Next Article in Journal
Valorization of Potato Peels (Solanum tuberosum) Using Infrared-Assisted Extraction: A Novel Sprouting Suppressant and Antibacterial Agent
Next Article in Special Issue
Enabling Stable Recycling of L-Arabinose Isomerase Through Whole-Cell Immobilization for Efficient and Cost-Effective D-Tagatose Production
Previous Article in Journal
Non-Conventional Brewers’ Spent Grains, an Alternative Raw Material in Bread-Making
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Functional Characterization of the 6-Phosphogluconate Dehydratase Operon in 2-Ketogluconic Acid Industrial Producing Strain Pseudomonas plecoglossicida JUIM01

1
School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013, China
2
Jiangxi Provincial Engineering and Technology Center for Food Additives Bio-Production, Shangrao 334221, China
3
Key Laboratory of Elemene Class Anti-Cancer Medicines, School of Pharmacy, Hangzhou Normal University, Hangzhou 311121, China
*
Authors to whom correspondence should be addressed.
Foods 2024, 13(21), 3444; https://doi.org/10.3390/foods13213444
Submission received: 1 October 2024 / Revised: 20 October 2024 / Accepted: 26 October 2024 / Published: 28 October 2024
(This article belongs to the Special Issue Advances in Food Biotechnology and Enzyme Engineering)

Abstract

:
Genus Pseudomonas bacteria mainly consume glucose through the Entner–Doudoroff (ED) route due to a lack of a functional Embden–Meyerhof–Parnas (EMP) pathway. In the present study, a 6-phosphogluconate dehydratase (edd) operon in the ED route was well investigated to find its structural characteristics and roles in the regulation of glucose consumption and 2-ketogluconic acid (2KGA) metabolism in the industrial 2KGA-producer P. plecoglossicida JUIM01. The edd operon contained four structural genes of edd, glk, gltR, and gtrS, encoding 6-PG dehydratase Edd, glucokinase Glk, response regulatory factor GltR, and histidine kinase GtrS, respectively. A promoter region was observed in the 5′-upstream of the edd gene, with a transcriptional start site located 129 bp upstream of the edd gene and in a pseudo-palindromic sequence of 5′-TTGTN7ACAA-3′ specifically binding to the transcription factor HexR. The knockout of the edd gene showed a remarkably negative effect on cell growth and re-growth using 2KGA as a substrate, beneficial to 2KGA production, with an increase of 8%. The deletion of glk had no significant effect on the cell growth or glucose metabolism, while showing an adverse impact on the 2KGA production, with a decrease of 5%. The outputs of the present study would provide a theoretical basis for 2KGA-producer improvement with metabolic engineering strategies and the development and optimization of P. plecoglossicida as the chassis cells.

1. Introduction

2-Ketogluconic acid (2KGA) is a noncorrosive organic acid (pKa = 2.66) with multiple uses, like as a calcium-enriched feed additive, cement plasticizer, cement retarder, and detergent [1,2]. 2KGA is also utilized as a building block for the synthesis of heterocyclic compounds and stereoselective or regioselective chemicals. The most important application of 2KGA is in the food industry as an intermediate for the production of GRAS (generally recognized as safe) antioxidant D-isoascorbic acid (E315-free acid and E316-sodium salt) to maintain food color/flavors and block the formation of ammonium nitrite (carcinogenic) during food processing [3,4].
The genus Pseudomonas bacteria have the glucose oxidation system located in the periplasmic space, which is mainly composed of membrane-bound pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (Gcd) and FAD-dependent gluconate dehydrogenase (Gad). The Gcd and Gad successively oxidize glucose to gluconic acid and gluconic acid to 2KGA in the periplasmic space [5,6,7,8]. Most interestingly, members of the genus Pseudomonas show significant adaptation, survival, and persistence capacities in response to environmental cues and stresses, which are beneficial for their industrial processes [9,10,11,12,13]. Pseudomonas bacteria have a specific glucose phosphorylation system that generates 6-phosphogluconate from glucose via three parallel pathways [14,15]. Glucose, gluconate, and 2KGA in the periplasmic space could be transported into the cell cytoplasm by the specific corresponding ATP-dependent transporters [16]. Generally, glucose enters the cell cytosol through an ABC transporter and is phosphorylated to glucose-6-phosphate by glucokinase (Glk), then further converted to 6-phosphogluconate (6-PG) via the sequential activity of glucose-6-phosphate-dehydrogenase (Zwf) and 6-phosphogluconolactonase (Pgl). The second pathway involves the transport of gluconic acid by gluconate permease (GntP), following the direct phosphorylation of gluconic acid to 6-PG mediated by gluconokinase (GnuK), and the third pathway, also called the 2KGA loop, involves the transport of 2KGA via 2-ketogluconate transporter (KguT) into cytosol, phosphorylation to 2-keto-6-phosphogluconate (2K6PG) via 2KGA kinase (KguK), and conversion into 6-PG via 2K6PG reductase (KguD). The absence of 6-phosphofructo-1-kinase (Pfk) in the genus Pseudomonas leads to the incomplete Embden–Meyerhof–Parnas pathway (EMP pathway). Hence, the glucose metabolism in genus Pseudomonas usually utilizes the ED-EMP route [14,15,16,17,18,19], which includes the Entner–Doudoroff pathway (ED pathway), pentose phosphate pathway (PP pathway), and partial EMP pathway (Figure 1). The metabolic flux analysis proved that over 90% of the consumed sugar was converted as 6-phosphogluconate in P. putida KT2440, which was further consumed in the ED pathway to 2-keto-3-deoxy-6-phosphogluconate (KDPG) by 6-PG dehydratase (Edd), further split by KDPG aldolase (Eda) into two trioses, pyruvate (Pyr) and glyceraldehyde-3-P (Glc-3-P), for further metabolism [16,20,21]. Less than 10% of 6-phosphogluconate entered the PP pathway, proving that the ED pathway plays the predominant role in glucose uptake in the genus Pseudomonas [19,21].
The transcriptional regulation of the ED pathway has been well investigated in P. putida and P. aeruginosa. The operon edd/glk/gltR/gtrS in P. putida contains four structure genes encoding proteins Edd, Glk, GtrS, and GltR, respectively, while the other operon zwf/pgl/eda had three structure genes encoding proteins Zwf, Pgl, and Eda, respectively [20,22]. Among them, GtrS and GltR form a two-component regulatory system (TCS) [23]. TCSs play crucial roles in bacterial adaptation to environments. It has been shown that many TCSs are involved in antibiotic resistance and the virulence of Gram-negative pathogens, such as Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa [24]. Since the Edd and Eda are the typical enzymes in the ED pathway [14], the edd/glk/gltR/gtrS operon and zwf/pgl/eda operon in the present context were nominated as the edd operon and eda operon, respectively. The pseudo-palindromic consensus sequences of 5′-TTGTN7–8ACAA-3′ in the promoters of the edd operon and the eda operon specifically bind the transcriptional regulator of HexR to control the transcriptional expression of the operons [18]. KDPG is the specific effector molecule of HexR, meaning that KDPG is the molecular inducer of edd and eda operons to activate the transcription of target genes by binding the sugar isomerase-like binding (SIS) domain at their C-terminal extension of HexR [25].
The edd operon is one of the key operons involved in glucose metabolism in the genus Pseudomonas participating in the transport, metabolism, and regulation of glucose [23]. However, the publications related to the edd operon are available in P. aeruginosa [18,26] and P. putida [22,27]. P. plecoglossicida JUIM01 is a biosafe 2KGA producer with high yield and has been applied in industrial production for over ten years, while its resistance (for example, tolerance to high temperature and high concentrations of 2KGA and substrate glucose) and production efficiency still need to be further improved [28]. Hence, the present study would focus on elucidating the structural characteristics, function, and expression regulation of the edd operon of P. plecoglossicida JUIM01, and analyzing the relationship between the edd operon and the 2KGA metabolic pathway to provide a theoretical basis for the improvement of 2KGA producers using the metabolic regulation strategies.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, Media, and Growth Conditions

