Insights from DNA Barcodes-Based Phylogenetic Analysis of Medicinal Plants and Estimation of Their Conservation Status: A Case Study in the Tianshan Wild Forest, China
Abstract
1. Introduction
2. Results
2.1. Morphological Observation and Identification
2.2. PCR and Sequence Analysis
2.3. Genetic Distance Analyses
2.4. Species Discrimination Using the BLAST Method
2.5. Distance-Based Species Delimitation
2.6. Phylogenetic Tree-Based Species Identification
2.7. Evaluation of Medicinal Herbs
3. Discussion
4. Materials and Methods
4.1. Study Area
4.2. DNA Extraction and Amplification
4.3. Sequence Editing and Phylogenetic Analyses
4.4. Comprehensive Evaluation and Analysis of Medicinal Herbs by AHP
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fitzgerald, M.; Heinrich, M.; Booker, A. Medicinal Plant Analysis: A Historical and Regional Discussion of Emergent Complex Techniques. Front. Pharmacol. 2020, 10, 1480. [Google Scholar] [CrossRef] [PubMed]
- Techen, N.; Parveen, I.; Pan, Z.; Khan, I.A. DNA Barcoding of Medicinal Plant Material for Identification. Curr. Opin. Biotechnol. 2014, 25, 103–110. [Google Scholar] [CrossRef] [PubMed]
- Rouhan, G.; Gaudeul, M. Plant Taxonomy: A Historical Perspective, Current Challenges, and Perspectives. Methods Mol. Biol. 2014, 1115, 1–37. [Google Scholar] [CrossRef] [PubMed]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological Identifications through DNA Barcodes. Proc. R. Soc. B-Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef]
- Schindel, D.E.; Miller, S.E. DNA Barcoding a Useful Tool for Taxonomists. Nature 2005, 435, 17. [Google Scholar] [CrossRef] [PubMed]
- Ai, Y.; Xing, Y.; Yan, L.; Ma, D.; Gao, A.; Xu, Q.; Zhang, S.; Mao, T.; Pan, Q.; Ma, X.; et al. Atrial Fibrillation and Depression: A Bibliometric Analysis from 2001 to 2021. Front. Cardiovasc. Med. 2022, 9, 775329. [Google Scholar] [CrossRef] [PubMed]
- Cheung, F. MODERN TCM Enter the Clinic. Nature 2011, 480, S94–S95. [Google Scholar] [CrossRef]
- Bolson, M.; Smidt, E.D.C.; Brotto, M.L.; Silva-Pereira, V. ITS and trnH-psbA as Efficient DNA Barcodes to Identify Threatened Commercial Woody Angiosperms from Southern Brazilian Atlantic Rainforests. PLoS ONE 2015, 10, e0143049. [Google Scholar] [CrossRef] [PubMed]
- Pang, X.; Liu, C.; Shi, L.; Liu, R.; Liang, D.; Li, H.; Cherny, S.S.; Chen, S. Utility of the trnH-psbA Intergenic Spacer Region and Its Combinations as Plant DNA Barcodes: A Meta-Analysis. PLoS ONE 2012, 7, e48833. [Google Scholar] [CrossRef] [PubMed]
- Logacheva, M.D.; Valiejo-Roman, C.M.; Pimenov, M.G. ITS Phylogeny of West Asian Heracleum Species and Related Taxa of Umbelliferae-Tordylieae W.D.J.!Koch, with Notes on Evolution of Their PsbA-TrnH Sequences. Plant Syst. Evol. 2008, 270, 139–157. [Google Scholar] [CrossRef]
- Lahaye, R.; Van der Bank, M.; Bogarin, D.; Warner, J.; Pupulin, F.; Gigot, G.; Maurin, O.; Duthoit, S.; Barraclough, T.G.; Savolainen, V. DNA Barcoding the Floras of Biodiversity Hotspots. Proc. Natl. Acad. Sci. USA 2008, 105, 2923–2928. [Google Scholar] [CrossRef] [PubMed]
- Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; Fazekas, A.J.; et al. A DNA Barcode for Land Plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef]
- Yao, H.; Song, J.; Liu, C.; Luo, K.; Han, J.; Li, Y.; Pang, X.; Xu, H.; Zhu, Y.; Xiao, P.; et al. Use of ITS2 Region as the Universal DNA Barcode for Plants and Animals. PLoS ONE 2010, 5, e13102. [Google Scholar] [CrossRef] [PubMed]
- Bell, K.L.; de Vere, N.; Keller, A.; Richardson, R.T.; Gous, A.; Burgess, K.S.; Brosi, B.J. Pollen DNA Barcoding: Current Applications and Future Prospects. Genome 2016, 59, 629–640. [Google Scholar] [CrossRef]
- Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; Zhu, Y.; Ma, X.; Gao, T.; Pang, X.; et al. Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef]
- Antil, S.; Abraham, J.S.; Sripoorna, S.; Maurya, S.; Dagar, J.; Makhija, S.; Bhagat, P.; Gupta, R.; Sood, U.; Lal, R.; et al. DNA Barcoding, an Effective Tool for Species Identification: A Review. Mol. Biol. Rep. 2023, 50, 761–775. [Google Scholar] [CrossRef] [PubMed]
- Comtet, T.; Sandionigi, A.; Viard, F.; Casiraghi, M. DNA (Meta)Barcoding of Biological Invasions: A Powerful Tool to Elucidate Invasion Processes and Help Managing Aliens. Biol. Invasions 2015, 17, 905–922. [Google Scholar] [CrossRef]
- Zhu, S.; Liu, Q.; Qiu, S.; Dai, J.; Gao, X. DNA Barcoding: An Efficient Technology to Authenticate Plant Species of Traditional Chinese Medicine and Recent Advances. Chin. Med. 2022, 17, 112. [Google Scholar] [CrossRef] [PubMed]
- Raclariu, A.C.; Mocan, A.; Popa, M.O.; Vlase, L.; Ichim, M.C.; Crisan, G.; Brysting, A.K. Veronica officinalis Product Authentication Using DNA Metabarcoding and HPLC-MS Reveals Widespread Adulteration with Veronica chamaedrys. Front. Pharmacol. 2017, 8, 957. [Google Scholar] [CrossRef]
- Puillandre, N.; Lambert, A.; Brouillet, S.; Achaz, G. ABGD, Automatic Barcode Gap Discovery for Primary Species Delimitation. Mol. Ecol. 2012, 21, 1864–1877. [Google Scholar] [CrossRef] [PubMed]
- Puillandre, N.; Brouillet, S.; Achaz, G. ASAP: Assemble Species by Automatic Partitioning. Mol. Ecol. Resour. 2021, 21, 609–620. [Google Scholar] [CrossRef] [PubMed]
- Vieira, C.; Brooks, C.M.; Akita, S.; Kim, M.S.; Saunders, G.W. Of Sea, Rivers and Symbiosis: Diversity, Systematics, Biogeography and Evolution of the Deeply Diverging Florideophycean Order Hildenbrandiales (Rhodophyta). Mol. Phylogenetics Evol. 2024, 197, 108106. [Google Scholar] [CrossRef]
- Guo, B.; Kong, L. Comparing the Efficiency of Single-Locus Species Delimitation Methods within Trochoidea (Gastropoda: Vetigastropoda). Genes 2022, 13, 2273. [Google Scholar] [CrossRef]
- Ren, J.; Ren, L.; Zhang, R. Delimiting Species, Revealing Cryptic Diversity, and Population Divergence in Qinghai-Tibet Plateau Weevils through DNA Barcoding. Ecol. Evol. 2024, 14, e11592. [Google Scholar] [CrossRef]
