You are currently viewing a new version of our website. To view the old version click .
Horticulturae
  • Article
  • Open Access

29 January 2025

Identification and Expression Analysis of miR166 Gene Family in Response to Salt Stress in Chrysanthemum

,
,
,
,
,
,
and
College of Horticulture, Jilin Agricultural University, 2888 Xincheng Street, Changchun 130118, China
*
Authors to whom correspondence should be addressed.
This article belongs to the Special Issue Germplasm, Genetics and Breeding of Ornamental Plants

Abstract

cgr-miR166 was observed to be significantly enhanced in Chrysanthemum under 200 mM NaCl treatment. Here, ten family members were identified by aligning cgr-miR166 with scaffold sequences from the Chrysanthemum nankingense genome database, naming them from cgr-miR166a to cgr-miR166j, and their precursors could form stable stem-loop structures. The mature regions were observed to be highly conserved, with the 3′ end being more conserved than the 5′ end. miR166s promoters have been found to contain cis-acting elements responsive to diverse stimuli like the phytohormones ABA and IAA. qRT-RCR results demonstrated that the transcriptome sequencing results were reliable and miR166 was present at different levels in the roots, stems, leaves and flowers of Chrysanthemum. Furthermore, the HD-ZipIII transcription factor was validated to be the target gene of Chrysanthemum miR166s by degradome sequencing. Taken together, the cgr-miR166 family exhibited both evolutionary conservation and diversification. The expression level of miR166 was upregulated in root under salt stress, while the expression level of the target gene HD-ZipIII was downregulated. These findings established the foundation for further understanding the mechanism of miR166-HD-ZipIII modules in salt response and tolerance.

1. Introduction

MicroRNAs (miRNAs) are a class of small endogenous non-coding RNAs found in eukaryotes that are approximately 20–24 nucleotides long. They play an important role in regulating plant gene expression [1]. In 1993, lin-4 was discovered in Caenorhabditis elegans, an essential regulatory factor in the early development of nematodes [2]. In 2002, the first plant miRNA was discovered in Arabidopsis thaliana, opening the door for human research on miRNAs in terrestrial plants [3]. Biosynthetic processes and mechanisms of action are gradually becoming clearer with the development of science and technology.
In plants, miRNAs are transcribed by RNA polymerase II to produce a primary transcript (pri-miRNA) and are subjected to polyadenylation [4]. The pri-miRNA is cleaved into the miRNA precursor, pre-miRNA, which is then processed into miRNA/miRNA* duplexes by the DCL1 complex [5]. Under the action of the methyltransferase HEN1, the 3′ terminal residues of the double strand are methylated and transported to the cytoplasm by HASTY(HST) and other factors [6]. Double strands are rapidly separated in the cytoplasm, and miRNA* is degraded [7]. Finally, miRNAs complement the target gene sequence and guide the RISC complex to regulate the target genes through transcript cleavage or translation inhibition [8].
miR166, one of the oldest and largest families of miRNAs, is widely distributed among terrestrial plants and highly conserved [9]. The number of miR166 members in different plants differs slightly. We downloaded miR166 sequences of all reported plants from miRbase (http://www.mirbase.org/, accessed on 6 October 2023), and we found that there are 7 miR166 family members in A. thaliana, 11 in Sorghum bicolor, 13 in Oryza sativa, 14 in Zea mays and 21 in Glycine max. Its wide distribution and high conservation suggest that it is closely associated with plant growth and development [10]. miR166 is primarily involved in plant responses to abiotic stress by specifically binding targets such as Class III homeodomain leucine zipper (HD-ZipIII) transcription factors to promote post-transcriptional regulation [11,12]. Related studies have shown that miR166f overexpression in mulberry downregulates the expression of the target homeodomain-leucine zipper (HD-Zip) transcription factor and histone arginine demethylase (JMJD6), thereby enhancing the adaptability of Morus alba to arid environments [13]. In G. max, drought stress inhibited the expression of miR166, resulting in the upregulation of its target gene, ATHB14-LIKE. By increasing the expression of ATHB14-LIKE to regulate downstream genes in response to drought stress, this feedback regulation cycle model may help plants improve their ability to adapt to drought stress [14]. Under high-temperature conditions, the downregulation of miR166 in A. thaliana increased the target gene HB15, inhibiting vascular bundle development and secondary cell wall formation in A. thaliana [15].
Chrysanthemum ‘Niu 9717’ (Chrysanthemum × grandiflora) is a new ground-cultivated small chrysanthemum cultivar group. Because of its strong resistance to salt and easy management, it has become an important plant material in landscape construction [16]. In the early stage of the research, 200 mM NaCl solution was used to treat the Chrysanthemum for 12 h. The samples were control root (CK-R), control leaf (CK-L), root under 200 mM NaCl (S200-R) and leaf under 200 mM NaCl (S200-L). High-throughput small RNA sequencing revealed that miR166 may play an important role in the response of Chrysanthemum to salt stress. In this study, miR166 was used as the research target. Sequence conservation, phylogenetic evolution, secondary structures of the precursor sequences, and upstream promoter regions were analyzed using bioinformatics methods. Target genes were predicted, annotated and expressed by the degradation data. The expression levels of miR166 in salt stress and different tissues were detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR), which provided a reference for further studies on the function and mechanism of miR166 and its target genes in response to salt stress in Chrysanthemum.

2. Materials and Methods

2.1. Plant Material and Growth Conditions

We used branches of Chrysanthemum ’Niu 9717’, which were propagated by cuttings, rooted and then transplanted into pots for cultivation (pots with a caliber of 10.0 cm and a height of 9.0 cm, cultivation soil/charcoal/garden soil/perlite/sand = 3:2:1:1). Different tissue parts (roots, stems, leaves and flowers) of Chrysanthemum were taken at the time of blooming, quickly put in liquid nitrogen for quick-freezing treatment and subsequently stored at −80 °C for subsequent analysis. Under salt stress, plant roots and leaves are the most sensitive parts of the plant to salt stress [17], and roots and leaves are also representative sampling sites in salt stress experiments [16,17,18,19]. When the plants had grown 9–10 leaves, they were watered with 45 mL of water (control) or with an aqueous solution containing 200 mM NaCl (Figure S1), and the leaves and roots at 0 h, 4 h, 8 h and 12 h were taken to determine the specific responses of Chrysanthemum miR166 in leaves and roots under salt stress. Three biological replicates were used in each experiment.

2.2. Acquisition of Mature Sequences of miR166 Family Members

Based on the results of high-throughput sequencing of miRNAs in the previous stages of research, a differentially expressed miRNA-miR166 (log2 = 0.27; p value = 0.0265) was screened from the small RNA library, and its mature sequence was determined (reference to previous work). BLASTN (Evalue = 1 × 10−5) was used to compare the mature sequence with the Chrysanthemum nankingense genome database (http://www.amwayabrc.com/index.html, accessed on 8 October 2023) scaffold sequences to determine the position of the mature body in the genome.

2.3. Secondary Structure Prediction of miR166 Precursors

The 200 nt nucleotide sequences at both ends of the fully matched genome sequence were obtained, and the secondary structure and minimum free energy (MFE) of the precursor sequence were predicted and analyzed using the online tool RNAfold Web Server (http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi, accessed on 8 October 2023).

2.4. Conservation of Sequences and Analysis of Base Preferences

Sequence alignments of precursor and mature sequences (-3p and-5p) of the miR166 family members were compared using DNAMAN (version 9) multiple sequence alignment (MSA) with default parameter settings, and their conservation was analyzed. Mature sequences of all reported plant miR166 were obtained from the miRbase. Weblogo (http://weblogo.berkeley.edu/logo.cgi, accessed on 10 October 2023) was used to analyze the frequency of each base, and a sequence logo diagram was generated to analyze base conservation.

2.5. Phylogenetic Analysis of Identified MIR166

The miR166 precursor sequences of A. thaliana, O. sativa, Z. mays, S. bicolor, Medicago truncatula, G max and Vitis vinifera were downloaded from miRbase. MEGA software (version 7.0) was used to calculate similar genetic distance parameters based on the neighbor-joining (NJ) method of 1000 bootstrap sampling, and a phylogenetic tree of miR166 family precursor sequences was generated.

2.6. Analysis of cis-Acting Elements

The 2000 bp sequences upstream of the miR166 precursors were extracted from C. nankingense. PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 10 October 2023) was used to retrieve and identify cis-acting elements in the promoter regions, and Tbtools (version 2.096) was used to visualize the prediction results.

2.7. Prediction of Target Genes

The target genes of miR166 were preliminarily screened based on the AllenScore values of the binding sites (the lower the score, the more likely they were to be reciprocally targeted) and T-plots of the degradome data of Chrysanthemum. A phylogenetic tree was constructed using the neighbor-joining method in MEGA (version 7.0) with 1000 bootstrap sampling to analyze the evolutionary relationship between the screened target genes and the HD-ZIPIII family of A. thaliana. Changes in the expression of the predicted target genes under salt stress were analyzed to further screen the target genes of miR166 in Chrysanthemum.

2.8. The Expression Pattern of miR166 Under Salt Stress

To verify the accuracy of the miRNA sequencing results and understand the specific responses of Chrysanthemum miR166, qRT-PCR was used to characterize the expression patterns of Chrysanthemum miR166 of roots and leaves under salt stress duration.

2.8.1. RNA Isolation and Detection

The total RNA was extracted from the roots and leaves of Chrysanthemum using a TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, China). The specific steps are described in the instructions section. After extraction, agarose gel electrophoresis (electrophoresis conditions: 1% gel concentration; 1 × TAE electrophoresis buffer; 120 V, 25 min) was used to detect the integrity of RNA in Chrysanthemum; RNA concentration and purity were measured using an ultra-micro protein nucleic acid analyzer (Implen GmbH, Munich, Germany). The qualified RNA was used for the subsequent reverse transcription reaction, and the remaining RNA was stored in a refrigerator at −80 °C.

2.8.2. Reverse Transcription

RNA was reverse transcribed into cDNA using the miRNA 1st Strand cDNA Synthesis Kit (stem-loop) (Vazyme, Nanjing, China). The stem-loop reverse transcription primer NZL-miR166 was designed using the primer design software miRNA Design (version 1.01) from the Vazyme Company. The stem-loop sequence was (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC). The following steps were followed:
  • Genomic DNA was removed, and the following mixture was prepared in an RNase-free centrifuge tube. The mixture details are listed in Table S1.
  • The reaction procedure was as follows: 42 °C, 2 min.
  • First-strand cDNA synthesis. The system details are listed in Table S2.
  • The reaction procedure was as follows: 25 °C, 5 min; 50 °C, 15 min; 85 °C, 5 min.

2.8.3. qRT-PCR

Reverse-transcribed cDNA was used as a template, and the forward primer q-miR166-F designed by miRNA Design and mQ Primer R in the miRNA Universal SYBR qPCR Master Mix kit were used as downstream primers. The qPCR was performed using a fluorescent quantitative PCR instrument (qTOWER3G, Jena, Germany). The system details are listed in Table S3 and the primer sequences are listed in Table S4. U6 was selected as the internal reference gene, and the expression level was calculated by the 2−ΔΔCT method.

2.9. Analysis of Tissue-Specific Expression

The extraction and detection of RNA from each tissue part of Chrysanthemum were as described in Section 2.8.1. Reverse transcription and qRT-PCR were performed on RNA from each tissue, and the test methods were the same as in Section 2.8.2 and Section 2.8.3.

3. Results

3.1. Mature Sequence and Genomic Location of the miR166 Gene Family

Significantly differentially expressed miRNAs were screened based on the small RNA database obtained by high-throughput sequencing in the early stage of the research. Among them, cgr-miR166 was not significantly differentially expressed in the leaves but was significantly upregulated in the roots (Figure 1). The mature sequence was aligned with the scaffold sequences of the C. nankingense genome database using BLASTN to obtain the genome sequence that matched exactly with the mature sequence and to determine the location of the mature body in the genome, which was sequentially named cgr-miR166a to cgr-miR166j (Table 1).
Figure 1. Expression of cgr-miR166 in leaves and roots of Chrysanthemum before and after 200 mM NaCI treatment for 12 h. * indicates that the difference is significant at the p < 0.05 level. ns is the symbols for not significant.
Table 1. Mature sequence of the cgr-miR166 gene family and their location.

3.2. Prediction of the Secondary Structure

The sequences of 200 bp both before the 5’ end and after the 3’ end of the miR166 mature body were obtained, and the secondary structures of the miR166 family members were analyzed using RNAfold Web Server. The results demonstrated that all the miR166 family members could form stable stem-loop structures, and the length of precursor sequences ranged from 91 to 184 bp. The MFEs of cgr-MIR166a-cgr-MIR166j were −46.70 kcal/mol, −56.50 kcal/mol, −41.60 kcal/mol, −62.40 kcal/mol, −68.00 kcal/mol, −37.80 kcal/mol, −49.70 kcal/mol, −66.20 kcal/mol, −80.30 kcal/mol and −79.00 kcal/mol, respectively. We visualized the precursor sequences using TBtools and found that the miR166 (red) and miR166* (green) double-stranded structural regions were located in the two arms of the stem-loop structure (Figure 2).
Figure 2. Secondary structure of precursor sequences of the miR166 family members. Red bases indicate miR166 mature sequences; green bases indicate miR166* sequences.

3.3. Analysis of Sequence Conservation and Base Preferences

We downloaded the miR166 mature sequences of all published plants from the miRbase and analyzed the base conservation of the miR166 sequences. The mature sequences formed at the 3′ end of the plant miR166 family were highly conserved and overall higher than those at the 5′ end, and the mature sequences of the Chrysanthemum miR166 family members were consistent with the sequences of most other miR166 family members. In contrast, the mature sequences formed at the 5′ end were only highly conserved in bases at positions 5, 6, 9, 13 and 14, and all preferred guanine (G) (Figure 3).
Figure 3. Identified conserved motif of the miR166 mature sequences. (A) 3′ end of the mature sequences; (B) 5′ end of the mature sequences.
Multiple sequence comparison analysis of precursor sequences and mature sequences using DNAMAN revealed that the mature sequences formed at the 3′ end and the 5′ end of the Chrysanthemum miR166 family members were more different, and the mature sequences formed at the 3′ end were more conserved. We found that the miR166 family has a segment of a conserved sequence of 5′-UCGGACCAGGCUUCAUUCC-3′, which is consistent with the conserved portion of the mature sequence at the 3′ end, with a decrease in the conservation of bases at other positions except for the position that produces the mature miRNA, which is highly conserved (Figure 4).
Figure 4. Multiple sequence alignment of miR166. (A) Comparison results of the precursor sequences; (B) comparison results of the 5′ end; (C) comparison results of the 3′ end.