Bacterial strains and plasmids used in this study are listed in Table S1. E. coli JM109 and DH5α were used in the present study and grown in LB medium at 37 °C for cloning and storing constructed plasmids. P. plecoglossicida JUIM01 is an industrial 2KGA-producing strain screened and stored in our laboratory [28,29]. P. plecoglossicida cells were activated on the media containing 10 g/L peptone, 5 g/L beef extract, 5 g/L NaCl, and 20 g/L agar at pH 7.0. The activated cells were inoculated into the 50 mL of seed media consisting of 20 g/L glucose, 5 g/L corn syrup powder, 2 g/L urea, 2 g/L KH2PO4, 0.5 g/L MgSO4·7H2O, and 5 g/L CaCO3 at pH 7.0 in the 500 mL Erlenmeyer flask and cultivated at 33 °C and 265 rpm for 20 h to harvest the seed. The 2KGA fermentation was conducted by inoculating 10% (v/v) of the seed into the 40 mL of fermentation media containing 180 g/L glucose, 10 g/L corn syrup powder, and 45 g/L CaCO3 in the 500 mL Erlenmeyer flask and cultivating it at 33 °C and 265 rpm.

2.2. Bioinformatics Analysis of the Edd Operon from P. plecoglossicida JUIM01

The plasmids used in the present study were listed in Table S2. P. plecoglossicida JUIM01 genome DNA was extracted using a Bacteria Genomic DNA Kit (TIANGEN, Tianjin, China). The edd operon gene was cloned using the extracted genome DNA as the template and the pairs of primers edd-P1/P2 by long and accurate polymerase chain reaction (LA-PCR). The cloned product was sequenced by Sangon Biotech Co. (Shanghai, China).
The promoter and structural genes and their positions of edd operon were predicted by using online ORF Finder (https://https.ncbi.nlm.nih.gov/orffinder/, accessed on 31 October 2022) and BPROM (http://www.softberry.com/, accessed on 24 April 2023). NCBI Protein BLASTn (https://www.ncbi.nlm.nih.gov/, accessed on 31 October 2022) was used to align the structural gene-encoded amino acid sequences in the edd operon [30]. Pfam online software (http://pfam.xfam.org/search/sequence, accessed on 16 January 2023) and Phobiusonline software (http://phobius.sbc.su.se/, accessed on 16 January 2023) were used to analyze protein domains, transmembrane structure, and predicted signal peptides [31,32].

2.3. Co-Transcription Assay of Structural Genes in the Edd Operon

P. plecoglossicida cells were collected after cultivating in seed media for 12–14 h at 32 °C and 265 rpm. The total RNA was extracted and purified using the bacteria total RNA extraction kit and RNase-free DNA removal kit (Sangon Biotech, Shanghai, China). The cDNA was prepared by reverse transcription using a FastKing RT Kit (with gDNase) (TIANGEN, Tianjin, China). The co-transcriptions of edd, glk, gltR, and gtrS were checked using the designated primers of G1/G2, G3/G4, and G5/G6 (Table S2) to clone the transgene fragments of glk-gltR, edd-gltR, and edd-gtrS with P. plecoglossicida JUIM01 genome DNA (positive), DI water (negative), and cDNA as the templates.

2.4. Promoter Fusion and β-Galactosidase Activity Assay

Based on the predicted sequence of the promoter region in the edd operon, a fragment of the gapA-edd complex region containing the 40 bp terminal homologous sequence of the linearized pME6522 was amplified using E1/E2 as primers, and the gene fragment was digested with restriction endonucleases Pst I and EcoR I. The seamless clone was used to ligate the purified target fragment with the linearized pME6522 to obtain the recombinant promoter probe plasmid pME6522-edd containing the fused sequence of the upstream fragment of edd and lacZ reporter gene in the promoter probe. The pME6522-edd and pME6522 were electro-transferred into P. plecoglossicida competent cells to generate the positive transformants of JUIM01/pME6522-edd and JUIM01/pME6522, respectively. The JUIM01/pME6522-edd and JUIM01/pME6522 strains were cultured in the LB media containing 20 g/L of glucose and 10 μg/mL of tetracycline at 32 °C and 200 r/min. The cell density (OD600 nm) at 12 h and 24 h were determined. The β-galactosidase activity of JUIM01/pME6522 and JUIM01/pME6522-edd cells at 12 h and 24 h was determined using the β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer (Promega, Madison, WI, USA). The β-galactosidase activity was calculated as follows:
Miller   units = 1000   ×     ( OD 420     OD 550 × 1.75 ) T   ×   V   ×   OD 600
Herein, T represented the reaction time (min), V represented the sample volume added in the reaction system (mL), and OD600 represented the absorbance of cell density at 600 nm. In comparison, OD420 and OD550 represented the absorbance at 420 nm and 550 nm after reaction, respectively.

2.5. 5-Rapid Amplification of cDNA Ends (5′-RACE)

The transcription start site (TSS) of the edd operon was determined using a 5′-RACE kit (Sangon Biotech, Shanghai, China) with the primers shown in Table S3. Using RT1/RT2 as primers, the cDNA was synthesized by reverse transcription using the total RNA of P. plecoglossicida JUIM01 as the template and digested by RNase H-, and a poly-C tail was added using deoxynucleotidyl transferase (TDT). The second-run PCR was conducted using cDNA and the above PCR product as the templates and NR1/adaptor and NR2/outer as the primers. The second-run PCR product was added a poly-A tail and ligated with pMD20-T to construct the plasmid pMD20-T-E. The constructed plasmid pMD20-T-E was transferred to E. coli JM109 to screen the positive transformants with LB plates containing 50 μg/mL ampicillin for further sequencing.

