Vitamin D Status Modulates Inflammatory Response in HIV+ Subjects: Evidence for Involvement of Autophagy and TG2 Expression in PBMC
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Patient Recruitment
4.2. Determination of 25(OH)D3 Plasma Levels
4.3. PBMC Collection
4.4. Quantitative Studies of Gene Expression
4.5. Power and Sample Size Calculation
4.6. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mueller, N.J.; Fux, C.A.; Ledergerber, B.; Elzi, L.; Schmid, P.; Dang, T.; Magenta, L.; Calmy, A.; Vergopoulos, A.; Bischoff-Ferrari, H.A.; et al. High prevalence of severe vitamin D deficiency in combined antiretroviral therapy-naive and successfully treated Swiss HIV patients. AIDS 2010, 24, 1127–1134. [Google Scholar] [CrossRef] [PubMed]
- Vescini, F.; Cozzi-Lepri, A.; Borderi, M.; Re, M.C.; Maggiolo, F.; De Luca, A.; Cassola, G.; Vullo, V.; Carosi, G.; Antinori, A.; et al. Prevalence of hypovitaminosis D and factors associated with vitamin D deficiency and morbidity among HIV-infected patients enrolled in a large Italian cohort. J. Acquir. Immune Defic. Syndr. 2011, 58, 163–172. [Google Scholar] [CrossRef] [PubMed]
- Dao, C.N.; Patel, P.; Overton, E.T.; Rhame, F.; Pals, S.L.; Johnson, C.; Bush, T.; Brooks, J.T. Study to Understand the Natural History of, H.I.V.; Investigators, A.i.t.E.o.E.T. Low vitamin D among HIV-infected adults: Prevalence of and risk factors for low vitamin D Levels in a cohort of HIV-infected adults and comparison to prevalence among adults in the US general population. Clin. Infect. Dis. 2011, 52, 396–405. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, T.T.; McComsey, G.A. Association between initiation of antiretroviral therapy with efavirenz and decreases in 25-hydroxyvitamin D. Antivir. Ther. 2010, 15, 425–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boura, M.; Sutre, A.F.; Badura, R.; Zagalo, A.; Afonso, C.; Caldeira, L.; Valadas, E. Hypovitaminosis D in HIV-infected patients in Lisbon: A link with antiretroviral treatment. J. Int. AIDS Soc. 2014, 17, 19826. [Google Scholar] [CrossRef] [PubMed]
- Conesa-Botella, A.; Florence, E.; Lynen, L.; Colebunders, R.; Menten, J.; Moreno-Reyes, R. Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen. AIDS Res. Ther. 2010, 7, 40. [Google Scholar] [CrossRef] [PubMed]
- Taiwo, B.O.; Chan, E.S.; Fichtenbaum, C.J.; Ribaudo, H.; Tsibris, A.; Klingman, K.L.; Eron, J.J.; Berzins, B.; Robertson, K.; Landay, A.; et al. Less Bone Loss With Maraviroc- Versus Tenofovir-Containing Antiretroviral Therapy in the AIDS Clinical Trials Group A5303 Study. Clin. Infect. Dis. 2015, 61, 1179–1188. [Google Scholar] [CrossRef] [Green Version]
- McComsey, G.A.; Kitch, D.; Daar, E.S.; Tierney, C.; Jahed, N.C.; Tebas, P.; Myers, L.; Melbourne, K.; Ha, B.; Sax, P.E. Bone mineral density and fractures in antiretroviral-naive persons randomized to receive abacavir-lamivudine or tenofovir disoproxil fumarate-emtricitabine along with efavirenz or atazanavir-ritonavir: Aids Clinical Trials Group A5224s, a substudy of ACTG A5202. J. Infect. Dis. 2011, 203, 1791–1801. [Google Scholar] [CrossRef]
- Cozzolino, M.; Vidal, M.; Arcidiacono, M.V.; Tebas, P.; Yarasheski, K.E.; Dusso, A.S. HIV-protease inhibitors impair vitamin D bioactivation to 1,25-dihydroxyvitamin D. AIDS 2003, 17, 513–520. [Google Scholar] [CrossRef]
