A Simple and Efficient CRISPR/Cas9 System Using a Ribonucleoprotein Method for Flammulina filiformis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains and Culture Conditions
2.2. Screening for Optimum Concentration of Triton X-100 Reagent
2.3. Preparingation of sgRNA
2.4. Preparation of RNP Complex
2.5. In Vitro Cas9 Cleavage Assay
2.6. Preparation of Protoplasts
2.7. PEG-Mediated Transformation of Protoplasts
2.8. Screening and Verification of Transformants
3. Results
3.1. Effects of Different Concentrations of Triton X-100 on Protoplast Regeneration
3.2. In Vitro Cas9 Cleavage Assay
3.3. Optimization of Polyethylene Glycol (PEG)-Mediated Protoplast Transformation of RNPs in F. filiformis
3.4. Comparative Analysis of RNP-Directed Mutants and Wild-Type Strain
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, P.M.; Liu, X.B.; Dai, Y.C.; Horak, E.; Steffen, K.; Yang, Z.L. Phylogeny and species delimitation of Flammulina: Taxonomic status of winter mushroom in East Asia and a new European species identified using an integrated approach. Mycol. Prog. 2018, 17, 1013–1030. [Google Scholar] [CrossRef]
- Liu, X.; Dong, J.; Liao, J.; Tian, L.; Qiu, H.; Wu, T.; Ge, F.; Zhu, J.; Shi, L.; Jiang, A.; et al. Establishment of CRISPR/Cas9 genome-editing system based on dual sgRNAs in Flammulina filiformis. J. Fungi 2022, 8, 693. [Google Scholar] [CrossRef] [PubMed]
- Sonnenberg, A.S.M.; Baars, J.J.P.; Gao, W.; Visser, R.G.F. Developments in breeding of Agaricus bisporus var. bisporus: Progress made and technical and legal hurdles to take. Appl. Microbiol. Biotechnol. 2017, 101, 1819–1829. [Google Scholar] [PubMed]
- Tsukihara, T.; Honda, Y.; Watanabe, T.; Watanabe, T. Molecular breeding of white rot fungus Pleurotus ostreatus by homologous expression of its versatile peroxidase MnP2. Appl. Microbiol. Biotechnol. 2006, 71, 114–120. [Google Scholar] [CrossRef]
- Tu, J.L.; Bai, X.Y.; Xu, Y.L.; Li, N.; Xu, J.W. Targeted gene insertion and replacement in the basidiomycete Ganoderma lucidum by inactivation of nonhomologous end joining using CRISPR/Cas9. Appl. Environ. Microbiol. 2021, 87, e0151021. [Google Scholar] [CrossRef]
- Boontawon, T.; Nakazawa, T.; Horii, M.; Tsuzuki, M.; Kawauchi, M.; Sakamoto, M.; Honda, Y. Functional analyses of Pleurotus ostreatus pcc1 and clp1 using CRISPR/Cas9. Fungal Genet. Biol. 2021, 154, 103599. [Google Scholar] [CrossRef]
- Chen, K.L.; Wang, Y.P.; Zhang, R.; Zhang, H.W.; Gao, C.X. CRISPR/Cas genome editing and precision plant breeding in agriculture. Annu. Rev. Plant Biol. 2019, 70, 667–697. [Google Scholar] [CrossRef]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef]
- Deltcheva, E.; Chylinski, K.; Sharma, C.M.; Gonzales, K.; Chao, Y.J.; Pirzada, Z.A.; Eckert, M.R.; Jörg Vogel, J.; Charpentie, E. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 2011, 471, 602–607. [Google Scholar] [CrossRef]
- DiCarlo, J.E.; Norville, J.E.; Mali, P.; Rios, X.; Aach, J.; Church, G.M. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 2013, 41, 4336–4343. [Google Scholar] [CrossRef] [Green Version]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.B.; Jiang, W.Y.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [PubMed]