2.6. Construction of the Structural Gene-Deficient Strains and Corresponding Gene-Complemented Strains

The plasmid pK18mobsacB was used for the construction of a series of P. plecoglossicida JUIM01 mutants deficient with the structural genes of edd, glk, gltR, and gtrS in the edd operon using two-step homologous recombination [29]. Briefly, using the genomic DNA of P. plecoglossicida JUIM01 as a template, the upstream and downstream fragments of the structural genes of edd, glk, gltR, and gtrS were amplified using the primers of R1/R2 and R3/R4 (Tables S1 and S2), respectively. These corresponding upstream and downstream fragments of edd, glk, gltR, and gtrS were used as the templates and fused using Touchdown PCR using R1/R4 as primers to obtain the fused fragments of Δedd, Δglk, ΔgltR, and ΔgtrS, respectively.
Since the primers R1/R4 of Δglk contained the homogenous sequence of the suicide plasmid pK18mobsacB [29], the plasmid pK18Δglk was constructed by ligating the Δglk fragment with linearized pK18mobsacB using the seamless cloning method. Similarly, suicide plasmids of pK18Δedd, pK18ΔgltR, and pK18ΔgtrS were constructed by inserting the cloned Δedd, ΔgltR, and ΔgtrS fragments into the BamH I and Hind III restriction sites of pK18mobsacB, respectively, since the primers R1/R4 of Δedd, ΔgltR, and ΔgtrS fragments contained the BamH I and Hind III restriction sites. These suicide plasmids of pK18Δedd, pK18Δglk, pK18ΔgltR, and pK18ΔgtrS were electro-transformed into P. plecoglossicida competent cells, which resulted in the first recombination. The selected colonies were cultivated for 18 h in a non-selective LB medium and subjected to the second recombination. Subsequently, an appropriate amount of the LB culture was plated onto LB agar containing 10% (w/v) sucrose to select edd-, glk-, gltR-, or gtrS-deleted strains. The modified genotype was investigated by PCR analysis, and the positively identified strain was named JUIM01Δedd, JUIM01Δglk, JUIM01ΔgltR, and JUIM01ΔgtrS, respectively.
The plasmid pBBR1MCS-2 was used for the construction of edd-, glk-, gltR-, or gtrS-complemented mutants [29]. Based on the primers R5/R6 containing the Hind III and BamH I restriction sites (Table S2), the edd, glk, gltR, and gtrS genes were amplified with the genomic DNA of P. plecoglossicida JUIM01 as the template, respectively. The PCR products and pBBR1MCS-2 were digested with Hind III and BamH I and ligated to obtain pBBRedd, pBBRglk, pBBRgltR, and pBBRgtrS, respectively. These plasmids were electro-transformed into JUIM01Δedd, JUIM01Δglk, JUIM01ΔgltR, and JUIM01ΔgtrS cells, respectively, and the complemented mutants JUIM01Δedd-edd, JUIM01Δglk-glk, JUIM01ΔgltR-gltR, and JUIM01ΔgtrS-gtrS were finally obtained after screening on the selective plates containing 25 μg/mL of kanamycin for sequencing.

2.7. Analytical Methods

The cell growth during seed culture and 2KGA fermentation was represented by optical density at 650 nm (OD650 nm) using a Biospec-1601 spectrophotometer (Shimadzu, Japan) or the dry cell weight (DCW) computed from a curve relating OD650 nm to DCW. An OD650 nm of 1.0 represents 0.575 g dry cell weight per liter. Glucose concentration was determined with a Biosensor Analyzer (Shandong Academy of Sciences Institute of Biology, Jinan, China) at 25 °C. The concentration of 2KGA was determined and calculated based on glucose concentration using the Polarimetry method developed by our group [33]. The determining procedure was described briefly as follows: a sample of cultured broth was first centrifuged at 4000 r/min for 20 min, and 25 mL of resulting supernatant was mixed with 20 mL of deionized water, adjusted to pH of 1.5 by adding 1 M HCl, and then diluted to 100 mL with deionized water. The final sample solution’s optical rotation degree was determined with a WZZ-1SS Digital Automatic Polarimeter (Precision Instrument Co., Ltd., Shanghai, China). The 2KGA concentration was calculated with the following Equation (2):
Y = −0.88 X1 + 0.5275 X2
X1 and X2 represented 2KGA and glucose concentrations, (g/L), respectively. Y represented optical rotation degree (°). Coefficients −0.88 and 0.5275 represented the optical rotation degree of 10.0 g/L of 2KGA and 10.0 g/L of glucose, respectively.

2.8. Statistical Analysis

All experiments were performed in three replicates. The data were expressed as the mean ± standard deviation (n = 3). The data sets were evaluated by one-way analysis of variance (ANOVA). Statistical comparisons were made based on the P value (α = 0.05 and 0.01).

3. Results and Discussion

3.1. Identification of Structural Genes in the Edd Operon of P. plecoglossicida JUIM01

A 6591 bp edd operon was cloned using a pair of primers of P1 and P2 from P. plecoglossicida JUIM01. The edd operon contained five open reading frames (ORFs). ORF1 showed an opposite transcript direction with other ORFs (ORFs 2–5) (Figure 2A and Table 1). ORF1, with an entire length of 1002 bp, encoded a hydrophilic protein containing 1781 amino acid residues localized to the cytoplasm, sharing 100% homology with that of glyceraldehyde-3-phosphate dehydrogenase (catalyzing glyceraldehyde-3-phosphate to 1,3-diphosphate glycerate) of P. putida, proving that the ORF1 gene should be classified as the gapA encoding glyceraldehyde-3-phosphate dehydrogenase. The 1827 bp ORF2 located at the 265 bp upstream of gapA and encoded a 65.28 kDa hydrophilic protein consisting of 608 amino acid residues, sharing over 99% homology with those of Edds (catalyzing 6-PG to 2K6PG) in P. putida and P. guariconensis. ORF3 had a full length of 960 bp with 4 bp (ATGA) of overlap with that of ORF2 and encoded a 33.59 kDa hydrophobic protein localized to the cytoplasm sharing over 99% of homology with those of Glks (catalyzing glucose to glucose-6-phosphate) in P. putida and Pseudomonas sp. p1 (2021b). ORF4 was located at 86 bp downstream of ORF3 with an entire length of 726 bp and encoded a 27.27 kDa hydrophilic protein containing 241 amino acid residues localized to the cytoplasm, sharing 98% homology with a response regulatory factor (GltR) in P. putida and Pseudomonas sp. p1 (2021b). The 1455 bp ORF5 had a 20 bp overlap (ATGTCTGCCCGGCCTGCTGA) with its upstream of ORF4 and encoded a 54.15 kDa transmembrane hydrophobic protein composed of 484 amino acid residues, sharing 98% homology with a sensor histidine kinase (GtrS) in P. putida and Pseudomonas sp. p1 (2021b). ORF5 had two transmembrane helices (TMHs) at 18–40 residues and 210–228 residues, with an extra-membrane region at 210–228 residues. GtrS and GltR form a two-component regulatory system (TCS), GtrS-GltR, which regulates glucose metabolism and transport, and the expression of toxA encoding exotoxin A in P. aeruginosa [23].