3.4. Phylogenetic Analysis of Identified MIR166

Mature miRNA species have very similar sequences, but their precursor structures differ. The phylogenetic analysis of precursor sequences helps us to understand the evolutionary relationships among family genes. By comparing the precursor sequences of miR166 family members from Chrysanthemum and other plants and constructing a phylogenetic evolutionary tree for analysis, we found that the eight plants were divided into three large branches, with cgr-MIR166a~cgr-MIR166j clustered under the same branch. Among them, cgr-MIR166a, cgr-MIR166c and cgr-MIR166b were closer to zma-MIR166m, sbi-MIR166f, and osa-MIR166h; cgr-MIR166e and cgr-MIR166h were closer to gma-MIR166a, gma-MIR166c, and mtr-MIR166g; cgr-MIR166j and cgr-MIR166i were closer to ath-MIR166e; cgr-MIR166f was closer to ath-MIR166a and ath-MIR166b; and cgr-MIR166d was closer to vvi-MIR166b (Figure 5). Closer kinship indicates that they may have similar biological functions. In addition, the phylogenetic evolutionary tree results showed that the distribution of various members of the same species was also more dispersed, and it was hypothesized that the genes of the miR166 family might have evolved in different ways and at different speeds, further illustrating the complexity of plant miRNA precursors.
Figure 5. Phylogenetic relationship analysis of cgr-MIR166. cgr: Chrysanthemum × grandiflora; ath: Arabidopsis thaliana; osa: Oryza sativa; zma: Zea mays; sbi: Sorghum bicolor; mtr: Medicago truncatula; gma: Glycine max; vvi: Vitis vinifera. Red-labeled nodes indicate the locations of cgr-MIR166; the violet, yellow and green background indicate the three branches of phylogenetic tree.
We performed an evolutionary analysis of the ten precursors, in which cgr-MIR166a, cgr-MIR166b and cgr-MIR166c were clustered under the same branch; cgr-MIR166a was more closely related to cgr-MIR166c, cgr-MIR166d, cgr-MIR166f and cgr-MIR166g clustered under the same branch; cgr-MIR166d was more closely related to cgr-MIR166g; cgr-MIR166e was more closely related to cgr-MIR166h; and cgr-MIR166i was more closely related to cgr-MIR166j (Figure 6). The phylogenetic evolutionary tree was analyzed in conjunction with their precursor sequences, and it was found that their close affinity might be due to the overall similarity of their precursor sequences, although there was a certain degree of difference.
Figure 6. Phylogenetic tree constructed based on cgr-MIR166. The numbers indicate the bootstrap values.

3.5. Analysis of cis-Acting Elements

Sequences 2000 bp upstream of the 5′ end of the precursor sequence were selected from the genome and analyzed using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 10 October 2023) online bioinformatics prediction software for upstream sequences and visualization using Tbtools (version 2.096). We found that the upstream promoter sequences of the miR166 family contain typical TATA boxes and CAAT boxes with transcriptional initiation functions consistent with eukaryotic features. They also contain several stress-related response elements, such as the MYB-binding site MBS; which is involved in drought inducibility; the anaerobic-induced response element ARE; the low-temperature response element LTR; the regulatory element TC-rich repeats for defense and stress responses; the light response elements ACE, G-Box, GT1-motif, Sp1 and 3-AF1 binding site; and some optical response elements such as the ACA-motif, AE-box, AT1-motif, ATCT-motif, Box 4, Box II, chs-CMA1a, chs-CMA2a, GA-motif, Gap-box, GATA-motif, I-box, LAMP-element and TCT-motif. In addition, there are several hormone response elements, including the abscisic acid response element ABRE, methyl jasmonate response element CGTCA-motif, TGACG-motif, ethylene response element ERE, gibberellin response element GARE-motif, TATC-box, P-box, cis-acting element involved in salicylic acid responsiveness, TCA-element and growth hormone-responsive cis-acting regulatory element TGA-element. There are also binding site-specific elements, such as the MYB-binding site, MYC-binding site, MYBHv1 binding site, AT-rich binding site of AT-rich DNA-binding protein (ATBP-1) and MYB-binding site MRE, which are involved in light responsiveness. Plant tissue-specific elements include the CAT-box, a response element related to the expression in meristematic tissues, and the GCN4-motif, a cis-regulatory element involved in endosperm expression. In addition to the above elements, there was also the O2-site, a regulatory element involved in zein metabolism regulation, and WUN-motif, a wound response element (Figure 7).
Figure 7. Visual analysis of cgr-miR166 promoter regions.
The miR166 family promoters share several of the same cis-acting elements, such as the anaerobic-inducible response element ARE, enhancer element CAAT-box, core promoter element TATA-box, light-responsive element and MYC-binding site. Most share the abscisic acid-responsive element ABRE, ethylene-responsive element ERE, methyl jasmonate-responsive element CGTCA-motif, TGACG-motif, gibberellin-responsive element GARE-motif, TATC-box, P-box and the growth hormone-responsive cis-acting regulatory element TGA-element (Table S1). This suggests that miR166 expression in Chrysanthemum is induced by abscisic acid, ethylene, methyl jasmonate, gibberellin, growth hormones and light signaling.