- Legeai, C.; Vigouroux, C.; Souberbielle, J.C.; Bouchaud, O.; Boufassa, F.; Bastard, J.P.; Carlier, R.; Capeau, J.; Goujard, C.; Meyer, L.; et al. Associations between 25-hydroxyvitamin D and immunologic, metabolic, inflammatory markers in treatment-naive HIV-infected persons: The ANRS CO9 ≪COPANA≫ cohort study. PLoS ONE 2013, 8, e74868. [Google Scholar] [CrossRef] [Green Version]
- Poudel-Tandukar, K.; Poudel, K.C.; Jimba, M.; Kobayashi, J.; Johnson, C.A.; Palmer, P.H. Serum 25-hydroxyvitamin d levels and C-reactive protein in persons with human immunodeficiency virus infection. AIDS Res. Hum. Retrovir. 2013, 29, 528–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Viard, J.P.; Souberbielle, J.C.; Kirk, O.; Reekie, J.; Knysz, B.; Losso, M.; Gatell, J.; Pedersen, C.; Bogner, J.R.; Lundgren, J.D.; et al. Vitamin D and clinical disease progression in HIV infection: Results from the EuroSIDA study. AIDS 2011, 25, 1305–1315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aranow, C. Vitamin D and the immune system. J. Investig. Med. 2011, 59, 881–886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holick, M.F. Vitamin D: Extraskeletal health. Rheum. Dis. Clin. North. Am. 2012, 38, 141–160. [Google Scholar] [CrossRef] [PubMed]
- Bishop, E.; Ismailova, A.; Dimeloe, S.K.; Hewison, M.; White, J.H. Vitamin D and immune regulation: Antibacterial, antiviral, anti-inflammatory. JBMR Plus 2020. [Google Scholar] [CrossRef]
- Aliyannissa, A.; Kuswiyanto, R.B.; Setiabudi, D.; Nataprawira, H.M.; Alam, A.; Sekarwana, N. Correlation between CD4 count and glomerular filtration rate or urine protein:Creatinine ratio in human immunodeficiency virus-infected children. Kidney Res. Clin. Pract. 2020, 39, 40–46. [Google Scholar] [CrossRef] [Green Version]
- Visalli, G.; Paiardini, M.; Chirico, C.; Cervasi, B.; Curro, M.; Ferlazzo, N.; Bertuccio, M.P.; Favaloro, A.; Pellicano, G.; Sturniolo, G.; et al. Intracellular accumulation of cell cycle regulatory proteins and nucleolin re-localization are associated with pre-lethal ultrastructural lesions in circulating T lymphocytes: The HIV-induced cell cycle dysregulation revisited. Cell Cycle 2010, 9, 2130–2140. [Google Scholar] [CrossRef]
- Espert, L.; Biard-Piechaczyk, M. Autophagy in HIV-induced T cell death. Curr. Top. Microbiol. Immunol. 2009, 335, 307–321. [Google Scholar] [CrossRef]
- Espert, L.; Denizot, M.; Grimaldi, M.; Robert-Hebmann, V.; Gay, B.; Varbanov, M.; Codogno, P.; Biard-Piechaczyk, M. Autophagy is involved in T cell death after binding of HIV-1 envelope proteins to CXCR4. J. Clin. Investig. 2006, 116, 2161–2172. [Google Scholar] [CrossRef]
- Nardacci, R.; Ciccosanti, F.; Marsella, C.; Ippolito, G.; Piacentini, M.; Fimia, G.M. Role of autophagy in HIV infection and pathogenesis. J. Intern. Med. 2017, 281, 422–432. [Google Scholar] [CrossRef]
- Sassi, F.; Tamone, C.; D’Amelio, P. Vitamin D: Nutrient, Hormone, and Immunomodulator. Nutrients 2018, 10, 1656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campbell, G.R.; Spector, S.A. Autophagy induction by vitamin D inhibits both Mycobacterium tuberculosis and human immunodeficiency virus type 1. Autophagy 2012, 8, 1523–1525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chrobok, N.L.; Sestito, C.; Wilhelmus, M.M.; Drukarch, B.; van Dam, A.M. Is monocyte- and macrophage-derived tissue transglutaminase involved in inflammatory processes? Amino Acids 2017, 49, 441–452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caccamo, D.; Ferlazzo, N.; Curro, M.; Ricca, S.; Ientile, R. Transglutaminase 2 Up-Regulation Is Associated with Inflammatory Response in PBMC from Healthy Subjects with Hypovitaminosis D. Med. Sci. 2018, 6, 103. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.; Kaartinen, M.T. Transglutaminase activity regulates differentiation, migration and fusion of osteoclasts via affecting actin dynamics. J. Cell Physiol. 2018, 233, 7497–7513. [Google Scholar] [CrossRef]
- Paolella, G.; Nanayakkara, M.; Sposito, S.; Lepretti, M.; Auricchio, S.; Esposito, C.; Barone, M.V.; Martucciello, S.; Caputo, I. Constitutive Differential Features of Type 2 Transglutaminase in Cells Derived from Celiac Patients and from Healthy Subjects. Int. J. Mol. Sci. 2020, 21, 1231. [Google Scholar] [CrossRef] [Green Version]
- Amendola, A.; Fesus, L.; Piacentini, M.; Szondy, Z. "Tissue" transglutaminase in AIDS. J. Immunol. Methods 2002, 265, 145–159. [Google Scholar] [CrossRef]
- Curro’, M.; Ferlazzo, N.; Costanzo, M.G.; Caccamo, D.; Lentile, R. Vitamin D status influences transcriptional levels of RANKL and inflammatory biomarkers which are associated with activation of PBMC. Clin. Chim. Acta 2020, 507, 219–223. [Google Scholar] [CrossRef]
- Mao, X.; Hu, B.; Zhou, Z.; Xing, X.; Wu, Y.; Gao, J.; He, Y.; Hu, Y.; Cheng, Q.; Gong, Q. Vitamin D levels correlate with lymphocyte subsets in elderly patients with age-related diseases. Sci. Rep. 2018, 8, 7708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holick, M.F.; Binkley, N.C.; Bischoff-Ferrari, H.A.; Gordon, C.M.; Hanley, D.A.; Heaney, R.P.; Murad, M.H.; Weaver, C.M.; Endocrine, S. Evaluation, treatment, and prevention of vitamin D deficiency: An Endocrine Society clinical practice guideline. J. Clin. Endocrinol. Metab. 2011, 96, 1911–1930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laplana, M.; Sanchez-de-la-Torre, M.; Puig, T.; Caruz, A.; Fibla, J. Vitamin-D pathway genes and HIV-1 disease progression in injection drug users. Gene 2014, 545, 163–169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Torres, C.; Sanchez de la Torre, M.; Garcia-Moruja, C.; Carrero, A.J.; Trujillo Mdel, M.; Fibla, J.; Caruz, A. Immunophenotype of vitamin D receptor polymorphism associated to risk of HIV-1 infection and rate of disease progression. Curr. HIV Res. 2010, 8, 487–492. [Google Scholar] [CrossRef] [PubMed]
- Orkin, C.; Wohl, D.A.; Williams, A.; Deckx, H. Vitamin D deficiency in HIV: A shadow on long-term management? AIDS Rev. 2014, 16, 59–74. [Google Scholar] [PubMed]
- Zicari, S.; Sessa, L.; Cotugno, N.; Ruggiero, A.; Morrocchi, E.; Concato, C.; Rocca, S.; Zangari, P.; Manno, E.C.; Palma, P. Immune Activation, Inflammation, and Non-AIDS Co-Morbidities in HIV-Infected Patients under Long-Term ART. Viruses 2019, 11, 200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abraham, A.G.; Zhang, L.; Calkins, K.; Tin, A.; Hoofnagle, A.; Palella, F.J., Jr.; Estrella, M.M.; Jacobson, L.P.; Witt, M.D.; Kingsley, L.A.; et al. Vitamin D status and immune function reconstitution in HIV-infected men initiating therapy. AIDS 2018, 32, 1069–1076. [Google Scholar] [CrossRef]
- Liu, N.Q.; Kaplan, A.T.; Lagishetty, V.; Ouyang, Y.B.; Ouyang, Y.; Simmons, C.F.; Equils, O.; Hewison, M. Vitamin D and the regulation of placental inflammation. J. Immunol. 2011, 186, 5968–5974. [Google Scholar] [CrossRef] [Green Version]
- Shahijanian, F.; Parnell, G.P.; McKay, F.C.; Gatt, P.N.; Shojoei, M.; O’Connor, K.S.; Schibeci, S.D.; Brilot, F.; Liddle, C.; Batten, M.; et al. The CYP27B1 variant associated with an increased risk of autoimmune disease is underexpressed in tolerizing dendritic cells. Hum. Mol. Genet. 2014, 23, 1425–1434. [Google Scholar] [CrossRef] [Green Version]
- Bikle, D.D.; Patzek, S.; Wang, Y. Physiologic and pathophysiologic roles of extra renal CYP27b1: Case report and review. Bone Rep. 2018, 8, 255–267. [Google Scholar] [CrossRef]
- Trovato, M.; Ruggeri, R.M.; Sciacchitano, S.; Vicchio, T.M.; Picerno, I.; Pellicano, G.; Valenti, A.; Visalli, G. Serum interleukin-6 levels are increased in HIV-infected patients that develop autoimmune disease during long-term follow-up. Immunobiology 2018, 223, 264–268. [Google Scholar] [CrossRef]
- Manion, M.; Hullsiek, K.H.; Wilson, E.M.P.; Rhame, F.; Kojic, E.; Gibson, D.; Hammer, J.; Patel, P.; Brooks, J.T.; Baker, J.V.; et al. Vitamin D deficiency is associated with IL-6 levels and monocyte activation in HIV-infected persons. PLoS ONE 2017, 12, e0175517. [Google Scholar] [CrossRef] [Green Version]
- Shepherd, L.; Souberbielle, J.C.; Bastard, J.P.; Fellahi, S.; Capeau, J.; Reekie, J.; Reiss, P.; Blaxhult, A.; Bickel, M.; Leen, C.; et al. Prognostic value of vitamin D level for all-cause mortality, and association with inflammatory markers, in HIV-infected persons. J. Infect. Dis. 2014, 210, 234–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deeks, S.G. HIV infection, inflammation, immunosenescence, and aging. Annu. Rev. Med. 2011, 62, 141–155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deeks, S.G.; Lewin, S.R.; Havlir, D.V. The end of AIDS: HIV infection as a chronic disease. Lancet 2013, 382, 1525–1533. [Google Scholar] [CrossRef] [Green Version]
- Wu, S.; Sun, J. Vitamin D, vitamin D receptor, and macroautophagy in inflammation and infection. Discov. Med. 2011, 11, 325–335. [Google Scholar]
- Wang, J.; Lian, H.; Zhao, Y.; Kauss, M.A.; Spindel, S. Vitamin D3 induces autophagy of human myeloid leukemia cells. J. Biol. Chem. 2008, 283, 25596–25605. [Google Scholar] [CrossRef] [Green Version]
- Coillard, A.; Segura, E. In vivo Differentiation of Human Monocytes. Front. Immunol. 2019, 10, 1907. [Google Scholar] [CrossRef]
- Thomas-Ecker, S.; Lindecke, A.; Hatzmann, W.; Kaltschmidt, C.; Zanker, K.S.; Dittmar, T. Alteration in the gene expression pattern of primary monocytes after adhesion to endothelial cells. Proc. Natl. Acad. Sci. USA 2007, 104, 5539–5544. [Google Scholar] [CrossRef] [Green Version]
Characteristic | Mean ± SEM |
---|---|
Age | 43.2 ± 1.8 |
Sex (female/male) | 23/34 |
Time since HIV diagnosis (months) | 93.1 ± 10.1 |
HIV viral load (copies/mL) | 41.3 ± 26.4 |
CYP27B1 Gene Expression | |||
---|---|---|---|
Variables | B | 95% C.I. | p-Value |
HIV infection | −0.301 | −0.4932; −0.110 | 0.002 |
Gender | 0.116 | −0.022; 0.254 | 0.098 |
Age | 0.001 | −0.007; 0.006 | 0.899 |
25(OH)D3 levels | 0.002 | 0.000; 0.005 | 0.072 |
Time since HIV diagnosis # | 0.001 | −0.001; 0.002 | 0.283 |
TNF-α gene expression | |||
HIV infection | 0.622 | 0.403; 0.842 | 0.000 |
Gender | 0.075 | −0.084; 0.233 | 0.355 |