3.2. Co-Transcription of Structural Genes in the Edd Operon

Since there are overlaps between edd with glk and gltR with gtrS, the promoters should not exist with edd-glk and gltR-gtrS. On this basis, the transgene regions between glk with gltR, edd with gltR, and edd with gtrS were amplified using G1/G2, G3/G4, and G5/G6 as primers, and cDNA and gDNA of P. plecoglossicida JUIM01 and ddH2O as templates, respectively, to verify the co-transcription of these structural genes in the edd operon. As shown in Figure 2B, no cloned bands were observed when using ddH2O as templates. The cloned glk-gltR, edd-gltR, and edd-gtrS showed identical 247 bp, 1307 bp, and 1901 bp bands on the agarose gel when using the cDNA and gDNA of P. plecoglossicida JUIM01 as templates, supporting the idea that edd, glk, gltR, and gtrS belonged to the structural genes of the edd operon and showed a co-transcription pattern, which was similar with the edd operon in P. putida [22]. Moreover, the structure of the edd operon may be a common characteristic among Pseudomonas species [34].

3.3. Identification of the Promoter Region of the Edd Operon

The promoter region of the edd operon in P. plecoglossicida JUIM01 was predicted using the online software BPROM (https://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb, accessed on 24 April 2023). As shown in Figure 3A, the −10 region in edd operon with the sequence of CAGTATTTT was the RNA polymerase binding site, and the −35 region of TAGAAA was the recognition site of RNA polymerase σ factor. The transcriptional start site (+1) was located at 129 bp upstream of the edd gene and in a pseudo-palindromic sequence of TTGTN7ACAA, which specifically bound to the transcription factor HexR [34]. Additionally, another pseudo-palindromic sequence of TTGTN10ACAA was also observed in the promoter region with potential roles to regulate the transcription of gapA.
On the basis of the predicted promoter region, a 287 bp fragment upstream of the edd gene was cloned and fused with lacZ reporter in the promoter probe vector pME6522 to construct the pME6522-edd (Figure S1) and the corresponding mutants of JUIM01/pME6522 and JUIM01/pME6522-edd. As shown in Figure 3B,C, mutant JUIM01/pME6522 and JUIM01/pME6522-edd cells showed the same growth trend and amount after 12 h and 24 h cultivation, while the produced β-galactosidase activities of JUIM01/pME6522-edd cultivated at 12 h and 24 h were 1.6 and 6.88 times those of JUIM01/pME6522, respectively. Hence, it could be proven that a promoter region was located 5′-upstream of the edd gene, and edd, glk, gltR, and gtrS genes should belonged to the structural genes of the edd operon. The transcriptional start site was confirmed 129 bp upstream of the translation initiation site of the edd gene with the first base, C (Figure 3D), in consistency with the previous prediction.

3.4. The Roles of the Structural Genes of the Edd Operon in 2KGA Metabolism

The structural gene-knocked mutants of JUIM01Δedd, JUIM01Δglk, JUIM01ΔgltR, and JUIM01ΔgtrS (Figure S6) and their complemented strains of JUIM01Δedd-edd, JUIM01Δglk-glk, JUIM01ΔgltR-gltR, and JUIM01ΔgtrS-gtrS (Figure S8) were constructed, respectively, to elucidate the roles of edd, glk, gltR, and gtrS genes in the 2KGA metabolism of P. plecoglossicida JUIM01. Figure 4A–D present the differences in the cell growth and 2KGA metabolism of the parent strain P. plecoglossicida JUIM01 and the structural gene-knocked and complemented strains when using 20 g/L of glucose as the sole carbon source. The knockout of glk, gltR, or gtrS had no significant changes in glucose utilization, cell growth, 2KGA synthesis and consumption, or pH levels in broth. Interestingly, the deletion of edd and the complementation of edd to the JUIM01Δedd strain benefited the glucose consumption rates of over 1.8 g/L/h, which increased by 20% compared to the parent strain. The edd-knocked strain JUIM01Δedd showed a high 2KGA production efficiency of the produced 2KGA concentration of 18.2 g/L and could not use the produced 2KGA as the sole carbon source (Figure 4E,F). The deletion of edd resulted in a remarkable reduction in cell concentration and growth rate with the maximum cell concentration of 2.35 g/L (OD650 nm = 4.08) compared to those of the parent strain with the maximum cell concentration of 8.56 g/L (OD650 nm = 14.89). Corresponding to an efficient 2KGA production performance, the pH of JUIM01Δedd broth also showed a significant difference from that of JUIM01.
Generally, 6-PG dehydratase encoded (Edd) by the edd gene is a key enzyme in the ED pathway. Not only in glucose metabolism, Edd also plays an important role in glycerol utilization and the biofilm phenotypes and virulence of P. aeruginosa, and it contributes to root colonization and the induction of the systemic resistance of Pseudomonas chlororaphis [19,35]. The edd-deletion in P. putida resulted in a block of glucose utilization via the ED pathway and led to the readjustment of the metabolic pathway to produce fructose 6-phosphate and a decrease in the cell growth rate [36]. Actually, the decreased cell concentration and growth rate originated from the inability of the genus Pseudomonas to utilize the produced 2KGA as the carbon source for 2nd-run growth. del Castillo et al. had revealed that the knockout of glk significantly decreased the growth rate of P. putida KT2440 by 26.7% compared to the parent strain [20]. However, in the present study, the deletion of glk had no significant effect on the cell growth of P. plecoglossicida JUIM01, indicating that the glucose phosphorylation catalyzed by glucokinase (Glk) was dispensable to the cell growth. The existed references have proven that the 6-PG produced from the direct phosphorylation of glucose accounts for 14–17% of the synthesized 6-PG in the glucose metabolic pathway [16], indicating the significant importance of the phosphorylation of gluconic acid and 2KGA for P. plecoglossicida growth.

3.5. Production Performance of P. plecoglossicida JUIM01 and Its Mutant Strains

The 2KGA production performances of P. plecoglossicida JUIM01; gene-knocked mutants of JUIM01Δedd, JUIM01Δglk, JUIM01ΔgltR, and JUIM01ΔgtrS; and their complemented strains of JUIM01Δedd-edd, JUIM01Δglk-glk, JUIM01ΔgltR-gltR, and JUIM01ΔgtrS-gtrS were compared with a high C/N ratio media containing 180 g/L glucose (Table 2). As summarized in Table 2, JUIM01 and mutants had no significant differences in glucose consumption or cell growth, while there were differences in 2KGA production. The JUIM01Δedd strain had the highest 2KGA concentration of 166.0 g/L and yield of 1.0 g/g (over 95.0% of the theoretical yield), increased by 8.38% compared to JUIM01, the underlying mechanism of which remains to be elucidated. Interestingly, unlike the significant difference in cell growth during seed culture, the edd knockout only resulted in a 3.5% decrease in the maximum cell concentration of JUIM01 during 2KGA fermentation. This probably was because of the higher initial glucose and C/N ratio in the fermentation medium, but it still needs further investigation. JUIM01Δglk showed a 5.2% decrease in the 2KGA concentration of 145.2 g/L and yield of 0.9 g/g (83.2% of the theoretical yield). In addition, the gene complementation could convert the gene-knockout mutants’ 2KGA production performance back into a similar level of the wild-type strain JUIM01.