3.6. Prediction of Target Genes

Target genes of miR166 were sequenced using the degradome, and six potential target genes of miR166 were identified by screening (Table 2). The shear sites were located at the 11th base of the 5′ end of cgr-miR166 at bases 710, 800, 443, 1250, 61 and 276 of the predicted target genes, respectively (Figure 8). In addition to having functionally characterized domains, including the homology domain (HD) and the leucine zipper structural domain (LZ), the HD-Zip III transcription factor has three additional structural domains—a MEKHLA structural domain that may play a role in light signaling and redox reactions, a START structural domain for lipid binding and a SAD structural domain for transcriptional activation [20]. The predicted target genes, TRINITY_DN121689_c0_g2, TRINITY_DN122682_c1_g2 and TRINITY_DN116772_c1_g3, were annotated as HD-ZIPIII transcription factors. A phylogenetic tree was constructed between the target genes and the Arabidopsis HD-ZIPIII family (Figure 9), in which TRINITY_DN121689_c0_g2 had the highest homology with AHTB15, and TRINITY_DN122682_c1_g2 and TRINITY_DN116772_c1_g3 were closer to REVOLUTA (REV), indicating that the HD-ZIPIII genes are also regulated by miR166 in Chrysanthemum.
Table 2. Target genes of cgr-miR166.
Figure 8. Target genes of cgr-miR166 and cleavage sites predicted by degradome sequencing. Red points are cleavage sites.
Figure 9. Phylogenetic tree constructed by target genes. The numbers indicate the bootstrap values.
To further identify the target genes, we analyzed the expression of predicted target genes under 200 mM NaCl treatment. The results showed that the expression of TRINITY_DN121689_c0_g2, TRINITY_DN122682_c1_g2 and TRINITY_DN116772_c1_g3 was downregulated to some extent; the expression of TRINITY_DN124857_c2_g2 was upregulated; and the expression of TRINITY_DN114449_ c0_g1 and TRINITY_DN95455_c0_g2 presented no significant changes (Figure 10).
Figure 10. Expression of target genes of cgr-miR166 before and after 200 mM NaCI treatment for 12 h.

3.7. Verification of the miR166 Expression Patterns Under Salt Stress by qRT-PCR

The differential expression pattern of miR166 in the leaves and roots of Chrysanthemum after salt stress was verified using stem-loop qRT-PCR. From the expression trend of miR166 after salt stress treatment, it can be seen that the expression of Chrysanthemum miR166 decreased significantly at 4 h, with a slight retracement of expression at 8 h and 12 h, but still with a large degree of downregulation relative to the untreated condition. Meanwhile, in roots, it showed a significant upregulation trend, and the expression of miR166 gradually increased with the accumulation of time. In the results of the previous high-throughput sequencing, miR166 after 12 h of salt stress presented some degree of downregulation in the leaves of Chrysanthemum, although the differential expression was not significant, whereas it was significantly upregulated in the roots. The expression pattern of miR166 in the qRT-PCR experiment was consistent with the expression trend detected by high-throughput sequencing (Figure 11), which indicated that miR166 in Chrysanthemum produced a certain response after being induced by salt stress and that the sequencing data were reliable.
Figure 11. Expression of miR166 in leaves and roots of Chrysanthemum under 200 mM NaCI treatment duration. * indicates that the difference is significant at the p < 0.05 level. ** indicates that the difference is significant at the p < 0.01 level.

3.8. Analysis of Tissue-Specific Expression

Analysis of tissue expression patterns is an effective way to understand gene functions. The expression of miR166 was detected in four tissue sites, namely the leaves, roots, stems and flowers of Chrysanthemum, using qRT-PCR, and miR166 was found to be expressed in all four tissue sites (Figure 12). Taking leaf expression as a control, the expression of miR166 in the roots of Chrysanthemum was approximately 1.23 times that in the leaves, and the expression of miR166 in the flowers was approximately 1.95 times that in the leaves. Overall, it appeared that the expression level of miR166 was relatively even in all tissue parts of Chrysanthemum, except for the stem, where the expression was approximately 7.04 times that in the leaves, indicating that the miR166 gene family might play an essential role in the stems of Chrysanthemum.
Figure 12. Expression pattern of cgr-miR166 in different tissues. * indicates that the difference is significant at the p < 0.05 level. ns is the symbols for not significant.

4. Discussion

The miR166 family is a multi-copy gene family with high conservation and several members [21] and has been found in A. thaliana [22], G. max [23], Z. mays [24] and other plants. In Chrysanthemum, there are several miRNA166 showing the conserved sequence 5′-UCGGACCAGGCUUCAUUCC-3′. Phylogeny and functional analysis of miRNA gene families play an important role in elucidating the functions of miRNA [25]. Secondary structure and MFE predictions demonstrated that the Chrysanthemum miR166 precursor sequences could form stable hairpin structures. Multiple sequence comparisons revealed that these precursor sequences were highly conserved in important functional regions (the location of the mature body), and the mature sequence formed at the 3′ end was highly conserved and higher than the 5′ end as a whole, whereas it was less conserved at the other positions of the precursor sequences. Similarly to other plants, the mature miR166 of Chrysanthemum showed the highest sequence identity as well as conservation in comparison to precursors. The miR166 mature sequences of all published plants were analyzed in this study, and once again verified the high degree of conservation at the 3′ end, and it was also found that the mature sequences of the Chrysanthemum miR166 family members remained consistent with the majority of the other plants and that the conservation of miR166 was not significantly reduced by spanning multiple species [26]. It is hypothesized that the conservation of function among different plants is maintained by the conservation of their sequences and structures [27].
Analysis of miR166 promoter elements in Chrysanthemum revealed that the upstream promoter sequences contain a variety of response elements, in addition to the typical core promoter and enhancer elements with transcriptional initiation functions, suggesting that the Chrysanthemum miR166 may be affected by multiple signaling pathways, such as light signaling, abscisic acid, ethylene, methyl jasmonate, gibberellin and auxin, and thus are involved in the response and regulation under adversity stress. miR166- and HD-ZIPIII-mediated plant growth and development are regulated by various hormones such as ABA [28] and IAA [29], which suggests that miR166 is also conserved across species in response to growth and developmental processes such as stress response and signal transduction.
Analysis of the expression patterns of Chrysanthemum miR166 in different tissue sites showed that miR166 was distributed to different degrees in the roots, stems, leaves and flowers with tissue expression specificity. miR166 might be involved in the development and metabolism of each organ and tissue of Chrysanthemum. Several studies have shown that miR166 plays a key role in the development of tissues in different plants; for example, the knockdown of the SlHB15A allele by miR166 results in a series of aberrant ovules associated with solanaceous reproduction, whereas plants carrying Slhb15a-miRNA166 develop normal ovules [30]. The shoot apical meristem (SAM) of A. thaliana is regulated by HD-ZipIII transcription factors, which are targets of miR166/165 [31]. LMBR1, a key target gene of miR166 in Lilium, regulates early embryonic cell formation [32]. In this study, the expression pattern of miR166 under salt stress was verified by stem-loop qRT-PCR, and it was found that miR166 was more sensitive in roots. miR166 members in A. thaliana respond to phytohormone signaling and mediate root development by targeting HD-ZipIII and KANADIs (KANs) [33]. It has also been demonstrated that miR166/165 dynamically regulates the SAM and flower development of A. thaliana [34].
The function of miRNAs in salt stress resistance is primarily realized through the regulation of target genes. Six potential target substrates of Chrysanthemum miR166 were identified by degradome sequencing, and it was found that TRINITY_DN121689_c0_g2, TRINITY_DN122682_c1_g2 and TRINITY_DN116772_c1_g3 were all annotated to the homeodomain leucine zipper. The phylogenetic tree constructed with the HD-ZipIII family of A. thaliana revealed that three genes were more closely related to ATHB15 and REV, respectively, and all showed reduced expression in the presence of a significant upregulation of miR166 after salt stress. Although the annotation results of the remaining three potential target genes were unclear, and they were found to have low homology with the A. thaliana HD-ZipIII family in the phylogenetic tree, and the expression of these potential target genes was not suppressed by the significant upregulation of miR166, which suggests that there may be a functional differentiation of miR166-regulated HD-ZipIII expression in Chrysanthemum. Therefore, TRINITY_DN121689_c0_g2, TRINITY_DN122682_c1_g2 and TRINITY_DN116772_c1_g3 were hypothesized to be the target genes of Chrysanthemum miR166.
As an important class of transcription factors, HD-ZipIII is precisely regulated at various levels, miRNA165/166 has been studied for its regulatory role in HD-Zip III [35]. The genome of A. thaliana contains two miR165 precursors and seven miR166 precursors, which are in near-perfect complementarity with a conserved region in a segment of the HD-ZipIII transcript of A. thaliana. The target genes of miR166 in A. thaliana are HD-ZipIII transcription factors, which consist of five members—PHABULOSA (PHB), PHAVOLUTA (PHV), REV, ATHB15 and ATHB8 [36,37].
Although miR166 is sequentially conserved across plants, its pattern of regulation is inconsistent across plants in response to salt stress. HD-ZIPIII overexpression in A. thaliana increased salt tolerance, and this may be related to the reduced expression of miR165/166 in transgenic A. thaliana [37]. In our study, salt treatment of Chrysanthemum for 12 h revealed that miR166 was significantly upregulated in Chrysanthemum under salt stress. After analyzing the changes in the expression of its predicted target genes, we found that the expression of TRINITY_DN121689_c0_g2, TRINITY_DN122682_c1_g2 and TRINITY_DN116772_c1_g3 was downregulated to some extent. A salt stress response pattern has also been observed in studies on other plants in which the expression of miR166 is upregulated and negatively correlated with the expression of its target genes. This result is consistent with the recent experimental finding in Ipomoea batatas L. showing the miR166 was up-regulated in the roots and leaves of sweet potato under salt stress conditions [38]. As well, the expression of miR166 was significantly elevated after salt treatment in S. tuberosum and peaked at 72 h of salt treatment [39]. It has also been reported that the down-regulated expression of HD-Zip transcription factor enhances salt tolerance in plants. The overexpression of ZmHDZ1 reduced tolerance to salt stress, resulting in higher malondialdehyde (MDA) accumulation and higher relative electrolyte leakage (REL) levels compared to WT plants [40]. The RNAi-silenced lines of S. lycopersicum with the HD-Zip transcription factor SlHB2 exhibited enhanced tolerance to salt stress, and the expression levels of the stress-related genes were all significantly higher than the WT plants in the RNAi lines; the results suggest that the transcription factor SlHB2 acts as a negative regulator in the salt stress signaling pathway [41]. In our study, miR166 responded in roots of Chrysanthemum under salt stress, but the specific regulatory mechanism and how it promotes root tolerance to salt stress are unclear. It has recently been shown that under salt stress conditions, a decrease in miR165/166 levels leads to an increase in PHB/PHV levels, which promotes cytokinin activity through IPT7, thus regulating root length [42,43]. Here, our study demonstrates that miR166 is a vital player in the regulation of salt tolerance in Chrysanthemum by negatively regulating target gene HD-ZIPIII.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11020141/s1, Figure S1: Growth phenotypes of Chrysanthemum before and after 200 mM NaCl treatment for 12 h; Table S1: Response to genomic DNA removal; Table S2: Compositions of reverse transcription reaction solution; Table S3: Compositions of the qRT-PCR reaction solution; Table S4: List of the qRT-PCR primer sequences; Table S5: Comparison of cis-acting elements in promoters of cgr-MIR166.

