Improving Generation of Cardiac Organoids from Human Pluripotent Stem Cells Using the Aurora Kinase Inhibitor ZM447439
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Line and Culture Protocol
2.2. Quality Control of hiPSCs
2.2.1. Flow Cytometry
2.2.2. PSC Scorecard Analysis
2.3. Differentiation of hiPSCs into CMs
2.4. Differentiation of hiPSCs into hCOs
2.5. Cell Cycle Analysis
2.6. RNA extraction, cRNA synthesis, and qRT-PCR
2.7. Immunofluorescent Staining
2.8. Electrophysiology
2.9. Transcriptome Analysis
2.10. Multi-Electrode Array Assay
2.11. Statistical Analysis
3. Results
3.1. Differentiation of CMs from Quality Controlled hiPSCs
3.2. ZM Treatment Changes Mesoderm Subtype during Differentiaion of iPSC-CMs
3.3. Improvement in Cardiac Gene Expression in ZM-Treated iPSC-hCOs
3.4. Increase in Cardiac Ion Channel Function in ZM-Treated iPSC- hCOs
3.5. Increase in Cardiac Function-Related Gene Expression in ZM-Treated hCOs
3.6. Drug Responses of FPs in hCOs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Hwang, T.J.; Carpenter, D.; Lauffenburger, J.C.; Wang, B.; Franklin, J.M.; Kesselheim, A.S. Failure of investigational drugs in late-stage clinical development and publication of trial results. JAMA Intern. Med. 2016, 176, 1826–1833. [Google Scholar] [CrossRef] [PubMed]
- DiMasi, J.A.; Hansen, R.W.; Grabowski, H.G. The price of innovation: New estimates of drug development costs. J. Health Econ. 2003, 22, 151–185. [Google Scholar] [CrossRef] [Green Version]
- Fogel, D.B. Factors associated with clinical trials that fail and opportunities for improving the likelihood of success: A review. Contemp. Clin. Trials Commun. 2018, 11, 156–164. [Google Scholar] [CrossRef]
- McNaughton, R.; Huet, G.; Shakir, S. An investigation into drug products withdrawn from the EU market between 2002 and 2011 for safety reasons and the evidence used to support the decision-making. BMJ Open 2014, 4, e004221. [Google Scholar] [CrossRef] [Green Version]
- Ranga, A.; Gjorevski, N.; Lutolf, M.P. Drug discovery through stem cell-based organoid models. Adv. Drug Deliv. Rev. 2014, 69–70, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Langhans, S.A. Three-dimensional in vitro cell culture models in drug discovery and drug repositioning. Front. Pharmacol. 2018, 9, 6. [Google Scholar] [CrossRef]
- Uhl, E.W.; Warner, N.J. Mouse models as predictors of human responses: Evolutionary medicine. Curr. Pathobiol. Rep. 2015, 3, 219–223. [Google Scholar] [CrossRef] [Green Version]
- Seok, J.; Warren, H.S.; Cuenca, A.G.; Mindrinos, M.N.; Baker, H.V.; Xu, W.; Richards, D.R.; McDonald-Smith, G.P.; Gao, H.; Hennessy, L.; et al. Genomic responses in mouse models poorly mimic human inflammatory diseases. Proc. Natl. Acad. Sci. USA 2013, 110, 3507–3512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fenwick, N.; Griffin, G.; Gauthier, C. The welfare of animals used in science: How the “Three Rs” ethic guides improvements. Can. Vet. J. 2009, 50, 523–530. [Google Scholar] [PubMed]
- Olson, H.; Betton, G.; Robinson, D.; Thomas, K.; Monro, A.; Kolaja, G.; Lilly, P.; Sanders, J.; Sipes, G.; Bracken, W.; et al. Concordance of the toxicity of pharmaceuticals in humans and in animals. Regul. Toxicol. Pharmacol. 2000, 32, 56–67. [Google Scholar] [CrossRef]
- Andersen, P.; Tampakakis, E.; Jimenez, D.V.; Kannan, S.; Miyamoto, M.; Shin, H.K.; Saberi, A.; Murphy, S.; Sulistio, E.; Chelko, S.P.; et al. Precardiac organoids form two heart fields via Bmp/Wnt signaling. Nat. Commun. 2018, 9, 3140. [Google Scholar] [CrossRef] [PubMed]