4. Conclusions

The edd operon of the industrial 2KGA-producer P. plecoglossicida JUIM01 was extensively characterized using reverse transcription PCR, promoter fusion, and 5′-RACE and analyzing the roles of each structural genes in the synthesis and metabolism of 2KGA for the first time. The obtained results proved that the edd operon of P. plecoglossicida JUIM01 contained four structural genes of edd, glk, gltR, and gtrS, encoding 6-PG dehydratase, glucokinase, response regulatory factor GltR, and histidine kinase GtrS, respectively. GtrS and GltR formed a two-component regulatory system of GtrS-GltR. A promoter region was observed in the 5′ upstream of the edd gene, with a transcriptional start site located 129 bp upstream of the edd gene and in a pseudo-palindromic sequence of TTGTN7ACAA, which specifically bound to the transcription factor HexR. The deletion of gltR or gtrS had no significant effect on the cell growth, glucose consumption, or 2KGA metabolism of P. plecoglossicida JUIM01. The knockout of edd showed a remarkably negative effect on cell growth and re-growth using 2KGA as a substrate. However, it benefited 2KGA production, with an increase of over 8% compared to JUIM01. The deletion of glk had no significant effect on cell growth or glucose metabolism while showing an adverse impact on 2KGA production, with a decrease of 5%. The outputs of the present study would provide a theoretical basis for 2KGA-producer improvement with metabolic engineering strategies and the development and optimization of P. plecoglossicida as the chassis cells.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/foods13213444/s1; Table S1: Bacterial strains and plasmids used in this study; Table S2: Primers used in this study; Table S3: Primers used in 5′-rapid amplification of cDNA ends; Figure S1: The recombinant plasmid pME6522-edd was verified through the digestion of the gene fragment with Pst I and EcoR I. Lane M, 15,000 bp molecular weight marker; lane 1, the double enzyme digestion products of the recombinant plasmid pME6522-edd; Figure S2: Obtaining the incomplete edd gene fragment with the upstream and downstream of the edd gene. Lane M, 2000 bp molecular weight marker; lane 1, the upstream fragment of the edd gene; lane 2, the downstream fragment of the edd gene; lane 3, using edd-R1/edd-R4 as primers, an incomplete edd fragment with the upstream and downstream of the edd gene obtained through the fusion of the upstream and downstream fragments of the edd gene. Figure S3: Obtaining the incomplete glk gene fragment with the upstream and downstream of the glk gene. Lane M, 2000 bp molecular weight marker; lane 1, the upstream fragment of the glk gene; lane 2, the downstream fragment of the glk gene; lane 3, using glk-R1/glk-R4 as primers, an incomplete glk fragment with the upstream and downstream of the glk gene obtained through the fusion of the upstream and downstream fragments of the glk gene. Figure S4: Obtaining the incomplete gltR gene fragment with the upstream and downstream of the gltR gene. Lane M, 2000 bp molecular weight marker; lane 1, the upstream fragment of the gltR gene; lane 2, the downstream fragment of the gltR gene; lane 3, using gltR-R1/gltR-R4 as primers, an incomplete gltR fragment with the upstream and downstream of the gltR gene obtained through the fusion of the upstream and downstream fragments of the gltR gene. Figure S5: Obtaining the incomplete gtrS gene fragment with the upstream and downstream of the gtrS gene. Lane M, 2000 bp molecular weight marker; lane 1, the upstream fragment of the gtrS gene; lane 2, the downstream fragment of the gtrS gene; lane 3, using gtrS-R1/gtrS-R4 as primers, an incomplete gtrS fragment with the upstream and downstream of the gtrS gene obtained through the fusion of the upstream and downstream fragments of the gtrS gene. Figure S6: The colony PCR verification of the gene-deletion strains. Lane M, 5000 bp molecular weight marker; lane 1, a PCR fragment with edd-R1/edd-R4 as primers and the wild-type strain JUIM01 as the template; lane 2, edd-knockout strain JUIM01Δedd; lane 3, a PCR fragment with glk-R1/glk-R4 as primers and the wild-type strain JUIM01 as the template; lane 4, glk-knockout strain JUIM01Δglk; lane 5, a PCR fragment with gltR-R1/gltR-R4 as primers and the wild-type strain JUIM01 as the template; lane 6, gltR-knockout strain JUIM01ΔgltR; lane 7, a PCR fragment with gtrS-R1/gtrS-R4 as primers and the wild-type strain JUIM01 as the template; lane 8, gtrS-knockout strain JUIM01ΔgtrS. Figure S7: The identification of the recombinant plasmids by single and double restriction endonuclease digestion. Lane M, 15,000 bp molecular weight marker; lane 1, the recombinant plasmid pBBRedd was digested by BamH I; lane 2, the recombinant plasmid pBBRedd was digested by BamH I and Hind III; lane 3, the recombinant plasmid pBBRglk was digested by BamH I; lane 4, the recombinant plasmid pBBRglk was digested by BamH I and Hind III; lane 5, the recombinant plasmid pBBRgltR was digested by BamH I; lane 6, the recombinant plasmid pBBRgltR was digested by BamH I and Hind III; lane 7, the recombinant plasmid pBBRgtrS was digested by BamH I; lane 8, recombinant plasmid pBBRgtrS was digested by BamH I and Hind III. Figure S8: The colony PCR verification of the gene-complemented strains. Lane M, 2000 bp molecular weight marker; lane 1, a PCR fragment with edd-1/edd-2 as primers and the wild-type strain JUIM01 as the template; lane 2, the edd-complemented strain JUIM01Δedd-edd; lane 3, a PCR fragment with glk-1/glk-2 as primers and the wild-type strain JUIM01 as the template; lane 4, the glk-complemented strain JUIM01Δglk-glk; lane 5, a PCR fragment with gltR-1/gltR-2 as primers and the wild-type strain JUIM01 as the template; lane 6, the gltR complemented strain JUIM01ΔgltR-gltR; lane 7, a PCR fragment with gtrS-1/gtrS-2 as primers and the wild-type strain JUIM01 as the template; lane 8, the gtrS complemented strain JUIM01ΔgtrS-gtrS.