- Dartois, M.; Pante, E.; Viricel, A.; Becquet, V.; Sauriau, P.-G. Molecular Genetic Diversity of Seaweeds Morphologically Related to Ulva rigida at Three Sites along the French Atlantic Coast. PeerJ 2021, 9, e11966. [Google Scholar] [CrossRef] [PubMed]
- Muster, C.; Spelda, J.; Rulik, B.; Thormann, J.; von der Mark, L.; Astrin, J.J. The Dark Side of Pseudoscorpion Diversity: The German Barcode of Life Campaign Reveals High Levels of Undocumented Diversity in European False Scorpions. Ecol. Evol. 2021, 11, 13815–13829. [Google Scholar] [CrossRef]
- Kittle, R.P.; Veillet, A.; Schmidt, W.E.; Fredericq, S.; McDermid, K.J. Chondrus retortus (Gigartinales, Rhodophyta) in Hawai’i: A Taxonomic and Biogeographic Puzzle. Bot. Mar. 2024, 67, 15–30. [Google Scholar] [CrossRef]
- Gu, S.; Lai, L. Associating 197 Chinese Herbal Medicine with Drug Targets and Diseases Using the Similarity Ensemble Approach. Acta Pharmacol. Sin. 2020, 41, 432–438. [Google Scholar] [CrossRef]
- Yang, H.; Cui, D.; Xu, Z.; Lin, P. Analysis on the Components and Resource Situation of Seed Plants in the Wild Fruit Forest in Tianshan Mountain in China. J. Plant Resour. Environ. 2003, 12, 39–45. [Google Scholar]
- Li, L.; Jiang, Y.; Liu, Y.; Niu, Z.; Xue, Q.; Liu, W.; Ding, X. The Large Single-Copy (LSC) Region Functions as a Highly Effective and Efficient Molecular Marker for Accurate Authentication of Medicinal Dendrobium Species. Acta Pharm. Sin. B 2020, 10, 1989–2001. [Google Scholar] [CrossRef] [PubMed]
- Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; da Fonseca, G.a.B.; Kent, J. Biodiversity Hotspots for Conservation Priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Yang, D.; Deng, J.; Zhang, Z.; Zhou, X.; Wang, W.; Li, J. Construction of an Indicator System for Evaluating the Protection Efficacy of National Nature Reserves in China: A Case Study on Terrestrial Vertebrates (Excluding Migratory Birds). J. Appl. Ecol. 2015, 26, 1571–1578. [Google Scholar]
- Melese, E.; Pickel, D.; Soon, D.; Mack, J.; Tighe, S.L. Analytical Hierarchy Process as Dust Palliative Selection Tool. Int. J. Pavement Eng. 2020, 21, 908–918. [Google Scholar] [CrossRef]
- Wei, G.; Li, M.; Zhang, G.; Chen, Z.; Wei, F.; Jiao, S.; Qian, J.; Wang, Y.; Wei, J.; Wang, Y.; et al. Temporal Dynamics of Rhizosphere Communities Across the Life Cycle of Panax notoginseng. Front. Microbiol. 2022, 13, 853077. [Google Scholar] [CrossRef]
- Li, L.; Qin, H.; Lughadha, E.N.; Zheng, Y.; Wan, H.; Plummer, J.; Howes, M.-J.R.; Liu, H.; Jiang, Y.; Wang, T.; et al. Red List Assessments of Chinese Higher Plants. Int. J. Digit. Earth 2023, 16, 2762–2775. [Google Scholar] [CrossRef]
- Zang, C.; Cain, L.; Li, J. Preparation of the China Biodiversity Red List and Its Significance for Biodiversity Conservation within China. Biodivers. Sci. 2016, 24, 610–615. [Google Scholar] [CrossRef]
- Ministerie van Landbouw, N. en V. China Releases Updated Version of the Red List of Biodiversity-Nieuwsbericht-Agroberichten Buitenland. Available online: https://www.agroberichtenbuitenland.nl/actueel/nieuws/2023/07/03/biodiversity-in-china (accessed on 23 November 2024).
- Yu, J.; Wu, X.; Liu, C.; Newmaster, S.; Ragupathy, S.; Kress, W.J. Progress in the Use of DNA Barcodes in the Identification and Classification of Medicinal Plants. Ecotoxicol. Environ. Saf. 2021, 208, 111691. [Google Scholar] [CrossRef] [PubMed]
- Altun, A.; Garcia-Rates, M.; Neese, F.; Bistoni, G. Unveiling the Complex Pattern of Intermolecular Interactions Responsible for the Stability of the DNA Duplex. Chem. Sci. 2021, 12, 12785–12793. [Google Scholar] [CrossRef] [PubMed]
- Mao, X.; Xie, W.; Li, X.; Shi, S.; Guo, Z. Establishing Community-Wide DNA Barcode References for Conserving Mangrove Forests in China. BMC Plant Biol. 2021, 21, 571. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Liu, Q.; Lu, C.; Liu, Q.; Pan, J.; Zhang, J.; Dong, S. Genetic Diversity of Prunus armeniaca L. Var. Ansu Maxim. Germplasm Revealed by Simple Sequence Repeat (SSR) Markers. PLoS ONE 2022, 17, e0269424. [Google Scholar] [CrossRef] [PubMed]
- Chizzola, R.; Lohwasser, U. Diversity of Secondary Metabolites in Roots from Conium maculatum L. Plants 2020, 9, 939. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, J.; Garran, T.A.; Liu, H.; Lin, H.; Luo, J.; Yuan, Q.; Sun, J.; Dong, W.; Guo, L. Genetic Diversity and Population Divergence of Leonurus Japonicus and Its Distribution Dynamic Changes from the Last Interglacial to the Present in China. BMC Plant Biol. 2023, 23, 276. [Google Scholar] [CrossRef]
- Zhao, L.; Tian, S.; Wen, E.; Upur, H. An Ethnopharmacological Study of Aromatic Uyghur Medicinal Plants in Xinjiang, China. Pharm. Biol. 2017, 55, 1114–1130. [Google Scholar] [CrossRef] [PubMed]
- Taoerdahong, H.; Kadeer, G.; Chang, J.; Kang, J.; Ma, X.; Yang, F. A Review Concerning the Polysaccharides Found in Edible and Medicinal Plants in Xinjiang. Molecules 2023, 28, 2054. [Google Scholar] [CrossRef] [PubMed]
- Mohamad, O.A.A.; Gao, L.; Liu, Y.; Ma, J.; Li, W.; Li, L. Diversity and Antagonistic Effect of Endophytic Bacteria Isolated from Origanum Vulgare L.in Xinjiang. Microbiol. China 2021, 48, 1140–1150. [Google Scholar]
- Huang, Y.; Ma, J.; Li, K.; Liu, Y.; Li, W.; Li, L. Identification of Pathogens Causing Apple Valsa Canker in Xinjiang Wild Apple Forests and Antifungal Effect of Endophytic Bacteria from Medicinal Plants on the Pathogens. Microbiol. China 2023, 50, 175–184. [Google Scholar]
- Li, L.; Zhang, B.; Xiao, P.; Zhang, Z.; Qi, Y.; Li, X.; Wang, G.; Liu, H. Native Medicinal Plant Richness Distribution Patterns and Environmental Determinants of Xinjiang, Northwest China. Chin. Herb. Med. 2015, 7, 45–53. [Google Scholar] [CrossRef]
- Sun, J.; Liu, B.; Guo, L.; Huang, L. Significance of plant taxonomy in Chinese material medica resources:the changes of family and genus category and standardization of scientific names in Chinese Pharmacopoeia. Scientia Sinica Vitae 2021, 51, 579–593. [Google Scholar] [CrossRef]