Author Contributions

D.W. performed the experiment, analyzed the data and drafted and edited the manuscript. S.W., D.Z. and Y.M. performed the experiments, analyzed the data and edited the manuscript. D.W., Y.Q. and S.F. edited the manuscript and visualized the data together. Y.Z. and Y.B. designed the experiment; provided the laboratories, instruments and equipment; edited and reviewed the manuscript; and connected with all authors and involved them in major decisions about the publication. All authors have read and agreed to the published version of the manuscript.

Funding

This work is supported by Natural Science Foundation of China (3227141149), Scientific Research Start-up Funds of Jilin Agricultural University (202023298).

Data Availability Statement

The data that support the findings of this study are available in the Supplementary Materials of this article.

Acknowledgments

We appreciate Yanmei Ma and Haihang Yu for their help in cultivating plant materials and performing the experiment for this research.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Begum, Y. Regulatory role of microRNAs (miRNAs) in the recent development of abiotic stress tolerance of plants. Gene 2022, 821, 146283. [Google Scholar] [CrossRef] [PubMed]
  2. Lee, R.C.; Feinbaum, R.L. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef]
  3. Reinhart, B.J.; Weinstein, E.G. MicroRNAs in plant. Genes. Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [PubMed]
  4. Srivastava, S.; Suprasanna, P. MicroRNAs: Tiny, powerful players of metal stress responses in plant. Plant Physiol. Bioch. 2021, 166, 928–938. [Google Scholar] [CrossRef]
  5. Islam, W.; Idrees, A. Plant responses to drought stress: microRNAs in action. Environ. Res. 2022, 215, 114282. [Google Scholar] [CrossRef]
  6. Budak, H.; Akpinar, B.A. Plant miRNAs: Biogenesis, organization and origins. Funct. Integr. Genom. 2015, 15, 523–531. [Google Scholar] [CrossRef]
  7. Gao, Z.; Nie, J. MicroRNA biogenesis in plant. Plant Growth Regul. 2020, 93, 1–12. [Google Scholar] [CrossRef]
  8. Yu, Y.; Jia, T.R. The ’how’ and ’where’ of plant microRNAs. New Phytol. 2017, 216. [Google Scholar] [CrossRef] [PubMed]
  9. Ankita, Y.; Sanoj, K. microRNA 166: An evolutionarily conserved stress biomarker in land plants targeting HD-ZIP family. Physiol. Mol. Biol. Plants 2021, 27, 2471–2485. [Google Scholar] [CrossRef]
  10. Barik, S.; SarkarDas, S. Phylogenetic analysis reveals conservation and diversification of microRNA166 genes among diverse plant species. Genomics 2014, 103, 114–121. [Google Scholar] [CrossRef]
  11. Zhang, Q.; Su, L. Analyses of microRNA166 gene structure, expression, and function during the early stage of somatic embryogenesis in Dimocarpus longan Lour. Plant Physiol. Bioch. 2020, 147, 205–214. [Google Scholar] [CrossRef] [PubMed]
  12. Zhou, C.; Yang, N. The miR166 targets CsHDZ3 genes to negatively regulate drought tolerance in tea plant (Camellia sinensis). Int. J. Biol. Macromol. 2024, 264, 130735. [Google Scholar] [CrossRef]
  13. Li, R.; Fan, T. Characterization and functional analysis of miR166f in drought stress tolerance in mulberry (Morus multicaulis). Mol. Breed. 2018, 38, 132. [Google Scholar] [CrossRef]
  14. Zhao, C.; Ma, J. Drought-triggered repression of miR166 promotes drought tolerance in soybean. Crop J. 2024, 12, 154–163. [Google Scholar] [CrossRef]
  15. Wei, H.B.; Song, Z. High temperature inhibits vascular development via the PIF4-miR166-HB15 module in Arabidopsis. Curr. Biol. 2023, 33, 3203–3214.e4. [Google Scholar] [CrossRef] [PubMed]
  16. Liu, H.; Liu, Y. Chrysanthemum × grandiflora leaf and root transcript profiling in response to salinity stress. BMC Plant Biol. 2022, 22, 240. [Google Scholar] [CrossRef]
  17. Sun, S.Y.; Wang, Y.P. Transcriptome responses to salt stress in roots and leaves of Lilium pumilum. Sci. Hortic. 2023, 309, 111622. [Google Scholar] [CrossRef]
  18. Ding, X.; Liu, B.W. A new CIPK gene CmCIPK8 enhances salt tolerance in transgenic chrysanthemum. Sci. Hortic. 2023, 308, 111562. [Google Scholar] [CrossRef]
  19. Liu, X.W.; Xia, B. Transgenic Chrysanthemum indicum overexpressing cin-miR396a exhibits altered plant development and reduced salt and drought tolerance. Plant Physiol. Biochem. 2021, 168, 17–26. [Google Scholar] [CrossRef] [PubMed]
  20. Elhiti, M.; Stasolla, C. Structure and function of homeodomain-leucine zipper (HD-Zip) proteins. Plant Signal. Behav. 2009, 4, 86–88. [Google Scholar] [CrossRef]