Author Contributions

W.-J.S., D.-M.W. and L.S.: Conceptualization, Writing—Reviewing and Editing, Supervision, Project administration, and Funding acquisition; Q.-N.Z.: Investigation; L.-L.L.: Investigation; M.-X.Q.: Investigation; X.-Y.Z.: Editing; F.-J.C.: Review and editing; Q.Z.: Conceptualization, Supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by funding from the Natural Science Foundation of China (32272286, 32201995) and Natural Science Foundation of Jiangsu Province (BK20220526), the Joint Funds of Natural Science Foundation of Zhejiang Province (LHZSZ24H280002), and the Scientific Research Fund of Zhejiang Provincial Education Department (Y202250010 and Y202353616).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Chia, M.; Nguyen, T.B.V.; Choi, W.J. DO-stat fed-batch production of 2-keto-D-gluconic acid from cassava using immobilized Pseudomonas aeruginosa. Appl. Microbiol. Biotechnol. 2008, 78, 759–765. [Google Scholar] [CrossRef] [PubMed]
  2. Sun, L.; Zhang, X.; Zhou, Y.; Peng, Z.; Cui, F.; Zhou, Q.; Man, Z.; Guo, J.; Sun, W. Can cadmium-contaminated rice be used to produce food additive sodium erythorbate? Food Chem. 2025, 462, 140923. [Google Scholar] [CrossRef] [PubMed]
  3. Zhou, X.; Shen, Y.; Xu, Y.; Balan, V. Directing cell catalysis of glucose to 2-keto-D-gluconic acid using Gluconobacter oxydans NL71. Process Biochem. 2020, 94, 365–369. [Google Scholar] [CrossRef]
  4. Georgiana, L.R.; Cristina, B.A.; Niculina, D.E.; Irina, G.A.; Dan, C. Mechanism, influencing factors exploration and modelling on the reactive extraction of 2-ketogluconic acid in presence of a phase modifier. Sep. Purif. Technol. 2021, 255, 117740. [Google Scholar] [CrossRef]
  5. Li, K.; Mao, X.; Liu, L.; Lin, J.; Sun, M.; Wei, D.; Yang, S. Overexpression of membrane-bound gluconate-2-dehydrogenase to enhance the production of 2-keto-D-gluconic acid by Gluconobacter oxydans. Microb. Cell Factories 2016, 15, 121. [Google Scholar] [CrossRef]
  6. Wang, D.M.; Sun, L.; Sun, W.J.; Cui, F.J.; Gong, J.S.; Zhang, X.M.; Shi, J.S.; Xu, Z.H. Purification, characterization and gene identification of a membrane-bound glucose dehydrogenase from 2-keto-D-gluconic acid industrial producing strain Pseudomonas plecoglossicida JUIM01. Int. J. Biol. Macromol. 2018, 118, 534–541. [Google Scholar] [CrossRef]
  7. Wang, D.M.; Sun, L.; Sun, W.J.; Cui, F.J.; Gong, J.S.; Zhang, X.M.; Shi, J.S.; Xu, Z.H. A membrane-bound gluconate dehydrogenase from 2-keto-D-gluconic acid industrial producing strain Pseudomonas plecoglossicida JUIM01: Purification, characterization, and gene identification. Appl. Biochem. Biotechnol. 2019, 188, 897–913. [Google Scholar] [CrossRef]
  8. Sun, L.; Wang, D.; Sun, W.; Zhang, X.; Cui, F.; Su, C.; Zhang, X.; Xu, G.; Shi, J.; Xu, Z. Characterization of a transcriptional regulator PtxS from Pseudomonas plecoglossicida for regulating 2-ketogluconic acid metabolism. Int. J. Biol. Macromol. 2021, 174, 330–338. [Google Scholar] [CrossRef]
  9. Nikel, P.I.; Chavarria, M.; Danchin, A.; de Lorenzo, V. From dirt to industrial applications: Pseudomonas putida as a synthetic biology chassis for hosting harsh biochemical reactions. Curr. Opin. Chem. Biol. 2016, 34, 20–29. [Google Scholar] [CrossRef]
  10. Nikel, P.I.; de Lorenzo, V. Pseudomonas putida as a functional chassis for industrial biocatalysis: From native biochemistry to trans-metabolism. Metab. Eng. 2018, 50, 142–155. [Google Scholar] [CrossRef]
  11. Weimer, A.; Kohlstedt, M.; Volke, D.C.; Nikel, P.I.; Wittmann, C. Industrial biotechnology of Pseudomonas putida: Advances and prospects. Appl. Microbiol. Biotechnol. 2020, 104, 7745–7766. [Google Scholar] [CrossRef] [PubMed]
  12. Craig, K.; Johnson, B.R.; Grunden, A. Leveraging Pseudomonas stress response mechanisms for industrial applications. Front. Microbiol. 2021, 12, 660134. [Google Scholar] [CrossRef] [PubMed]
  13. Bitzenhofer, N.L.; Kruse, L.; Thies, S.; Wynands, B.; Lechtenberg, T.; Ronitz, J.; Kozaeva, E.; Wirth, N.T.; Eberlein, C.; Jaeger, K.; et al. Towards robust Pseudomonas cell factories to harbour novel biosynthetic pathways. Essays Biochem. 2021, 65, 319–336. [Google Scholar] [CrossRef] [PubMed]
  14. Patra, T.; Koley, H.; Ramamurthy, T.; Ghose, A.C.; Nandy, R.K. The Entner-Doudoroff pathway is obligatory for gluconate utilization and contributes to the pathogenicity of Vibrio cholerae. J. Bacteriol. 2012, 194, 3377–3385. [Google Scholar] [CrossRef] [PubMed]
  15. Kohlstedt, M.; Wittmann, C. GC-MS-based 13C metabolic flux analysis resolves the parallel and cyclic glucose metabolism of Pseudomonas putida KT2440 and Pseudomonas aeruginosa PAO1. Metab. Eng. 2019, 54, 35–53. [Google Scholar] [CrossRef]
  16. Nikel, P.I.; Chavarría, M.; Fuhrer, T.; Sauer, U.; de Lorenzo, V. Pseudomonas putida KT2440 strain metabolizes glucose through a cycle formed by enzymes of the Entner-Doudoroff, Embden-Meyerhof-Parnas, and pentose phosphate pathways. J. Biol. Chem. 2015, 290, 25920–25932. [Google Scholar] [CrossRef]
  17. Sasnow, S.S.; Wei, H.; Aristilde, L. Bypasses in intracellular glucose metabolism in iron-limited Pseudomonas putida. MicrobiologyOpen 2016, 5, 3–20. [Google Scholar] [CrossRef]
  18. Campilongo, R.; Fung, R.K.Y.; Little, R.H.; Grenga, L.; Trampari, E.; Pepe, S.; Chandra, G.; Stevenson, C.E.M.; Roncarati, D.; Malone, J.G. One ligand, two regulators and three binding sites: How KDPG controls primary carbon metabolism in Pseudomonas. PLOS Genet. 2017, 13, e1006839. [Google Scholar] [CrossRef]
  19. Pan, S.; Underhill, S.A.M.; Hamm, C.W.; Stover, M.A.; Butler, D.R.; Shults, C.A.; Manjarrez, J.R.; Cabeen, M.T. Glycerol metabolism impacts biofilm phenotypes and virulence in Pseudomonas aeruginosa via the Entner-Doudoroff pathway. mSphere 2024, 9, e00786-23. [Google Scholar] [CrossRef]
  20. del Castillo, T.; Ramos, J.L.; Rodríguez-Herva, J.J.; Fuhrer, T.; Sauer, U.; Duque, E. Convergent peripheral pathways catalyze initial glucose catabolism in Pseudomonas putida: Genomic and flux analysis. J. Bacteriol. 2007, 189, 5142–5152. [Google Scholar] [CrossRef]
  21. Rojo, F. Carbon catabolite repression in Pseudomonas: Optimizing metabolic versatility and interactions with the environment. FEMS Microbiol. Rev. 2010, 34, 658–684. [Google Scholar] [CrossRef] [PubMed]
  22. Daddaoua, A.; Krell, T.; Ramos, J.L. Regulation of glucose metabolism in Pseudomonas: The phosphorylative branch and Entner-Doudoroff enzymes are regulated by a repressor containing a sugar isomerase domain. J. Biol. Chem. 2009, 284, 21360–21368. [Google Scholar] [CrossRef] [PubMed]
  23. Daddaoua, A.; Molina-Santiago, C.; de la Torre, J.; Krell, T.; Ramos, J.L. GtrS and GltR form a two-component system: The central role of 2-ketogluconate in the expression of exotoxin A and glucose catabolic enzymes in Pseudomonas aeruginosa. Nucleic Acids Res. 2014, 42, 7654–7665. [Google Scholar] [CrossRef] [PubMed]
  24. Bhagirath, A.Y.; Li, Y.; Patidar, R.; Yerex, K.; Ma, X.; Kumar, A.; Duan, K. Two component regulatory systems and antibiotic resistance in gram-negative pathogens. Int. J. Mol. Sci. 2019, 20, 1781. [Google Scholar] [CrossRef] [PubMed]
  25. Zhu, Y.; Mou, X.; Song, Y.; Zhang, Q.; Sun, B.; Liu, H.; Tang, H.; Bao, R. Molecular mechanism of the one-component regulator RccR on bacterial metabolism and virulence. Nucleic Acids Res. 2024, 52, 3433–3449. [Google Scholar] [CrossRef]
  26. Xu, C.; Cao, Q.; Lan, L. Glucose-binding of periplasmic protein GltB activates GtrS-GltR two-component system in Pseudomonas aeruginosa. Microorganisms 2021, 9, 447. [Google Scholar] [CrossRef]