- Jin, F.J.; Wang, B.T.; Wang, Z.D.; Jin, L.; Han, P. CRISPR/Cas9-based genome editing and its application in Aspergillus species. J. Fungi 2022, 8, 467. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, H.Y.; Ma, L.; Gong, M.; Wu, Y.Y.; Bao, D.P.; Zou, G. Use of CRISPR-Cas tools to engineer Trichoderma species. Microb. Biotechnol. 2022, 1–12. [Google Scholar] [CrossRef]
- Wang, P.A.; Xiao, H.; Zhong, J.J. CRISPR-Cas9 assisted functional gene editing in the mushroom Ganoderma lucidum. Appl. Microbiol. Biotechnol. 2020, 104, 1661–1671. [Google Scholar] [CrossRef]
- Wang, T.L.; Yue, S.; Jin, Y.T.; Wei, H.; Lu, L. Advances allowing feasible pyrG gene editing by a CRISPR-Cas9 system for the edible mushroom Pleurotus eryngii. Fungal Genet. Biol. 2021, 147, 103509. [Google Scholar] [CrossRef] [PubMed]
- Qin, H.; Xiao, H.; Zou, G.; Zhou, Z.; Zhong, J.J. CRISPR-Cas9 assisted gene disruption in the higher fungus Ganoderma species. Process Biochem. 2017, 56, 57–61. [Google Scholar] [CrossRef]
- Luo, R.; Lin, J.F.; Guo, L.Q.; Ye, Z.W.; Guo, T.F.; Yun, F. Construction of Flammulina velutipes genome editing vector by using CRISPR/Cas9 system. Sci. Technol. Food Ind. 2016, 37, 230–234. [Google Scholar]
- Lin, J.D.; Yang, X.Q.; Wei, T.; Guo, L.Q.; Lin, J.F.; Chen, Y.S.; Huang, S.S. Construction and transformation of CRISPR/Cas9 genome editing vector of Flammulina filiformis G protein-coupled receptor gene. Mycosystema 2019, 38, 349–361. [Google Scholar]
- Liu, J.Y.; Liu, J.H.; Zhang, D.; Zhang, M.Y.; Xu, Z.; Wang, R.J.; Yu, H.L.; Shang, X.D. Agrobacterium-mediated gene transformation of Cas9 into Flammulina velutipes. Acta Edulis Fungi 2017, 24, 25–29. [Google Scholar]
- Ahyayauch, H.; Collado, M.I.; Alonso, A.; Goni, F.M. Lipid bilayers in the gel phase become saturated by Triton X-100 at lower surfactant concentrations thanthose in the fluid phase. Biophys. J. 2012, 102, 2510–2516. [Google Scholar] [CrossRef]
- Mattei, B.; Lira, R.B.; Perez, K.R.; Riske, K.A. Membrane permeabilization induced by Triton X-100: The role of membrane phase state and edge tension. Chem. Phys. Lipids 2017, 202, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Zou, G.; Zhou, Z. CRISPR/Cas9-mediated genome editing of Trichoderma reesei. In Trichoderma reesei: Methods and Protocols, Methods in Molecular Biology, 1st ed.; Mach-Aigner, A.R., Martzy, R., Eds.; Humana: New York, NY, USA, 2021; Volume 2234, pp. 87–98. [Google Scholar]
- Zou, G.; Xiao, M.L.; Chai, S.X.; Zhu, Z.Z.; Wang, Y.; Zhou, Z.H. Efficient genome editing in filamentous fungi via an improved CRISPR-Cas9 ribonucleoprotein method facilitated by chemical reagents. Microb. Biotechnol. 2021, 14, 2343–2355. [Google Scholar] [CrossRef] [PubMed]
- Montague, T.G.; Cruz, J.M.; Gagnon, J.A.; Church, G.M.; Valen, E. CHOPCHOP: A CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 2014, 42, W401–W407. [Google Scholar] [CrossRef] [Green Version]
- Hille, F.; Richter, H.; Wong, S.P.; Bratovic, M.; Ressel, S.; Charpentier, E. The biology of CRISPR-Cas: Backward and forward. Cell 2018, 172, 1239–1259. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.F.; Russa, M.L.; Qi, L.S. CRISPR/Cas9 in genome editing and beyond. Annu. Rev. Biochem. 2016, 85, 227–264. [Google Scholar] [CrossRef] [PubMed]
