Effects of Dietary Fat Sources during Late Gestation on Colostrum Quality and Mammary Gland Inflammation in Lipopolysaccharide-Challenged Sows
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Animals, Diets and Experimental Design
2.3. Analysis of the Composition and Cytokines Concentrations in Colostrum
2.4. Quantitative Real-Time PCR Analysis
2.5. Immunoblotting Analysis
2.6. Statistical Analysis
3. Results
3.1. Performance Characteristics
3.2. Colostrum Production and Composition
3.3. Cytokine Productions in the Colostrum
3.4. mRNA Abundances and Protein Expression of Inflammatory Cytokine in Mammary Gland
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Pravieux, J.J.; Poulet, H.; Charreyre, C.; Juillard, V. Protection of Newborn Animals through Maternal Immunization. J. Comp. Pathol. 2007, 137, S32–S34. [Google Scholar] [CrossRef]
- Lauridsen, C.; Stagsted, J.; Jensen, S.K. n-6 and n-3 fatty acids ratio and vitamin E in porcine maternal diet influence the antioxidant status and immune cell eicosanoid response in the progeny. Prostag. Oth. Lipid. Mediat. 2007, 84, 66–78. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.S.; Wang, C.Q.; Zhao, X.; Shi, B.M.; Shan, A.S. Effects of fat sources in sow on the fatty acid profiles and fat globule size of milk and immunoglobulins of sows and piglets. Anim. Feed Sci. Technol. 2017, 234, 217–227. [Google Scholar] [CrossRef]
- Lavery, A.; Lawlor, P.G.; Miller, H.M.; Magowan, E. The effect of dietary oil type and energy intake in lactating sows on the fatty acid profile of colostrum and milk, and piglet growth to weaning. Animals 2019, 9, 1092. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Wan, H.; Zhu, J.; Fang, Z.; Che, L.; Xu, S.; Lin, Y.; Li, J.; Wu, D. Fish oil and olive oil supplementation in late pregnancy and lactation differentially affect oxidative stress and inflammation in sows and piglets. Lipids 2015, 50, 647–658. [Google Scholar] [CrossRef] [PubMed]
- Gessner, D.K.; Grone, B.; Couturier, A.; Rosenbaum, S.; Hillen, S.; Becker, S.; Erhardt, G.; Reiner, G.; Ringseis, R.; Eder, K. Dietary fish oil inhibits pro-inflammatory and ER stress signalling pathways in the liver of sows during lactation. PLoS ONE 2015, 10, e0137684. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, A.M.; de Francisco, P.C.; Motta, K.; Chagas, T.R.; Dos Santos, C.; Rafacho, A.; Nunes, E.A. Fish oil supplementation attenuates changes in plasma lipids caused by dexamethasone treatment in rats. Appl. Physiol. Nutr. Metab. 2016, 41, 382–390. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Plakidas, A.; Lee, W.H.; Heikkinen, A.; Chanmugam, P.; Bray, G.; Hwang, D.H. Differential modulation of Toll-like receptors by fatty acids: Preferential inhibition by n-3 polyunsatured fatty acids. J. Lipid Res. 2003, 44, 479–486. [Google Scholar] [CrossRef]
- Sordillo, L.M.; Streicher, K.L. Mammary gland immunity and mastitis susceptibility. J. Mammary Gland Biol. 2002, 7, 135–146. [Google Scholar] [CrossRef]