  27. del Castillo, T.; Duque, E.; Ramos, J.L. A set of activators and repressors control peripheral glucose pathways in Pseudomonas putida to yield a common central intermediate. J. Bacteriol. 2008, 190, 2331–2339. [Google Scholar] [CrossRef]
  28. Wang, D.M.; Chen, X.; Guo, H.; Wang, Q.H.; Sun, L.; Sun, W.J. Exploring the response mechanism of Pseudomonas plecoglossicida to high-temperature stress by transcriptomic analyses for 2-keto gluconic acid production. Food Biosci. 2024, 62, 105063. [Google Scholar] [CrossRef]
  29. Sun, W.J.; Wang, Q.H.; Luan, F.; Man, Z.W.; Cui, F.J.; Qi, X.H. The role of kguT gene in 2-ketogluconate-producing Pseudomonas plecoglossicida JUIM01. Appl. Biochem. Biotechnol. 2019, 187, 965–974. [Google Scholar] [CrossRef]
  30. Brouwer, R.W.W.; Kuipers, O.P.; van Hijum, S.A.F.T. The relative value of operon predictions. Brief. Bioinform. 2008, 9, 367–375. [Google Scholar] [CrossRef]
  31. He, X.; Wang, D.; Sun, W.; Cui, F.; Qian, J.; Qi, X.; Yu, S.L. Cloning, expression and bioinformatic analysis of 2-ketogluconate kinase gene from Pseudomonas plecoglossicida. Food Sci. 2017, 38, 10–16. (In Chinese) [Google Scholar] [CrossRef]
  32. Wu, C.M.; Huang, H.H.; Li, L.H.; Lin, Y.T.; Yang, T.C. Molecular characterization of three tandemly located flagellin genes of Stenotrophomonas maltophilia. Int. J. Mol. Sci. 2022, 23, 3863. [Google Scholar] [CrossRef] [PubMed]
  33. Sun, W.J.; Zhou, Y.Z.; Zhou, Q.; Cui, F.J.; Yu, S.L.; Sun, L. Semi-continuous production of 2-keto-gluconic acid by Pseudomonas fluorescens AR4 from rice starch hydrolysate. Bioresour. Technol. 2012, 110, 546–551. [Google Scholar] [CrossRef] [PubMed]
  34. Udaondo, Z.; Ramos, J.L.; Segura, A.; Krell, T.; Daddaoua, A. Regulation of carbohydrate degradation pathways in Pseudomonas involves a versatile set of transcriptional regulators. Microb. Biotechnol. 2018, 11, 442–454. [Google Scholar] [CrossRef] [PubMed]
  35. Kim, H.J.; Nam, H.S.; Anderson, A.J.; Yang, K.Y.; Cho, B.H.; Kim, Y.C. Mutation in the edd gene encoding the 6-phosphogluconate dehydratase of Pseudomonas chlororaphis O6 impairs root colonization and is correlated with reduced induction of systemic resistance. Lett. Appl. Microbiol. 2007, 44, 56–61. [Google Scholar] [CrossRef]
  36. Kim, J.; Yeom, J.; Jeon, C.O.; Park, W. Intracellular 2-keto-3-deoxy-6-phosphogluconate is the signal for carbon catabolite repression of phenylacetic acid metabolism in Pseudomonas putida KT2440. Microbiology 2009, 155, 2420–2428. [Google Scholar] [CrossRef]
Figure 1. The deduced glucose metabolism in Pseudomonas based on the gene annotations and functional analysis.
Figure 1. The deduced glucose metabolism in Pseudomonas based on the gene annotations and functional analysis.
Foods 13 03444 g001
Figure 2. The physical map of the putative edd operon (A), and co-transcription assay of edd, glk, gltR, and gtrS in the putative edd operon (B). (Lane M, DL 2000 bp DNA marker; lane 1, using gDNA as a template (primer pair G1/G2); lane 2, using cDNA as a template (primer pair G1/G2); lane 3, using deionized water as a template (primer pair G1/G2); lane 4, using gDNA as a template (primer pair G3/G4); lane 5, using cDNA as a template (primer pair G3/G4); lane 6, using deionized water as a template (primer pair G3/G4); lane 7, using gDNA as a template (primer pair G5/G6); lane 8, using cDNA as a template (primer pair G5/G6); and lane 9, using deionized water as a template (primer pair G5/G6).
Figure 2. The physical map of the putative edd operon (A), and co-transcription assay of edd, glk, gltR, and gtrS in the putative edd operon (B). (Lane M, DL 2000 bp DNA marker; lane 1, using gDNA as a template (primer pair G1/G2); lane 2, using cDNA as a template (primer pair G1/G2); lane 3, using deionized water as a template (primer pair G1/G2); lane 4, using gDNA as a template (primer pair G3/G4); lane 5, using cDNA as a template (primer pair G3/G4); lane 6, using deionized water as a template (primer pair G3/G4); lane 7, using gDNA as a template (primer pair G5/G6); lane 8, using cDNA as a template (primer pair G5/G6); and lane 9, using deionized water as a template (primer pair G5/G6).
Foods 13 03444 g002
Figure 3. The prediction of the promoter region of the edd operon (A), a comparison of the cell growth (B) and β-galactosidase activities (C) between JUIM01/pME6522 and JUIM01/pME6522-edd after 12 h and 24 h cultivation, and the determined transcription start site of the edd operon by 5′-RACE (D).
Figure 3. The prediction of the promoter region of the edd operon (A), a comparison of the cell growth (B) and β-galactosidase activities (C) between JUIM01/pME6522 and JUIM01/pME6522-edd after 12 h and 24 h cultivation, and the determined transcription start site of the edd operon by 5′-RACE (D).
Foods 13 03444 g003
Figure 4. The growth and metabolism of P. plecoglossicida JUIM01 and its mutant strains using glucose (AD) or 2KGA (E,F) as the sole carbon source.
Figure 4. The growth and metabolism of P. plecoglossicida JUIM01 and its mutant strains using glucose (AD) or 2KGA (E,F) as the sole carbon source.
Foods 13 03444 g004
Table 1. The predicted proteins encoded by ORFs 2–5 and their similarities to other proteins in Pseudomonas.
Table 1. The predicted proteins encoded by ORFs 2–5 and their similarities to other proteins in Pseudomonas.
ORFMolecular Weight of the Product (No. of Amino Acid Residues)Proposed Functionof Gene ProductSimilar Gene Product
(% Identity)
ORF2
(edd)
65.28 kDa (608)6-Phosphogluconate dehydrataseP. putida and P. guariconensis 6-phosphogluconate dehydratase (>99%)
ORF3
(glk)
33.59 kDa (319)Glucose kinaseP. putida and Pseudomonas sp. p1 (2021b) glucose kinase (>99%)
ORF4
(gltR)
27.27 kDa (241)Response regulatory factor GltRP. putida and Pseudomonas sp. p1 (2021b) response regulatory factor GltR (>98%)
ORF5
(gtrS)
54.15 kDa (484)Histidine kinase GtrSP. putida and Pseudomonas sp. p1 (2021b) histidine kinase GtrS (>98%)
Table 2. Comparison of 2KGA production performance between P. plecoglossicida JUIM01 and its mutant strains.
Table 2. Comparison of 2KGA production performance between P. plecoglossicida JUIM01 and its mutant strains.
StrainsInitial Glucose
(g/L)
Residual
Glucose (g/L)
Maximum Cell Concentration
(OD650 nm)
2KGA
(g/L)
2KGA Yield
(g/100 g)
Fermentation Period
(h)
2KGA Productivity (g/L·h)
JUIM01162.000.03 ± 0.009.63 ± 0.03153.1 ± 3.894.5 ± 2.472.02.13 ± 0.05
JUIM01Δedd162.000.00 ± 0.009.29 ± 0.05166.0 ± 6.4102.4 ± 4.072.02.30 ± 0.09
JUIM01Δedd-edd162.000.01 ± 0.009.54 ± 0.04155.9 ± 6.196.3 ± 3.772.02.17 ± 0.08
JUIM01Δglk162.000.02 ± 0.009.86 ± 0.02145.2 ± 5.289.7 ± 3.272.02.02 ± 0.07
JUIM01Δglk-glk162.000.01 ± 0.009.71 ± 0.01152.0 ± 4.693.9 ± 2.972.02.11 ± 0.06
JUIM01ΔgltR162.000.00 ± 0.009.36 ± 0.04153.6 ± 3.994.8 ± 2.472.02.13 ± 0.05
JUIM01ΔgltR-gltR162.000.01 ± 0.009.51 ± 0.02153.0 ± 3.094.4 ± 1.872.02.12 ± 0.04
JUIM01ΔgtrS162.000.00 ± 0.009.74 ± 0.03153.4 ± 1.994.7 ± 1.272.02.13 ± 0.03
JUIM01ΔgtrS-gtrS162.000.03 ± 0.009.59 ± 0.03152.0 ± 6.993.8 ± 4.272.02.11 ± 0.10
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, W.-J.; Zhang, Q.-N.; Li, L.-L.; Qu, M.-X.; Zan, X.-Y.; Cui, F.-J.; Zhou, Q.; Wang, D.-M.; Sun, L. The Functional Characterization of the 6-Phosphogluconate Dehydratase Operon in 2-Ketogluconic Acid Industrial Producing Strain Pseudomonas plecoglossicida JUIM01. Foods 2024, 13, 3444. https://doi.org/10.3390/foods13213444