  21. Sam, G. The microRNA Registry. Nucleic Acids Res. 2004, 32, 109–111. [Google Scholar] [CrossRef]
  22. Zhang, L.; Zhang, C. Comprehensive high-throughput sequencing, evolutionary and functional analyses reveal the conservation and diversification of miR166s in regulating pleiotropic traits between rapeseed and Arabidopsis. Ind. Crops Prod. 2024, 218, 118817. [Google Scholar] [CrossRef]
  23. Wang, Z.; Jin, H. Evolution analysis about soybean MIR166 family. J. Northeast Agric. Univ. 2015, 22, 22–29. [Google Scholar] [CrossRef]
  24. Pan, J.K.; Li, J. Regulatory roles of microRNAs in maize growth, development and abiotic stress responses. Prog. Biochem. Biophys. 2023, 50, 277–290. [Google Scholar] [CrossRef]
  25. Shang, R.F.; Lee, S. microRNAs in action: Biogenesis, function and regulation. Nat. Rev. Genet. 2023, 24, 816–833. [Google Scholar] [CrossRef]
  26. Wang, Y.F.; Zhao, Y.H. Molecular evolution and function of MIR166 gene family in maize. J. South. Agric. 2015, 46, 1345–1349. [Google Scholar] [CrossRef]
  27. Lin, Y.L.; Zhang, Q.L. Analysis on evolutionary characteristics and the temporal and spatial expression patterns of miR166 gene family in Dimocarpus longan. Acta Hortic. Sin. 2017, 44, 2285–2295. [Google Scholar] [CrossRef]
  28. Ramachandran, P.; Augstein, F. Abscisic acid signaling activates distinct VND transcription factors to promote xylem differentiation in Arabidopsis. Curr. Biol. 2021, 31, 3153–3161. [Google Scholar] [CrossRef]
  29. Li, N.; Yang, T.X. Maize microRNA166 inactivation confers plant development and abiotic stress resistance. Int. J. Mol. Sci. 2020, 21, 9506. [Google Scholar] [CrossRef]
  30. Clepet, C.; Devani, R.S. The miR166-SlHB15A regulatory module controls ovule development and parthenocarpic fruit set under adverse temperatures in tomato. Mol. Plant 2021, 14, 1185–1198. [Google Scholar] [CrossRef]
  31. Zhu, H.; Hu, F. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell 2011, 145, 242–256. [Google Scholar] [CrossRef]
  32. Yang, Y.; Zhang, J. Dynamic changes of miR166s at both the transcriptional and post-transcriptional levels during somatic embryogenesis in Lilium. Sci. Hortic. 2020, 261, 108928. [Google Scholar] [CrossRef]
  33. Roy, S.; Singh, S. Phytohormonal crosstalk modulates the expression of miR166/165s, target Class III HD-ZIPs, and KANADI genes during root growth in Arabidopsis thaliana. Sci. Rep. 2017, 7, 3408. [Google Scholar] [CrossRef]
  34. Jung, J.H.; Park, C.M. MIR166/165 genes exhibit dynamic expression patterns in regulating shoot apical meristem and floral development in Arabidopsis. Planta 2007, 225, 1327–1338. [Google Scholar] [CrossRef]
  35. Du, Q.; Wang, H.Z. The role of HD-ZIP III transcription factors and miR165/166 in vascular development and secondary cell wall formation. Plant Signal Behav. 2015, 10, e1078955. [Google Scholar] [CrossRef]
  36. Jiang, H.; Jin, J. Genome-wide analysis of HD-Zip genes in grape (Vitis vinifera). Tree Genet. Genomes 2015, 11, 827. [Google Scholar] [CrossRef]
  37. Jia, X.; Ding, N. Functional plasticity of miR165/166 in plant development revealed by small tandem target mimic. Plant Sci. 2015, 233, 11–21. [Google Scholar] [CrossRef] [PubMed]
  38. Yang, Z.M.; Zhu, P.P. High-throughput deep sequencing reveals the important role that microRNAs play in the salt response in sweet potato (Ipomoea batatas L.). BMC Genom. 2020, 21, 164. [Google Scholar] [CrossRef]
  39. Kitazumi, A.; Kawahara, Y. Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp andigena) to salinity stress, predicted from network models in Arabidopsis. Genome 2015, 58, 13–24. [Google Scholar] [CrossRef] [PubMed]
  40. Wang, Q.; Zha, K. Functional analysis of the HD-Zip I gene ZmHDZ1 in ABA-mediated salt tolerance in rice. J. Plant Biol. 2017, 60, 207–214. [Google Scholar] [CrossRef]
  41. Hu, J.; Chen, G. Silencing of SlHB2 improves drought, salt stress tolerance, and induces stress-related gene expression in tomato. J. Plant Growth Regul. 2017, 36, 578–589. [Google Scholar] [CrossRef]
  42. Scintu, D.; Scacchi, E. microRNA165 and 166 modulate response of the Arabidopsis root apical meristem to salt stress. Commun. Biol. 2023, 6, 834. [Google Scholar] [CrossRef]
  43. Ioio, R.D.; Galinha, C. A PHABULOSA/cytokinin feedback loop controls root growth in Arabidopsis. Curr. Biol. 2012, 22, 1699–1704. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.