- Khan, S.A.; Baeshen, M.N.; Ramadan, H.A.; Baeshen, N.A. ITS2: An Ideal DNA Barcode for the Arid Medicinal Plant Rhazya Stricta. Pharm. Med. 2019, 33, 53–61. [Google Scholar] [CrossRef]
- Zheng, M.; Liu, D.; Zhang, H.; Zhang, Y. Molecular Authentication of Medicinal and Edible Plant Gnaphalium affine (Cudweed Herb, “Shu-Qu-Cao”) Based on DNA Barcode Marker ITS2. Acta Physiol. Plant. 2021, 43, 119. [Google Scholar] [CrossRef]
- Kang, Y.; Deng, Z.; Zang, R.; Long, W. DNA Barcoding Analysis and Phylogenetic Relationships of Tree Species in Tropical Cloud Forests. Sci. Rep. 2017, 7, 12564. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.; Wang, H. Comprehensive Evaluation and Application of Woody Plants in the Green Spaces of Parks in Saline-Alkaline Areas from a Low-Carbon Perspective: A Case Study of Tianjin Qiaoyuan Park. PLoS ONE 2024, 19, e0303341. [Google Scholar] [CrossRef]
- Liang, J.; Chen, Y.; Tang, X.; Lu, Y.; Yu, J.; Wang, Z.; Zhang, Z.; Ji, H.; Li, Y.; Wu, P.; et al. Comprehensive Evaluation of Appreciation of Rhododendron Based on Analytic Hierarchy Process. Plants 2024, 13, 558. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST plus: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Mo, M.; Yang, L.; Mi, F.; Cao, Y.; Liu, C.; Tang, X.; Wang, P.; Xu, J. Exploring the Species Diversity of Edible Mushrooms in Yunnan, Southwestern China, by DNA Barcoding. J. Fungi 2021, 7, 310. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Li, D.-Z.; Gao, L.-M.; Li, H.-T.; Wang, H.; Ge, X.-J.; Liu, J.-Q.; Chen, Z.-D.; Zhou, S.-L.; Chen, S.-L.; Yang, J.-B.; et al. Comparative Analysis of a Large Dataset Indicates That Internal Transcribed Spacer (ITS) Should Be Incorporated into the Core Barcode for Seed Plants. Proc. Natl. Acad. Sci. USA 2011, 108, 19641–19646. [Google Scholar] [CrossRef]
- Lam-Tung, N.; Schmidt, H.A.; von Haeseler, A.; Bui, Q.M. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
- Liu, J.; Moeller, M.; Gao, L.-M.; Zhang, D.-Q.; Li, D.-Z. DNA Barcoding for the Discrimination of Eurasian Yews (Taxus L., Taxaceae) and the Discovery of Cryptic Species. Mol. Ecol. Resour. 2011, 11, 89–100. [Google Scholar] [CrossRef] [PubMed]
Items | ITS | matK | rbcL |
---|---|---|---|
Number of samples (individuals) | 109 | 109 | 109 |
Success rates for PCR amplification (%) | 100 | 100 | 100 |
Success rates for sequencing (%) | 100 | 100 | 100 |
Length range (bp) | 278–860 (678) | 662–926 (799) | 567–722 (591) |
GC content (%) | 48.6–66.6 (56.4) | 28.9–38.2 (33.86) | 41.8–45.7 (43.81) |
Polymorphic sites | 116 (10.17%) | 408 (35.17%) | 397 (51.36%) |
Nucleotide diversity (π) | 0.302 | 0.38 | 0.10 |
Non-parsimonious variable sites | 112 (9.82%) | 392 (33.79%) | 191 (24.71%) |
Aligned length (bp) | 1141 | 1160 | 773 |
Conserved sites | 70 (9.7%) | 24 (3.1%) | 151 (25.8%) |
Barcode Locus | Intra-Species Distance | Inter-Species Distance | ||||