AMA Style

Sun W-J, Zhang Q-N, Li L-L, Qu M-X, Zan X-Y, Cui F-J, Zhou Q, Wang D-M, Sun L. The Functional Characterization of the 6-Phosphogluconate Dehydratase Operon in 2-Ketogluconic Acid Industrial Producing Strain Pseudomonas plecoglossicida JUIM01. Foods. 2024; 13(21):3444. https://doi.org/10.3390/foods13213444

Chicago/Turabian Style

Sun, Wen-Jing, Qian-Nan Zhang, Lu-Lu Li, Meng-Xin Qu, Xin-Yi Zan, Feng-Jie Cui, Qiang Zhou, Da-Ming Wang, and Lei Sun. 2024. "The Functional Characterization of the 6-Phosphogluconate Dehydratase Operon in 2-Ketogluconic Acid Industrial Producing Strain Pseudomonas plecoglossicida JUIM01" Foods 13, no. 21: 3444. https://doi.org/10.3390/foods13213444

APA Style

Sun, W.-J., Zhang, Q.-N., Li, L.-L., Qu, M.-X., Zan, X.-Y., Cui, F.-J., Zhou, Q., Wang, D.-M., & Sun, L. (2024). The Functional Characterization of the 6-Phosphogluconate Dehydratase Operon in 2-Ketogluconic Acid Industrial Producing Strain Pseudomonas plecoglossicida JUIM01. Foods, 13(21), 3444. https://doi.org/10.3390/foods13213444

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop