Identification and Expression Analysis of miR166 Gene Family in Response to Salt Stress in Chrysanthemum
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. Acquisition of Mature Sequences of miR166 Family Members
2.3. Secondary Structure Prediction of miR166 Precursors
2.4. Conservation of Sequences and Analysis of Base Preferences
2.5. Phylogenetic Analysis of Identified MIR166
2.6. Analysis of cis-Acting Elements
2.7. Prediction of Target Genes
2.8. The Expression Pattern of miR166 Under Salt Stress
2.8.1. RNA Isolation and Detection
2.8.2. Reverse Transcription
- Genomic DNA was removed, and the following mixture was prepared in an RNase-free centrifuge tube. The mixture details are listed in Table S1.
- The reaction procedure was as follows: 42 °C, 2 min.
- First-strand cDNA synthesis. The system details are listed in Table S2.
- The reaction procedure was as follows: 25 °C, 5 min; 50 °C, 15 min; 85 °C, 5 min.
2.8.3. qRT-PCR
2.9. Analysis of Tissue-Specific Expression
3. Results
3.1. Mature Sequence and Genomic Location of the miR166 Gene Family
3.2. Prediction of the Secondary Structure
3.3. Analysis of Sequence Conservation and Base Preferences
3.4. Phylogenetic Analysis of Identified MIR166
3.5. Analysis of cis-Acting Elements
3.6. Prediction of Target Genes
3.7. Verification of the miR166 Expression Patterns Under Salt Stress by qRT-PCR
3.8. Analysis of Tissue-Specific Expression
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Begum, Y. Regulatory role of microRNAs (miRNAs) in the recent development of abiotic stress tolerance of plants. Gene 2022, 821, 146283. [Google Scholar] [CrossRef] [PubMed]
- Lee, R.C.; Feinbaum, R.L. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef]
- Reinhart, B.J.; Weinstein, E.G. MicroRNAs in plant. Genes. Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, S.; Suprasanna, P. MicroRNAs: Tiny, powerful players of metal stress responses in plant. Plant Physiol. Bioch. 2021, 166, 928–938. [Google Scholar] [CrossRef]
- Islam, W.; Idrees, A. Plant responses to drought stress: microRNAs in action. Environ. Res. 2022, 215, 114282. [Google Scholar] [CrossRef]
- Budak, H.; Akpinar, B.A. Plant miRNAs: Biogenesis, organization and origins. Funct. Integr. Genom. 2015, 15, 523–531. [Google Scholar] [CrossRef]
- Gao, Z.; Nie, J. MicroRNA biogenesis in plant. Plant Growth Regul. 2020, 93, 1–12. [Google Scholar] [CrossRef]
- Yu, Y.; Jia, T.R. The ’how’ and ’where’ of plant microRNAs. New Phytol. 2017, 216. [Google Scholar] [CrossRef] [PubMed]
- Ankita, Y.; Sanoj, K. microRNA 166: An evolutionarily conserved stress biomarker in land plants targeting HD-ZIP family. Physiol. Mol. Biol. Plants 2021, 27, 2471–2485. [Google Scholar] [CrossRef]
- Barik, S.; SarkarDas, S. Phylogenetic analysis reveals conservation and diversification of microRNA166 genes among diverse plant species. Genomics 2014, 103, 114–121. [Google Scholar] [CrossRef]
- Zhang, Q.; Su, L. Analyses of microRNA166 gene structure, expression, and function during the early stage of somatic embryogenesis in Dimocarpus longan Lour. Plant Physiol. Bioch. 2020, 147, 205–214. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Yang, N. The miR166 targets CsHDZ3 genes to negatively regulate drought tolerance in tea plant (Camellia sinensis). Int. J. Biol. Macromol. 2024, 264, 130735. [Google Scholar] [CrossRef]
- Li, R.; Fan, T. Characterization and functional analysis of miR166f in drought stress tolerance in mulberry (Morus multicaulis). Mol. Breed. 2018, 38, 132. [Google Scholar] [CrossRef]
- Zhao, C.; Ma, J. Drought-triggered repression of miR166 promotes drought tolerance in soybean. Crop J. 2024, 12, 154–163. [Google Scholar] [CrossRef]