---|---|---|---|---|---|---|
Minimum | Maximum | Mean | Minimum | Maximum | Mean | |
ITS | 0.000 | 1.479 | 0.096 | 0.000 | 2.434 | 0.676 |
matK | 0.000 | 1.298 | 0.168 | 0.000 | 1.434 | 0.626 |
rbcL | 0.000 | 0.009 | 0.0008 | 0.000 | 2.352 | 0.123 |
ITS + matK | 0.000 | 1.078 | 0.124 | 0.000 | 2.557 | 0.616 |
ITS + rbcL | 0.000 | 2.432 | 0.462 | 0.000 | 2.632 | 0.621 |
matK + rbcL | 0.000 | 2.034 | 0.599 | 0.000 | 2.771 | 0.678 |
ITS + matK + rbcL | 0.000 | 1.195 | 0.078 | 0.003 | 2.193 | 0.568 |
Species | Red List | Family | AHP Value | Endemic to Local (Y/N) | Ecological Type |
---|---|---|---|---|---|
Gagea serotina | - | Liliaceae | 0.60 | N | Perennial Herb |
Primula algida | LC | Primulaceae | 0.60 | Y | Perennial Herb |
Leonurus turkestanicus | LC | Lamiaceae | 0.60 | Y | Perennial Herb |
Lathyrus tuberosus | LC | Fabaceae | 0.60 | Y | Perennial Herb |
Inula racemosa | LC | Asteraceae | 0.60 | Y | Perennial Herb |
Ligularia heterophylla | LC | Asteraceae | 0.60 | Y | Perennial Herb |
Rheum wittrockii | LC | Polygonaceae | 0.60 | Y | Perennial Herb |
Aquilegia atrovinosa | LC | Ranunculaceae | 0.60 | Y | Perennial Herb |
Cynoglossum officinale | - | Boraginaceae | 0.60 | Y | Biennial Herb |
Doronicum altaicum | LC | Asteraceae | 0.60 | Y | Perennial Herb |
Arctium tomentosum | LC | Asteraceae | 0.60 | Y | Biennial Herb |
Conium maculatum | LC | Apiaceae | 0.61 | Y | Biennial Herb |
Oxytropis ochroleuca | LC | Fabaceae | 0.61 | Y | Perennial Herb |
Roemeria refracta | LC | Papaveraceae | 0.61 | Y | Annual herb |
Thymus marschallianus | LC | Lamiaceae | 0.61 | Y | Semishrubs |
Thymus proximus | LC | Lamiaceae | 0.61 | Y | Perennial Semishrubs |
Rosa laxa | LC | Rosaceae | 0.62 | Y | Shrubs |
Prunus armeniaca | NT | Rosaceae | 0.63 | N | Deciduous Tree |
Betula tianschanica | LC | Betulaceae | 0.63 | N | Perennial Tree |
Glycyrrhiza uralensis | NT | Fabaceae | 0.65 | N | Perennial Herb |
Rhodiola quadrifida | NT | Crassulaceae | 0.65 | N | Perennial Herb |
Pseudolysimachion alatavicum | NT | Plantaginaceae | 0.69 | Y | Perennial Herb |
Aconitum nemorum | NT | Ranunculaceae | 0.69 | Y | Perennial Herb |
Barcode | Primer | Sequence |
---|---|---|
ITS | ITS_LEU | GTCCACTGAACCTTATCATTTAG |
ITS4 | TCCTCCGCTTATTGATATGC | |
matK | matK472F | CCCRTYCATCTGGAAATCTTGGTTC |
matK1248R | GCTRTRATAATGAGAAAGATTTCTGC | |
rbcL | rbcLa_For | ATGTCACCACAAACAGAGACTAAAGC |
rbcLa_Rev | GTAAAATCAAGTCCACCRCG |
Criterion Layer (C) | Index Layer (P) |
---|---|
Endangered Category (D1, 0.3938) | Extinct (9) |
Critically Endangered (7) | |
Endangered (5) | |
Vulnerable or Near Threatened (3) | |
Least Concern (1) | |
Artificial planting (D2, 0.0438) | Unable to artificially breed (5) |
Artificial populations cannot form under natural conditions (3) | |
Artificial populations can form under natural conditions (1) | |
Conservation Status (D3, 0.0127) | Not Conserved (7) |