- Lewis-Israeli, Y.R.; Wasserman, A.H.; Gabalski, M.A.; Volmert, B.D.; Ming, Y.; Ball, K.A.; Yang, W.; Zou, J.; Ni, G.; Pajares, N. Self-assembling human heart organoids for the modeling of cardiac development and congenital heart disease. Nat. Commun. 2021, 12, 5142. [Google Scholar] [CrossRef] [PubMed]
- Hofbauer, P.; Jahnel, S.M.; Papai, N.; Giesshammer, M.; Deyett, A.; Schmidt, C.; Penc, M.; Tavernini, K.; Grdseloff, N.; Meledeth, C.; et al. Cardioids reveal self-organizing principles of human cardiogenesis. Cell 2021, 184, 3299–3317.e3222. [Google Scholar] [CrossRef]
- Sasai, Y. Next-generation regenerative medicine: Organogenesis from stem cells in 3D culture. Cell Stem Cell 2013, 12, 520–530. [Google Scholar] [CrossRef] [Green Version]
- Nugraha, B.; Buono, M.F.; von Boehmer, L.; Hoerstrup, S.P.; Emmert, M.Y. Human cardiac organoids for disease modeling. Clin. Pharmacol. Ther. 2019, 105, 79–85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Forsythe, S.D.; Devarasetty, M.; Shupe, T.; Bishop, C.; Atala, A.; Soker, S.; Skardal, A. Environmental toxin screening using uuman-derived 3D Bioengineered liver and Cardiac Organoids. Front. Public Health 2018, 6, 103. [Google Scholar] [CrossRef] [Green Version]
- Lewis-Israeli, Y.R.; Wasserman, A.H.; Aguirre, A. Heart organoids and engineered heart tissues: Novel tools for modeling human cardiac biology and disease. Biomolecules 2021, 11, 1277. [Google Scholar] [CrossRef]
- Laco, F.; Woo, T.L.; Zhong, Q.; Szmyd, R.; Ting, S.; Khan, F.J.; Chai, C.L.L.; Reuveny, S.; Chen, A.; Oh, S. Unraveling the inconsistencies of cardiac differentiation efficiency induced by the GSK3β Inhibitor CHIR99021 in human pluripotent stem cells. Stem Cell Rep. 2018, 10, 1851–1866. [Google Scholar] [CrossRef] [Green Version]
- Bolanos-Garcia, V.M. Aurora kinases. Int. J. Biochem. Cell Biol. 2005, 37, 1572–1577. [Google Scholar] [CrossRef]
- Tang, A.; Gao, K.; Chu, L.; Zhang, R.; Yang, J.; Zheng, J. Aurora kinases: Novel therapy targets in cancers. Oncotarget 2017, 8, 23937. [Google Scholar] [CrossRef] [Green Version]
- Lee, D.-F.; Su, J.; Ang, Y.-S.; Carvajal-Vergara, X.; Mulero-Navarro, S.; Pereira, C.F.; Gingold, J.; Wang, H.-L.; Zhao, R.; Sevilla, A.; et al. Regulation of embryonic and induced pluripotency by aurora kinase-p53 signaling. Cell Stem Cell 2012, 11, 179–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.; Zou, Y.; Nowotschin, S.; Kim, S.Y.; Li, Q.V.; Soh, C.-L.; Su, J.; Zhang, C.; Shu, W.; Xi, Q.; et al. The p53 Family coordinates Wnt and Nodal inputs in mesendodermal differentiation of embryonic stem cells. Cell Stem Cell 2017, 20, 70–86. [Google Scholar] [CrossRef] [Green Version]
- Lian, X.; Hsiao, C.; Wilson, G.; Zhu, K.; Hazeltine, L.B.; Azarin, S.M.; Raval, K.K.; Zhang, J.; Kamp, T.J.; Palecek, S.P. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc. Natl. Acad. Sci. USA 2012, 109, E1848–E1857. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Klos, M.; Wilson, G.F.; Herman, A.M.; Lian, X.; Raval, K.K.; Barron, M.R.; Hou, L.; Soerens, A.G.; Yu, J.; et al. Extracellular matrix promotes highly efficient cardiac differentiation of human pluripotent stem cells: The matrix sandwich method. Circ. Res. 2012, 111, 1125–1136. [Google Scholar] [CrossRef]
- Cyganek, L.; Tiburcy, M.; Sekeres, K.; Gerstenberg, K.; Bohnenberger, H.; Lenz, C.; Henze, S.; Stauske, M.; Salinas, G.; Zimmermann, W.H.; et al. Deep phenotyping of human induced pluripotent stem cell-derived atrial and ventricular cardiomyocytes. JCI Insight 2018, 3, e99941. [Google Scholar] [CrossRef] [Green Version]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
- Chan, E.M.; Ratanasirintrawoot, S.; Park, I.-H.; Manos, P.D.; Loh, Y.-H.; Huo, H.; Miller, J.D.; Hartung, O.; Rho, J.; Ince, T.A.; et al. Live cell imaging distinguishes bona fide human iPS cells from partially reprogrammed cells. Nat. Biotechnol. 2009, 27, 1033–1037. [Google Scholar] [CrossRef] [PubMed]
- Dar, A.A.; Belkhiri, A.; El-Rifai, W. The aurora kinase A regulates GSK-3beta in gastric cancer cells. Oncogene 2009, 28, 866–875. [Google Scholar] [CrossRef] [Green Version]
- Sheng, X.; Reppel, M.; Nguemo, F.; Mohammad, F.I.; Kuzmenkin, A.; Hescheler, J.; Pfannkuche, K. Human pluripotent stem cell-derived cardiomyocytes: Response to TTX and lidocain reveals strong cell to cell variability. PLoS ONE 2012, 7, e45963. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Branco, M.A.; Cabral, J.M.S.; Diogo, M.M. From Human Pluripotent Stem Cells to 3D Cardiac Microtissues: Progress, Applications and Challenges. Bioengineering 2020, 7, 92. [Google Scholar] [CrossRef]
- Richards, D.J.; Coyle, R.C.; Tan, Y.; Jia, J.; Wong, K.; Toomer, K.; Menick, D.R.; Mei, Y. Inspiration from heart development: Biomimetic development of functional human cardiac organoids. Biomaterials 2017, 142, 112–123. [Google Scholar] [CrossRef]
- Ravenscroft, S.M.; Pointon, A.; Williams, A.W.; Cross, M.J.; Sidaway, J.E. Cardiac Non-myocyte Cells Show Enhanced Pharmacological Function Suggestive of Contractile Maturity in Stem Cell Derived Cardiomyocyte Microtissues. Toxicol. Sci. 2016, 152, 99–112. [Google Scholar] [CrossRef] [PubMed]
- Giacomelli, E.; Bellin, M.; Sala, L.; van Meer, B.J.; Tertoolen, L.G.; Orlova, V.V.; Mummery, C.L. Three-dimensional cardiac microtissues composed of cardiomyocytes and endothelial cells co-differentiated from human pluripotent stem cells. Development 2017, 144, 1008–1017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Archer, C.R.; Sargeant, R.; Basak, J.; Pilling, J.; Barnes, J.R.; Pointon, A. Characterization and Validation of a Human 3D Cardiac Microtissue for the Assessment of Changes in Cardiac Pathology. Sci. Rep. 2018, 8, 10160. [Google Scholar] [CrossRef]
- Polonchuk, L.; Chabria, M.; Badi, L.; Hoflack, J.C.; Figtree, G.; Davies, M.J.; Gentile, C. Cardiac spheroids as promising in vitro models to study the human heart microenvironment. Sci. Rep. 2017, 7, 7005. [Google Scholar] [CrossRef]
- Giacomelli, E.; Meraviglia, V.; Campostrini, G.; Cochrane, A.; Cao, X.; van Helden, R.W.J.; Krotenberg Garcia, A.; Mircea, M.; Kostidis, S.; Davis, R.P.; et al. Human-iPSC-derived cardiac stromal cells enhance maturation in 3D cardiac microtissues and reveal non-cardiomyocyte contributions to heart disease. Cell Stem Cell 2020, 26, 862–879.e811. [Google Scholar] [CrossRef]
- Pitaktong, I.; Lui, C.; Lowenthal, J.; Mattson, G.; Jung, W.H.; Bai, Y.; Yeung, E.; Ong, C.S.; Chen, Y.; Gerecht, S.; et al. Early Vascular Cells Improve Microvascularization within 3D Cardiac Spheroids. Tissue Eng. Part C Methods 2020, 26, 80–90. [Google Scholar] [CrossRef]
- Mills, R.J.; Parker, B.L.; Quaife-Ryan, G.A.; Voges, H.K.; Needham, E.J.; Bornot, A.; Ding, M.; Andersson, H.; Polla, M.; Elliott, D.A.; et al. Drug screening in human PSC-cardiac organoids identifies pro-proliferative compounds acting via the mevalonate pathway. Cell Stem Cell 2019, 24, 895–907.e896. [Google Scholar] [CrossRef] [PubMed]
- Keung, W.; Chan, P.K.; Backeris, P.C.; Lee, E.K.; Wong, N.; Wong, A.O.; Wong, G.K.; Chan, C.W.; Fermini, B.; Costa, K.D.; et al. Human Cardiac Ventricular-Like Organoid Chambers and Tissue Strips From Pluripotent Stem Cells as a Two-Tiered Assay for Inotropic Responses. Clin. Pharmacol. Ther. 2019, 106, 402–414. [Google Scholar] [CrossRef]
- Ma, Z.; Wang, J.; Loskill, P.; Huebsch, N.; Koo, S.; Svedlund, F.L.; Marks, N.C.; Hua, E.W.; Grigoropoulos, C.P.; Conklin, B.R.; et al. Self-organizing human cardiac microchambers mediated by geometric confinement. Nat. Commun. 2015, 6, 7413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hofer, M.; Lutolf, M.P. Engineering organoids. Nat. Rev. Mater. 2021, 6, 402–420. [Google Scholar] [CrossRef] [PubMed]
- Laco, F.; Lam, A.T.-L.; Woo, T.-L.; Tong, G.; Ho, V.; Soong, P.-L.; Grishina, E.; Lin, K.-H.; Reuveny, S.; Oh, S.K.-W. Selection of human induced pluripotent stem cells lines optimization of cardiomyocytes differentiation in an integrated suspension microcarrier bioreactor. Stem Cell Res. Ther. 2020, 11, 118. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Zhang, P.; Huang, W.; Liu, F.; Long, D.; Peng, W.; Dang, X.; Zeng, X.; Zhou, R. p53 Promotes Differentiation of Cardiomyocytes from hiPSC through Wnt Signaling-Mediated Mesendodermal Differentiation. Int. J. Stem Cells 2021, 14, 410–422. [Google Scholar] [CrossRef]
- Yiangou, L.; Grandy, R.A.; Osnato, A.; Ortmann, D.; Sinha, S.; Vallier, L. Cell cycle regulators control mesoderm specification in human pluripotent stem cells. J. Biol. Chem. 2019, 294, 17903–17914. [Google Scholar] [CrossRef] [Green Version]
- Litviňuková, M.; Talavera-López, C.; Maatz, H.; Reichart, D.; Worth, C.L.; Lindberg, E.L.; Kanda, M.; Polanski, K.; Heinig, M.; Lee, M.; et al. Cells of the adult human heart. Nature 2020, 588, 466–472. [Google Scholar] [CrossRef]
- Ditchfield, C.; Johnson, V.L.; Tighe, A.; Ellston, R.; Haworth, C.; Johnson, T.; Mortlock, A.; Keen, N.; Taylor, S.S.; Aurora, B. couples chromosome alignment with anaphase by targeting BubR1, Mad2, and Cenp-E to kinetochores. J. Cell Biol. 2003, 161, 267–280. [Google Scholar] [CrossRef]
- Huang, C.Y.; Maia-Joca, R.P.M.; Ong, C.S.; Wilson, I.; DiSilvestre, D.; Tomaselli, G.F.; Reich, D.H. Enhancement of human iPSC-derived cardiomyocyte maturation by chemical conditioning in a 3D environment. J. Mol. Cell. Cardiol. 2020, 138, 1–11. [Google Scholar] [CrossRef]
- Ronaldson-Bouchard, K.; Ma, S.P.; Yeager, K.; Chen, T.; Song, L.; Sirabella, D.; Morikawa, K.; Teles, D.; Yazawa, M.; Vunjak-Novakovic, G.J.N. Advanced maturation of human cardiac tissue grown from pluripotent stem cells. Nature 2018, 556, 239–243, Erratum in Nature 2019, 572, E16–E17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shadrin, I.Y.; Allen, B.W.; Qian, Y.; Jackman, C.P.; Carlson, A.L.; Juhas, M.E.; Bursac, N. Cardiopatch platform enables maturation and scale-up of human pluripotent stem cell-derived engineered heart tissues. Nat. Commun. 2017, 8, 1825. [Google Scholar] [CrossRef] [Green Version]