- Chai, S.X.; Zhu, Z.Z.; Tian, E.N.; Xiao, M.L.; Wang, Y.; Zou, G.; Zhou, Z.H. Building a versatile protein production platform using engineered Trichoderma reesei. ACS Synth. Biol. 2022, 11, 486–496. [Google Scholar] [CrossRef]
- Kwon, M.J.; Schütze, T.; Spohner, S.; Haefner, S.; Meyer, V. Practical guidance for the implementation of the CRISPR genome editing tool in filamentous fungi. Fungal Biol. Biotechnol. 2019, 6, 15–25. [Google Scholar] [CrossRef]
- Moon, S.; An, J.Y.; Choi, Y.J.; Oh, Y.L.; Ro, H.Y.; Ryu, H. Construction of a CRISPR/Cas9-mediated genome editing system in Lentinula edodes. Mycobiology 2021, 49, 599–603. [Google Scholar] [CrossRef]
- Boontawon, T.; Nakazawa, T.; Inoue, C.; Osakabe, K.; Kawauchi, M.; Sakamoto, M.; Honda, Y. Efficient genome editing with CRISPR/Cas9 in Pleurotus ostreatus. AMB Express 2021, 11, 30–40. [Google Scholar] [CrossRef]
- Vonk, P.J.; Escobar, N.; Wösten, H.A.B.; Lugones, L.G.; Ohm, R.A. High-throughput targeted gene deletion in the model mushroom Schizophyllum commune using pre-assembled Cas9 ribonucleoproteins. Sci. Rep. 2019, 9, 7632–7640. [Google Scholar] [CrossRef]
- Boontawon, T.; Nakazawa, T.; Xu, H.B.; Kawauchi, M.; Sakamoto, M.; Honda, Y. Gene targeting using pre-assembled Cas9 ribonucleoprotein and split-marker recombination in Pleurotus ostreatus. FEMS Microbiol. Lett. 2021, 368, fnab080. [Google Scholar] [CrossRef] [PubMed]
- Nødvig, C.S.; Nielsen, J.B.; Kogle, M.E.; Mortensen, U.H. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 2015, 10, e0133085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Sequence (5′ to 3′) |
---|---|
crRNA (56 bp) | GCGTACACAAAATCGCGAGCCUCCUUCACCUCCUCUCAUCGUUUUAGAGCUAUGCU 1 |
tracrRNA (67 bp) | AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU |
Name | Fragment Length (bp) | Sequence (5′ to 3′) |
---|---|---|
pyrG-1F | 578 | GAGACTATGGAACGCAAAA |
pyrG-1R | CCTCTGAGCGATGAAGC | |
pyrG-4F | 902 | ATGCAGTCCTACGCCGCTCG |
pyrG-4R | TCATGCTGTTCTCTCCAAGT |
Protoplasts (Cell mL−1) | 0.01% Triton X-100 | No Triton X-100 | ||
---|---|---|---|---|
CFUs | Positivity Rate (%) | CFUs | Positivity Rate (%) | |
3.5 × 104 | 0 | - | 0 | - |
3.5 × 105 | 0 | - | 0 | - |
3.5 × 106 | 2 | 100 | 0 | - |
3.5 × 107 | 5 | 100 | 0 | - |
RNPs (nM) | CFUs | Positivity Rate (%) |
---|---|---|
0 | 0 | - |
90 | 0 | - |
170 | 0 | - |
250 | 3 | 100 |
300 | 4 | 100 |
400 | 2 | 100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Cui, H.; Wang, R.; Xu, Z.; Yu, H.; Song, C.; Lu, H.; Li, Q.; Xing, D.; Tan, Q.; et al. A Simple and Efficient CRISPR/Cas9 System Using a Ribonucleoprotein Method for Flammulina filiformis. J. Fungi 2022, 8, 1000. https://doi.org/10.3390/jof8101000
Liu J, Cui H, Wang R, Xu Z, Yu H, Song C, Lu H, Li Q, Xing D, Tan Q, et al. A Simple and Efficient CRISPR/Cas9 System Using a Ribonucleoprotein Method for Flammulina filiformis. Journal of Fungi. 2022; 8(10):1000. https://doi.org/10.3390/jof8101000
Chicago/Turabian StyleLiu, Jianyu, Haiyang Cui, Ruijuan Wang, Zhen Xu, Hailong Yu, Chunyan Song, Huan Lu, Qiaozhen Li, Danrun Xing, Qi Tan, and et al. 2022. "A Simple and Efficient CRISPR/Cas9 System Using a Ribonucleoprotein Method for Flammulina filiformis" Journal of Fungi 8, no. 10: 1000. https://doi.org/10.3390/jof8101000