- Lowe, A.P.; Thomas, R.S.; Nials, A.T.; Kidd, E.J.; Broadley, K.J.; Ford, W.R. LPS exacerbates functional and inflammatory responses to ovalbumin and decreases sensitivity to inhaled fluticasone propionate in a guinea pig model of asthma. Br. J. Pharmacol. 2015, 172, 2588–2603. [Google Scholar] [CrossRef]
- Sun, L.H.; Pi, D.A.; Zhao, L.; Wang, X.Y.; Zhu, L.Y.; Qi, D.S.; Liu, Y.L. Response of selenium and selenogenome in immune tissues to LPS-Induced inflammatory reactions in pigs. Biol. Trace Elem. Res. 2017, 177, 90–96. [Google Scholar] [CrossRef] [PubMed]
- Mouton, P.R.; Kelleybell, B.; Tweedie, D.; Spangler, E.L.; Perez, E.; Carlson, O.D.; Short, R.G.; de Cabo, R.; Chang, J.; Ingram, D.K. The effects of age and lipopolysaccharide (LPS)-mediated peripheral inflammation on numbers of central catecholaminergic neurons. Neurobiol. Aging 2012, 33, 423. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Xue, P.; Cao, S.; Liu, J.; Chen, L.; Zhang, H. Effects of dietary phosphorus concentration and body weight on postileal phosphorus digestion in pigs. Anim. Feed Sci. Technol. 2018, 242, 86–94. [Google Scholar] [CrossRef]
- You, L.; Lee, A.V.; Oh, S.Y.; Fisher-Heffernan, R.E.; Edwards, M.; de Lange, K.; Karrow, N.A. Effect of lipopolysaccharide-induced immune stimulation and maternal fish oil and microalgae supplementation during late pregnancy on nursery pig hypothalamic-pituitary-adrenal function1. J. Anim. Sci. 2019, 97, 2940–2951. [Google Scholar] [CrossRef] [PubMed]
- NRC. Nutrient Requirements of Swine, 11th ed.; National Academy Press: Washington, DC, USA, 2012. [Google Scholar]
- Krogh, U.; Bruun, T.S.; Amdi, C.; Flummer, C.; Theil, P.K. Colostrum production in sows fed different sources of fiber and fat during late gestation. Can. J. Anim. Sci. 2015, 95, 211–223. [Google Scholar] [CrossRef]
- Devillers, N.; Farmer, C.; Le Dividich, J.; Prunier, A. Variability of colostrum yield and colostrum intake in pigs. Animal 2007, 1, 1033–1041. [Google Scholar] [CrossRef]
- Liu, J.; Yan, H.; Cao, S.; Hu, Y.; Zhang, H. Effects of absorbents on growth performance, blood profiles and liver gene expression in broilers fed diets naturally contaminated with aflatoxin. Asian-Australas. J. Anim. Sci. 2020, 33, 294–304. [Google Scholar] [CrossRef]
- Liu, J.; Yan, H.; Zhang, Y.; Hu, Y.; Zhang, H. Effects of stale maize on growth performance, immunity, intestinal morphology and antioxidant capacity in broilers. Asian-Australas. J. Anim. Sci. 2020. [Google Scholar] [CrossRef]
- Zhang, C.; Chen, K.; Zhao, X.; Wang, C.; Geng, Z. Effect of L-theanine on the growth performance, immune function, and jejunum morphology and antioxidant status of ducks. Animal 2019, 13, 1145–1153. [Google Scholar] [CrossRef]
- Yan, H.; Cao, S.; Hu, Y.; Zhang, H.; Liu, J. Effects of methylsulfonylmethane on growth performance, immunity, antioxidant capacity and meat quality in Pekin ducks. Poul. Sci. 2020, 99, 1069–1074. [Google Scholar] [CrossRef]