- Mills, R.J.; Titmarsh, D.M.; Koenig, X.; Parker, B.L.; Ryall, J.G.; Quaife-Ryan, G.A.; Voges, H.K.; Hodson, M.P.; Ferguson, C.; Drowley, L.J.; et al. Functional screening in human cardiac organoids reveals a metabolic mechanism for cardiomyocyte cell cycle arrest. Proc. Natl. Acad. Sci. USA 2017, 114, E8372–E8381. [Google Scholar] [CrossRef] [Green Version]
- Ruan, J.-L.; Tulloch, N.L.; Razumova, M.V.; Saiget, M.; Muskheli, V.; Pabon, L.; Reinecke, H.; Regnier, M.; Murry, C.E.J.C. Mechanical stress conditioning and electrical stimulation promote contractility and force maturation of induced pluripotent stem cell-derived human cardiac tissue. Circulation 2016, 134, 1557–1567. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Pu, W.T. Cardiomyocyte Maturation. Circ. Res. 2020, 126, 1086–1106. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Qian, J.-Y.; Abrams, R.; Tang, H.-M.; Weiser, T.; Sanders, M.J.; Kolaja, K. The electrophysiological effects of cardiac glycosides in human iPSC-derived cardiomyocytes and in guinea pig isolated hearts. Cell. Physiol. Biochem. 2011, 27, 453–462. [Google Scholar] [CrossRef] [PubMed]
- Himmel, H.M. Drug-induced functional cardiotoxicity screening in stem cell-derived human and mouse cardiomyocytes: Effects of reference compounds. J. Pharmacol. Toxicol. Methods 2013, 68, 97–111. [Google Scholar] [CrossRef]
- Fujiki, A.; Tani, M.; Mizumaki, K.; Shimono, M.; Inoue, H. Electrophysiologic effects of intravenous E-4031, a novel class III antiarrhythmic agent, in patients with supraventricular tachyarrhythmias. J. Cardiovasc. Pharmacol. 1994, 23, 374–378. [Google Scholar] [CrossRef]
- Kopljar, I.; Lu, H.R.; Van Ammel, K.; Otava, M.; Tekle, F.; Teisman, A.; Gallacher, D.J. Development of a Human iPSC Cardiomyocyte-Based Scoring System for Cardiac Hazard Identification in Early Drug Safety De-risking. Stem Cell Rep. 2018, 11, 1365–1377. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Primer Sequence (5′-3′) |
---|---|
GAPDH | F: 5′ CAATGGAAATCCCAT-CACCA 3′ |
R: 5′ GGGCAGAGATGATGACCCTT 3′ | |
cTnT | F: 5′ GGAGAC-CAGGGCAGAAGAAG 3′ |
R: 5′ GATCTTGGGAGGCACCAAGT 3′ | |
Vimentin | F: 5′ GACAGGATGTTGACAATGCG 3′ |
R: 5′ GTTCCTGAATCTGAGCCTGC 3′ | |
VE-cad | F: 5′ GAAGCCTCTGATTGGCACAGTG 3′ |
R: 5′ TTTTGTGACTCGGAA-GAACTGGC 3′ | |
Nav1.5 | F: 5′ TTCCTATTACCTCGGGGCAC 3′ |
R: 5′ TGCCATAGAGATCTGGCAGC 3′ | |
Car1.2 | F: 5′ AGTCCAAGACACGGCAAACA 3′ |
R: 5′ GCAGTCAAAGCGGTTGAAGA 3′ | |
hERG | F: 5′ GAGCAGCCACACATGGACTC 3′ |
R: 5′ AGAGCGCCGTCACATACTTG 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.-J.; Kim, H.-A.; Kim, S.-J.; Lee, H.-A. Improving Generation of Cardiac Organoids from Human Pluripotent Stem Cells Using the Aurora Kinase Inhibitor ZM447439. Biomedicines 2021, 9, 1952. https://doi.org/10.3390/biomedicines9121952
Lee S-J, Kim H-A, Kim S-J, Lee H-A. Improving Generation of Cardiac Organoids from Human Pluripotent Stem Cells Using the Aurora Kinase Inhibitor ZM447439. Biomedicines. 2021; 9(12):1952. https://doi.org/10.3390/biomedicines9121952
Chicago/Turabian StyleLee, Su-Jin, Hyeon-A Kim, Sung-Joon Kim, and Hyang-Ae Lee. 2021. "Improving Generation of Cardiac Organoids from Human Pluripotent Stem Cells Using the Aurora Kinase Inhibitor ZM447439" Biomedicines 9, no. 12: 1952. https://doi.org/10.3390/biomedicines9121952
APA StyleLee, S.-J., Kim, H.-A., Kim, S.-J., & Lee, H.-A. (2021). Improving Generation of Cardiac Organoids from Human Pluripotent Stem Cells Using the Aurora Kinase Inhibitor ZM447439. Biomedicines, 9(12), 1952. https://doi.org/10.3390/biomedicines9121952