- Wei, H.B.; Song, Z. High temperature inhibits vascular development via the PIF4-miR166-HB15 module in Arabidopsis. Curr. Biol. 2023, 33, 3203–3214.e4. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Liu, Y. Chrysanthemum × grandiflora leaf and root transcript profiling in response to salinity stress. BMC Plant Biol. 2022, 22, 240. [Google Scholar] [CrossRef]
- Sun, S.Y.; Wang, Y.P. Transcriptome responses to salt stress in roots and leaves of Lilium pumilum. Sci. Hortic. 2023, 309, 111622. [Google Scholar] [CrossRef]
- Ding, X.; Liu, B.W. A new CIPK gene CmCIPK8 enhances salt tolerance in transgenic chrysanthemum. Sci. Hortic. 2023, 308, 111562. [Google Scholar] [CrossRef]
- Liu, X.W.; Xia, B. Transgenic Chrysanthemum indicum overexpressing cin-miR396a exhibits altered plant development and reduced salt and drought tolerance. Plant Physiol. Biochem. 2021, 168, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Elhiti, M.; Stasolla, C. Structure and function of homeodomain-leucine zipper (HD-Zip) proteins. Plant Signal. Behav. 2009, 4, 86–88. [Google Scholar] [CrossRef]
- Sam, G. The microRNA Registry. Nucleic Acids Res. 2004, 32, 109–111. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, C. Comprehensive high-throughput sequencing, evolutionary and functional analyses reveal the conservation and diversification of miR166s in regulating pleiotropic traits between rapeseed and Arabidopsis. Ind. Crops Prod. 2024, 218, 118817. [Google Scholar] [CrossRef]
- Wang, Z.; Jin, H. Evolution analysis about soybean MIR166 family. J. Northeast Agric. Univ. 2015, 22, 22–29. [Google Scholar] [CrossRef]
- Pan, J.K.; Li, J. Regulatory roles of microRNAs in maize growth, development and abiotic stress responses. Prog. Biochem. Biophys. 2023, 50, 277–290. [Google Scholar] [CrossRef]
- Shang, R.F.; Lee, S. microRNAs in action: Biogenesis, function and regulation. Nat. Rev. Genet. 2023, 24, 816–833. [Google Scholar] [CrossRef]
- Wang, Y.F.; Zhao, Y.H. Molecular evolution and function of MIR166 gene family in maize. J. South. Agric. 2015, 46, 1345–1349. [Google Scholar] [CrossRef]
- Lin, Y.L.; Zhang, Q.L. Analysis on evolutionary characteristics and the temporal and spatial expression patterns of miR166 gene family in Dimocarpus longan. Acta Hortic. Sin. 2017, 44, 2285–2295. [Google Scholar] [CrossRef]
- Ramachandran, P.; Augstein, F. Abscisic acid signaling activates distinct VND transcription factors to promote xylem differentiation in Arabidopsis. Curr. Biol. 2021, 31, 3153–3161. [Google Scholar] [CrossRef]
- Li, N.; Yang, T.X. Maize microRNA166 inactivation confers plant development and abiotic stress resistance. Int. J. Mol. Sci. 2020, 21, 9506. [Google Scholar] [CrossRef]
- Clepet, C.; Devani, R.S. The miR166-SlHB15A regulatory module controls ovule development and parthenocarpic fruit set under adverse temperatures in tomato. Mol. Plant 2021, 14, 1185–1198. [Google Scholar] [CrossRef]
- Zhu, H.; Hu, F. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell 2011, 145, 242–256. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, J. Dynamic changes of miR166s at both the transcriptional and post-transcriptional levels during somatic embryogenesis in Lilium. Sci. Hortic. 2020, 261, 108928. [Google Scholar] [CrossRef]
- Roy, S.; Singh, S. Phytohormonal crosstalk modulates the expression of miR166/165s, target Class III HD-ZIPs, and KANADI genes during root growth in Arabidopsis thaliana. Sci. Rep. 2017, 7, 3408. [Google Scholar] [CrossRef]
- Jung, J.H.; Park, C.M. MIR166/165 genes exhibit dynamic expression patterns in regulating shoot apical meristem and floral development in Arabidopsis. Planta 2007, 225, 1327–1338. [Google Scholar] [CrossRef]
- Du, Q.; Wang, H.Z. The role of HD-ZIP III transcription factors and miR165/166 in vascular development and secondary cell wall formation. Plant Signal Behav. 2015, 10, e1078955. [Google Scholar] [CrossRef]