- Zou, T.; Kang, Y.; Wang, B.; de Avila, J.M.; You, J.; Zhu, M.J.; Du, M. Raspberry supplementation reduces lipid accumulation and improves insulin sensitivity in skeletal muscle of mice fed a high-fat diet. J. Funct. Foods 2019, 63, 103572. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, Y.; Li, Y.; Yan, H.; Zhang, H. L-tryptophan enhances intestinal integrity in diquat-challenged piglets associated with improvement of redox status and mitochondrial function. Animals 2019, 9, 266. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Zhou, P.; Zhang, Y.; Zhang, Z.; Liu, J.; Zhang, H. Short-chain fructo-oligosaccharides alleviates oxidized oil-induced intestinal dysfunction in piglets associated with the modulation of gut microbiota. J. Funct. Foods 2020, 64, 103661. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, M.; Zhou, P.; Yan, H.; Zhang, Z.; Zhang, H.; Qi, R.; Liu, J. β-hydroxy-β-methylbutyrate-induced upregulation of miR-199a-3p contributes to slow-to-fast muscle fiber type conversion in mice and C2C12 cells. J. Agric. Food Chem. 2020, 68, 530–540. [Google Scholar] [CrossRef]
- Jin, C.; Fang, Z.; Lin, Y.; Che, L.; Wu, C.; Xu, S.; Feng, B.; Li, J.; Wu, D. Influence of dietary fat source on sow and litter performance, colostrum and milk fatty acid profile in late gestation and lactation. Anim. Sci. J. 2017, 88, 1768–1778. [Google Scholar] [CrossRef]
- Leonard, S.G.; Sweeney, T.; Bahar, B.; Lynch, B.P.; O’Doherty, J.V. Effect of maternal fish oil and seaweed extract supplementation on colostrum and milk composition, humoral immune response, and performance of suckled piglets. J. Anim. Sci. 2010, 88, 2988–2997. [Google Scholar] [CrossRef]
- Wang, H.; Yang, L.L.; Hu, Y.F.; Wang, B.W.; Huang, Y.Y.; Zhang, C.; Chen, Y.H.; Xu, D.X. Maternal LPS exposure during pregnancy impairs testicular development, steroidogenesis and spermatogenesis in male offspring. PLoS ONE 2014, 9, e106786. [Google Scholar] [CrossRef]
- Quesnel, H.; Farmer, C.; Devillers, N. Colostrum intake: Influence on piglet performance and factors of variation. Livest. Sci. 2012, 146, 105–114. [Google Scholar] [CrossRef]
- Oliver, S.P.; Calvinho, L.F. Influence of Inflammation on Mammary Gland Metabolism and Milk Composition. J. Anim. Sci. 1995, 73, 18–33. [Google Scholar] [CrossRef]
- Hoogland, I.C.; Houbolt, C.; van Westerloo, D.J.; van Gool, W.A.; van de Beek, D. Systemic inflammation and microglial activation: Systematic review of animal experiments. J. Neuroinflamm. 2015, 12, 114. [Google Scholar] [CrossRef] [PubMed]
- Zou, T.; Wang, B.; Li, S.; Liu, Y.; You, J. Dietary apple polyphenols promote fat browning in high-fat diet-induced obese mice through activation of AMP-activated protein kinase (AMPK) α. J. Sci. Food Agric. 2020. [Google Scholar] [CrossRef] [PubMed]
- Tai, C.C.; Ding, S.T. N-3 polyunsaturated fatty acids regulate lipid metabolism through several inflammation mediators: Mechanisms and implications for obesity prevention. J. Nutr. Biochem. 2010, 21, 357–363. [Google Scholar] [CrossRef]
- Ye, J.; Keller, J.N. Regulation of energy metabolism by inflammation: A feedback response in obesity and calorie restriction. Aging 2010, 2, 361–368. [Google Scholar] [CrossRef]
- Puerta, R.D.L.; Marquez-Martin, A.; Fernandez-Arche, A.; Ruiz-Gutierrez, V. Influence of dietary fat on oxidative stress and inflammation in murine macrophages. Nutrition 2009, 25, 548–554. [Google Scholar] [CrossRef]
- Duda, M.K.; O’Shea, K.M.; Tintinu, A.; Xu, W.; Khairallah, R.J.; Barrows, B.R.; Chess, D.J.; Azimzadeh, A.M.; Harris, W.S.; Sharov, V.G.; et al. Fish oil, but not flaxseed oil, decreases inflammation and prevents pressure overload-induced cardiac dysfunction. Cardiovasc. Res. 2009, 81, 319–327. [Google Scholar] [CrossRef]
- Fritsche, K.L.; Alexander, D.W.; Cassity, N.A.; Huang, S.C. Maternally-supplied fish oil alters piglet immune cell fatty acid profile and eicosanoid production. Lipids 1993, 28, 677–682. [Google Scholar] [CrossRef]
- Luo, J.; Huang, F.R.; Xiao, C.L.; Chen, W.; Jiang, S.W.; Peng, J. Effect of dietary supplementation of fish oil for lactating sows and weaned piglets on piglet Th polarization. Livest. Sci. 2009, 126, 286–291. [Google Scholar] [CrossRef]
- Veshkini, A.; Mohammadi-Sangcheshmeh, A.; Alamouti, A.A.; Kouhkan, F.; Salehi, A. Maternal supplementation with fish oil modulates inflammation-related MicroRNAs and genes in suckling lambs. Trop. Anim. Health Prod. 2019, 1–12. [Google Scholar] [CrossRef]
- Zhang, J.; Xu, X.; Zhu, H.; Wang, Y.; Hou, Y.; Liu, Y. Dietary fish oil supplementation alters liver gene expressions to protect against LPS-induced liver injury in weanling piglets. Innate Immun. 2019, 25, 60–72. [Google Scholar] [CrossRef]
- Yuan, F.H.; Wang, H.L.; Tian, Y.; Li, Q.; He, L.; Li, N.; Liu, Z. Fish oil alleviated high-fat diet–induced non-alcoholic fatty liver disease via regulating hepatic lipids metabolism and metaflammation: A transcriptomic study. Lipids Health Dis. 2016, 15, 20. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, D.S.; Cecchini, R.; Kadri, M.Z.E.; Rodríguez, M.A.M.; Dichi, I. Decreased oxidative stress in patients with ulcerative colitis supplemented with fish oil omega-3 fatty acids. Nutrition 2003, 19, 837–842. [Google Scholar] [CrossRef]
- Rocha, D.M.; Caldas, A.P.; Oliveira, L.L.; Bressan, J.; Hermsdorff, H.H. Saturated fatty acids trigger TLR4-mediated inflammatory response. Atherosclerosis 2016, 244, 211–215. [Google Scholar] [CrossRef] [PubMed]
- Milanski, M.; Degasperi, G.; Coope, A.; Morari, J.; Denis, R.; Cintra, D.E.; Tsukumo, D.M.L.; Anhe, G.; Amaral, M.E.; Takahashi, H.K. Saturated fatty acids produce an inflammatory response predominantly through the activation of tlr4 signaling in hypothalamus: Implications for the pathogenesis of obesity. J. Neurosci. 2009, 29, 359–370. [Google Scholar] [CrossRef] [PubMed]
- Ströher, D.J.; de Oliveira, M.F.; Martinez-Oliveira, P.; Pilar, B.C.; Cattelan, M.D.P.; Rodrigues, E.; Bertolin, K.; Gonçalves, P.B.D.; Piccoli, J.D.C.E.; Manfredini, V. Virgin coconut oil associated with high-fat diet induces metabolic dysfunctions, adipose inflammation, and hepatic lipid accumulation. J. Med. Food 2019. [Google Scholar] [CrossRef] [PubMed]
Ingredients (g/kg of Diet) | Soybean Oil | Coconut Oil | Fish Oil |
---|---|---|---|
Corn | 645.0 | 645.0 | 645.0 |
Soybean meal (CP44%) | 130.0 | 130.0 | 130.0 |
Wheat bran | 150.0 | 150.0 | 150.0 |
Soybean oil | 30.0 | - | - |
Fish oil | - | - | 30.0 |
Coconut oil | - | 30.0 | - |
Fish meal (CP65%) | 20.0 | 20.0 | 20.0 |
Lysine-HCl (98.5%) | 0.3 | 0.3 | 0.3 |
DL-Methionine (99%) | 0.3 | 0.3 | 0.3 |
L-Threonine (99%) | 0.4 | 0.4 | 0.4 |
Limestone | 6.5 | 6.5 | 6.5 |
Monocalcium phosphate | 10.0 | 10.0 | 10.0 |
NaCl | 4.0 | 4.0 | 4.0 |
Choline chloride (50%) | 1.0 | 1.0 | 1.0 |
Vitamin mix 1 | 0.5 | 0.5 | 0.5 |
Mineral mix 2 | 2.0 | 2.0 | 2.0 |
Total | 1000.0 | 1000.0 | 1000.0 |
Calculated composition | |||
Digestible energy, Mcal/kg | 3.30 | 3.26 | 3.30 |
Crude protein, % | 14.25 | 14.25 | 14.25 |
Ca, % | 0.72 | 0.72 | 0.72 |
Total P, % | 0.68 | 0.68 | 0.68 |
Available P, % | 0.41 | 0.41 | 0.41 |
Total lysine, % | 0.62 | 0.62 | 0.62 |
Total methionine, % | 0.23 | 0.23 | 0.23 |
Total threonine, % | 0.48 | 0.48 | 0.48 |
Total tryptophan, % | 0.13 | 0.13 | 0.13 |
Soybean Oil | Coconut Oil | Fish Oil | |
---|---|---|---|
Ether extract, % | 99.64 | 99.86 | 99.56 |
Fatty acids, % of ether extract | |||
C12:0 | 1.13 | 42.89 | 0.23 |
C14:0 | 0.26 | 23.44 | 6.58 |
C16:0 | 12.36 | 8.36 | 15.33 |
C16:1 (n-7) | 0.31 | 0.12 | 7.06 |
C18:0 | 4.63 | 2.56 | 3.85 |
C18:1 (n-9) | 20.16 | 8.74 | 16.06 |
C18:2 (n-6) | 53.63 | 0.03 | 4.55 |
C18:3 (n-3) | 7.56 | 1.22 | 2.26 |
C20:0 | 0.53 | 0.34 | 0.82 |
C20:1 (n-9) | not detected | 0.54 | 2.04 |
C20:5 (n-3) | 0.23 | not detected | 16.89 |
C22:1 | not detected | not detected | 3.31 |
C22:5 (n-3) | not detected | not detected | 1.96 |
C22:6 (n-3) | 0.38 | not detected | 13.99 |
Gene Symbols | Nucleotide Sequence of Primers (5′-3′) | Accession No. |
---|---|---|
ACTB | F: TCTGGCACCACACCTTCT R: TGATCTGGGTCATCTTCTCAC | XM_003124280.3 |
TOP2B | F: AACTGGATGATGCTAATGATGCT R: TGGAAAAACTCCGTATCTGTCTC | NM_001258386.1 |
TBP | F: GATGGACGTTCGGTTTAGG R: AGCAGCACAGTACGAGCAA | DQ178129 |
TLR4 | F: TCAGTTCTCACCTTCCTCCTG R: GTTCATTCCTCACCCAGTCTTC | GQ503242.1 |
IL6 | F: GACAAAGCCACCACCCCTAA R: CTCGTTCTGTGACTGCAGCTTATC | M80258.1 |
IL1β | F: TCTGCCTGTACCCCAACTG R: CCAGGAAGACGGGCTTTTG | NM214055.1 |
TNFα | F: CGTGAAGCTGAAAGACAACCAG R: GATGGTGTGAGTGAGGAAAACG | EU682384.1 |
Items | Soybean Oil | Coconut Oil | Fish Oil | p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Saline | LPS | Saline | LPS | Saline | LPS | SEM | Oil Type | LPS | O × L | |
Sow body weighgt at day 90, kg | 261.3 | 262.1 | 263.0 | 262.9 | 260.0 | 261.1 | 4.6 | 0.891 | 0.885 | 0.992 |
Sow backfat at day 90, mm | 14.6 | 14.9 | 15.0 | 15.0 | 15.0 | 14.9 | 0.4 | 0.862 | 0.823 | 0.920 |
Duration of farrowing, h | 4.3 | 3.4 | 4.1 | 3.9 | 3.5 | 4.2 | 0.9 | 0.980 | 0.751 | 0.478 |
Onset of transient milk production, h | 30.2 | 31.3 | 31.2 | 30.4 | 33.9 | 32.8 | 1.3 | 0.125 | 0.821 | 0.698 |