Not Effectively Regulated (5) | |
Conserved in situ, Translocated, or Isolated (3) | |
Restoration of Populations (1) | |
Threat Persistence (D4, 0.0410) | Persistence of Threatening Factors (5) |
Transient Threatening Factors (3) | |
Non-threatening Factors (1) | |
Domestic and international population impacts (D5, 0.0029) | Breeding from Abroad (5) |
No Effect within Domestic and Foreign populations (3) | |
No Population Decline at home or abroad (1) | |
Species Trade Impacts (D6, 0.0059) | Over-utilization (3) |
No Over-utilization (1) | |
Community Status (D7, 0.0041) | Dominant Species (7) |
Subdominant Species (5) | |
Companion Species (3) | |
No Effect on Other Species in the Community (1) | |
Organism Type (D8, 0.0289) | Tree (7) |
Shrub (5) | |
Perennial Herb (3) | |
Annual Herb (1) | |
Endemic Species (D9, 0.0545) | Provincial Endemic Species (7) |
Regional Endemic Species (5) | |
Chinese Endemic Species (3) | |
Non-Chinese endemic Species (1) | |
Species Status (D10, 0.0060) | Monotypic Family (9) |
Oligocene Species (7) | |
Monotypic Genus (5) | |
Oligotypic Genus (3) | |
Polyphyletic Genus (1) | |
The Status of Relict Species (D11, 0.0140) | Glacial Relict Plants (3) |
Non-Glacial Relict Plants (1) | |
Economic Values (D12, 0.0655) | Valuable for Development and Utilization (3) |
No Development or Utilization Value (1) | |
Hereditary Value (D13, 0.3270) | Unique utilization Value (5) |
Certain Utilization Value (3) | |
No Utilization Value (1) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiamahate, A.; Bozorov, T.A.; Wang, J.; Zhang, J.; Zhang, H.; Wang, X.; Yang, H.; Zhang, D. Insights from DNA Barcodes-Based Phylogenetic Analysis of Medicinal Plants and Estimation of Their Conservation Status: A Case Study in the Tianshan Wild Forest, China. Plants 2025, 14, 99. https://doi.org/10.3390/plants14010099
Jiamahate A, Bozorov TA, Wang J, Zhang J, Zhang H, Wang X, Yang H, Zhang D. Insights from DNA Barcodes-Based Phylogenetic Analysis of Medicinal Plants and Estimation of Their Conservation Status: A Case Study in the Tianshan Wild Forest, China. Plants. 2025; 14(1):99. https://doi.org/10.3390/plants14010099
Chicago/Turabian StyleJiamahate, Aerguli, Tohir A. Bozorov, Jiancheng Wang, Jianwei Zhang, Hongxiang Zhang, Xiyong Wang, Honglan Yang, and Daoyuan Zhang. 2025. "Insights from DNA Barcodes-Based Phylogenetic Analysis of Medicinal Plants and Estimation of Their Conservation Status: A Case Study in the Tianshan Wild Forest, China" Plants 14, no. 1: 99. https://doi.org/10.3390/plants14010099
APA StyleJiamahate, A., Bozorov, T. A., Wang, J., Zhang, J., Zhang, H., Wang, X., Yang, H., & Zhang, D. (2025). Insights from DNA Barcodes-Based Phylogenetic Analysis of Medicinal Plants and Estimation of Their Conservation Status: A Case Study in the Tianshan Wild Forest, China. Plants, 14(1), 99. https://doi.org/10.3390/plants14010099