Age | 0.004 | −0.003; 0.011 | 0.279 |
25(OH)D3 levels | −0.003 | −0.006; −0.001 | 0.022 |
Time since HIV diagnosis # | 0.001 | −0.001; 0.002 | 0.546 |
IFN-γ gene expression | |||
HIV infection | 0.606 | 0.313; 0.900 | 0.000 |
Gender | 0.040 | −0.171; 0.252 | 0.709 |
Age | −0.006 | −0.016; 0.003 | 0.210 |
25(OH)D3 levels | −0.005 | −0.008; −0.001 | 0.018 |
Time since HIV diagnosis # | −0.002 | −0.005; 0.002 | 0.983 |
LC3 gene expression | |||
HIV infection | −0.280 | −0.499; −0.060 | 0.012 |
Gender | −0.024 | −0.182; 0.134 | 0.763 |
Age | 0.001 | −0.006; 0.008 | 0.745 |
25(OH)D3 levels | 0.002 | −0.001; 0.005 | 0.176 |
Time since HIV diagnosis # | 0.001 | −0.001; 0.002 | 0.477 |
ATG5 gene expression | |||
HIV infection | −0.334 | −0.525; −0.143 | 0.001 |
Gender | 0.086 | −0.051; 0.224 | 0.218 |
Age | 0.005 | −0.001; 0.011 | 0.105 |
25(OH)D3 levels | 0.003 | 0.001; 0.005 | 0.019 |
Time since HIV diagnosis # | −0.001 | −0.003; 0.001 | 0.729 |
BECN1 gene expression | |||
HIV infection | −0.168 | −0.451; 0.0115 | 0.245 |
Gender | −0.092 | −0.296; 0.113 | 0.379 |
Age | 0.006 | −0.003; 0.016 | 0.178 |
25(OH)D3 levels | 0.002 | −0.001; 0.006 | 0.263 |
Time since HIV diagnosis # | −0.001 | −0.002; 0.002 | 0.874 |
TGM2 gene expression | |||
HIV infection | 0.025 | −0.158; 0.209 | 0.787 |
Gender | −0.007 | −0.139; 0.125 | 0.916 |
Age | 0.002 | −0.004; 0.008 | 0.490 |
25(OH)D3 levels | −0.003 | −0.006; −0.001 | 0.005 |
Time since HIV diagnosis # | −0.002 | −0.003; 0.001 | 0.925 |
Gene | Primer | Sequence 5′→ 3′ |
---|---|---|
β-ACT | forward | TGGTTACAGGAAGTCCCTTGCC |
β-ACT | reverse | ATGCTATCACCTCCCCTGTGTG |
CYP27B1 | forward | GGAACCCTGAACAACGTAGTC |
CYP27B1 | reverse | AGTCCGAACTTGTAAAATTCCCC |
TGM2 | forward | CCTTACGGAGTCCAACCTCA |
TGM2 | reverse | CCGTCTTCTGCTCCTCAGTC |
TNF-α | forward | GTGAGGAGGACGAACATC |
TNF-α | reverse | GAGCCAGAAGAGGTTGAG |
IFN-γ | forward | GCAGCCAACCTAAGCAAGAT |
IFN-γ | reverse | TCACCTGACACATTCAAGTTCTG |
LC3 | forward | CGGTGATAATAGAACGATACAAG |
LC3 | reverse | CTGAGATTGGTGTGGAGAC |
ATG5 | forward | TGCCTGAACAGAATCATCCTT |
ATG5 | reverse | CCAGCCCAGTTGCCTTAT |
BECN1 | forward | ACAGTGAACAGTTACAGATGGA |
BECN1 | reverse | CTCAGCCTGGACCTTCTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Currò, M.; Visalli, G.; Pellicanò, G.F.; Ferlazzo, N.; Costanzo, M.G.; D’Andrea, F.; Caccamo, D.; Nunnari, G.; Ientile, R. Vitamin D Status Modulates Inflammatory Response in HIV+ Subjects: Evidence for Involvement of Autophagy and TG2 Expression in PBMC. Int. J. Mol. Sci. 2020, 21, 7558. https://doi.org/10.3390/ijms21207558
Currò M, Visalli G, Pellicanò GF, Ferlazzo N, Costanzo MG, D’Andrea F, Caccamo D, Nunnari G, Ientile R. Vitamin D Status Modulates Inflammatory Response in HIV+ Subjects: Evidence for Involvement of Autophagy and TG2 Expression in PBMC. International Journal of Molecular Sciences. 2020; 21(20):7558. https://doi.org/10.3390/ijms21207558
Chicago/Turabian StyleCurrò, Monica, Giuseppa Visalli, Giovanni Francesco Pellicanò, Nadia Ferlazzo, Maria Giovanna Costanzo, Flavia D’Andrea, Daniela Caccamo, Giuseppe Nunnari, and Riccardo Ientile. 2020. "Vitamin D Status Modulates Inflammatory Response in HIV+ Subjects: Evidence for Involvement of Autophagy and TG2 Expression in PBMC" International Journal of Molecular Sciences 21, no. 20: 7558. https://doi.org/10.3390/ijms21207558