Litter size, n | ||||||||||
Total born | 12.3 | 12.0 | 12.6 | 13.0 | 12.5 | 12.6 | 1.2 | 0.857 | 0.972 | 0.966 |
Born alive | 11.2 | 11.3 | 11.1 | 11.4 | 11.3 | 11.0 | 1.3 | 0.981 | 0.950 | 0.987 |
Mortality from day 1 to 5, % | 4.3 | 3.7 | 3.9 | 5.2 | 5.6 | 4.5 | 0.7 | 0.431 | 0.991 | 0.198 |
Piglets | ||||||||||
Birth weight, kg | 1.45 | 1.52 | 1.47 | 1.50 | 1.39 | 1.42 | 0.1 | 0.816 | 0.706 | 0.994 |
Weight gain (0 to 24 h), g | 132 | 109 | 132 | 94 | 129 | 114 | 10 | 0.497 | <0.001 | 0.357 |
Items | Soybean Oil | Coconut Oil | Fish Oil | p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Saline | LPS | Saline | LPS | Saline | LPS | SEM | Oil Type | LPS | O × L | |
0 to 24 h Colostrum yield (kg sow-1) | 4.4 | 3.6 | 5.1 | 3.8 | 5.0 | 4.7 | 0.3 | 0.084 | 0.014 | 0.437 |
0 to 24 h Colostrum intake (g piglet-1) | 392 | 317 | 458 | 323 | 441 | 424 | 36 | 0.059 | 0.005 | 0.189 |
Items | Soybean Oil | Coconut Oil | Fish Oil | p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Saline | LPS | Saline | LPS | Saline | LPS | SEM | Oil Type | LPS | O × L | |
Protein (%) | 10.8 | 9.1 | 10.9 | 9.3 | 10.4 | 10.2 | 0.8 | 0.964 | 0.270 | 0.808 |
Fat (%) | 5.3 | 4.9 | 5.4 | 5.1 | 5.6 | 5.4 | 0.6 | 0.733 | 0.492 | 0.996 |
Lactose (%) | 4.4 | 4.3 | 4.7 | 4.6 | 4.5 | 4.3 | 0.2 | 0.218 | 0.372 | 0.951 |
Dry matter (%) | 22.4 | 20.2 | 22.3 | 19.1 | 21.9 | 20.8 | 1.0 | 0.759 | 0.005 | 0.502 |
Items | Soybean Oil | Coconut Oil | Fish Oil | p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Saline | LPS | Saline | LPS | Saline | LPS | SEM | Oil Type | LPS | O × L | |
IL6 (mg/L) | 1.23 | 2.23 | 2.12 | 4.05 | 0.98 | 1.17 | 0.4 | <0.001 | <0.001 | <0.001 |
IL1β (ng/L) | 23.13 | 43.67 | 29.91 | 75.78 | 20.45 | 33.11 | 5.4 | <0.001 | <0.001 | <0.001 |
TNFα (ng/L) | 121.3 | 149.4 | 109.4 | 229.4 | 119.4 | 129.3 | 24.5 | 0.009 | <0.001 | <0.001 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zou, T.; Wei, W.; Cao, S.; Zhang, H.; Liu, J. Effects of Dietary Fat Sources during Late Gestation on Colostrum Quality and Mammary Gland Inflammation in Lipopolysaccharide-Challenged Sows. Animals 2020, 10, 319. https://doi.org/10.3390/ani10020319
Zou T, Wei W, Cao S, Zhang H, Liu J. Effects of Dietary Fat Sources during Late Gestation on Colostrum Quality and Mammary Gland Inflammation in Lipopolysaccharide-Challenged Sows. Animals. 2020; 10(2):319. https://doi.org/10.3390/ani10020319
Chicago/Turabian StyleZou, Tiande, Wenzhuo Wei, Shanchuan Cao, Hongfu Zhang, and Jingbo Liu. 2020. "Effects of Dietary Fat Sources during Late Gestation on Colostrum Quality and Mammary Gland Inflammation in Lipopolysaccharide-Challenged Sows" Animals 10, no. 2: 319. https://doi.org/10.3390/ani10020319
APA StyleZou, T., Wei, W., Cao, S., Zhang, H., & Liu, J. (2020). Effects of Dietary Fat Sources during Late Gestation on Colostrum Quality and Mammary Gland Inflammation in Lipopolysaccharide-Challenged Sows. Animals, 10(2), 319. https://doi.org/10.3390/ani10020319