional molecular effects may contribute to its anticancer activity. G-quadruplexes (G4s), non-canonical nucleic acid structur...