- Jiang, H.; Jin, J. Genome-wide analysis of HD-Zip genes in grape (Vitis vinifera). Tree Genet. Genomes 2015, 11, 827. [Google Scholar] [CrossRef]
- Jia, X.; Ding, N. Functional plasticity of miR165/166 in plant development revealed by small tandem target mimic. Plant Sci. 2015, 233, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.M.; Zhu, P.P. High-throughput deep sequencing reveals the important role that microRNAs play in the salt response in sweet potato (Ipomoea batatas L.). BMC Genom. 2020, 21, 164. [Google Scholar] [CrossRef]
- Kitazumi, A.; Kawahara, Y. Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp andigena) to salinity stress, predicted from network models in Arabidopsis. Genome 2015, 58, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Zha, K. Functional analysis of the HD-Zip I gene ZmHDZ1 in ABA-mediated salt tolerance in rice. J. Plant Biol. 2017, 60, 207–214. [Google Scholar] [CrossRef]
- Hu, J.; Chen, G. Silencing of SlHB2 improves drought, salt stress tolerance, and induces stress-related gene expression in tomato. J. Plant Growth Regul. 2017, 36, 578–589. [Google Scholar] [CrossRef]
- Scintu, D.; Scacchi, E. microRNA165 and 166 modulate response of the Arabidopsis root apical meristem to salt stress. Commun. Biol. 2023, 6, 834. [Google Scholar] [CrossRef]
- Ioio, R.D.; Galinha, C. A PHABULOSA/cytokinin feedback loop controls root growth in Arabidopsis. Curr. Biol. 2012, 22, 1699–1704. [Google Scholar] [CrossRef]













| miRNA Gene | Mature miRNA | Gene Location |
|---|---|---|
| cgr-miR166a | UCGGACCAGGCUUCAUUCC | utg53606_pilon_pilon |
| cgr-miR166b | UCGGACCAGGCUUCAUUCC | utg34314_pilon_pilon |
| cgr-miR166c | UCGGACCAGGCUUCAUUCC | utg20850_pilon_pilon |
| cgr-miR166d | UCGGACCAGGCUUCAUUCC | utg17871_pilon_pilon |
| cgr-miR166e | UCGGACCAGGCUUCAUUCCCC | utg114989_pilon_pilon |
| cgr-miR166f | UCGGACCAGGCUUCAUUCCCC | utg60807_pilon_pilon |
| cgr-mR166g | UCGGACCAGGCUUCAUUCCCC | utg34064_pilon_pilon |
| cgr-miR166h | UCGGACCAGGCUUCAUUCCCC | utg28234_pilon_pilon |
| cgr-miR166i | UCGGACCAGGCUUCAUUCCCC | utg18595_pilon_pilon |
| cgr-miR166j | UCGGACCAGGCUUCAUUCCCC | utg10542_pilon_pilon |
| Target Genes | Annotation |
|---|---|
| TRINITY_DN121689_c0_g2 | START domain, homeodomain-like, MEKHLA, START-like domain protein |
| TRINITY_DN122682_c1_g2 | Homeobox leucine-zipper protein |
| TRINITY_DN116772_c1_g3 | Homeobox-leucine zipper family protein/lipid-binding START domain-containing protein |
| TRINITY_DN114449_c0_g1 | Hypothetical protein CTI12_AA333100 |
| TRINITY_DN95455_c0_g2 | - |
| TRINITY_DN124857_c2_g2 | Hypothetical protein CTI12_AA147430 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, D.; Wang, S.; Zhang, D.; Meng, Y.; Qian, Y.; Feng, S.; Bai, Y.; Zhou, Y. Identification and Expression Analysis of miR166 Gene Family in Response to Salt Stress in Chrysanthemum. Horticulturae 2025, 11, 141. https://doi.org/10.3390/horticulturae11020141
Wang D, Wang S, Zhang D, Meng Y, Qian Y, Feng S, Bai Y, Zhou Y. Identification and Expression Analysis of miR166 Gene Family in Response to Salt Stress in Chrysanthemum. Horticulturae. 2025; 11(2):141. https://doi.org/10.3390/horticulturae11020141
Chicago/Turabian StyleWang, Di, Shuheng Wang, Dongyang Zhang, Yuan Meng, Ying Qian, Siyu Feng, Yun Bai, and Yunwei Zhou. 2025. "Identification and Expression Analysis of miR166 Gene Family in Response to Salt Stress in Chrysanthemum" Horticulturae 11, no. 2: 141. https://doi.org/10.3390/horticulturae11020141
APA StyleWang, D., Wang, S., Zhang, D., Meng, Y., Qian, Y., Feng, S., Bai, Y., & Zhou, Y. (2025). Identification and Expression Analysis of miR166 Gene Family in Response to Salt Stress in Chrysanthemum. Horticulturae, 11(2), 141. https://doi.org/10.3390/horticulturae11020141

