Skip to Content
PlantsPlants
  • Article
  • Open Access

9 April 2024

Effect and Mechanism of L-Arginine against Alternaria Fruit Rot in Postharvest Blueberry Fruit

,
,
,
,
,
,
,
,
and
1
College of Food Science, Shenyang Agricultural University, Shenyang 110866, China
2
Key Laboratory of Protected Horticulture (Shenyang Agricultural University), Ministry of Education, Shenyang 110866, China
3
Shenyang Key Laboratory for Logistics Preservation and Packaging of Agricultural Products, Shenyang 110866, China
*
Author to whom correspondence should be addressed.

Abstract

This study aimed to explore the impact of L-arginine (Arg) on the development of resistance to Alternaria tenuissima (A. tenuissima) in blueberries. The metabolism of reactive oxygen species, pathogenesis-related proteins (PRs), and jasmonic acid (JA) biosynthesis pathways were analyzed, including changes in activity and gene expression of key enzymes. The results indicated that Arg treatment could prevent the development of Alternaria fruit rot in postharvest blueberries. In addition, it was also found to induce a burst of hydrogen peroxide in the blueberries early on during storage, thereby improving their resistance to A. tenuissima. Arg treatment was observed to increase the activity of antioxidant enzymes (peroxidase, catalase, superoxide dismutase, and ascorbate peroxidase) and related gene expression, as well as the total levels of phenolics, flavonoids, and anthocyanin in the blueberries. The activity and gene expression of the PRs (chitinase and β-1,3-glucanase) were elevated in Arg-treated blueberries, boosting their resistance to pathogens. Additionally, a surge in endogenous JA content was detected in Arg-treated blueberries, along with upregulated expression of key genes related the JA biosynthesis pathway (VcLOX1, VcAOS1, VcAOC, VcAOC3, VcOPR1, VcOPR3, VcMYC2, and VcCOI1), thereby further bolstering disease resistance. In conclusion, Arg treatment was determined to be a promising prospective method for controlling Alternaria fruit rot in blueberries.

1. Introduction

Blueberries (Vaccinium spp.) are highly perishable due to their soft skin, which leaves them susceptible to softening and rotting, leading to diminishing taste and nutritional value [1,2]. Blueberries are prone to mechanical damage after harvest and are easily infected by pathogens, such as Botrytis cinerea and Alternaria sp. These pathogens are known to cause fruit rot in postharvest blueberries [3,4]. Zhu and Xiao isolated and identified 283 strains of Alternaria sp. from rotten blueberry fruit in California, USA, including five species, Alternaria alternata, A. tenuissima, A. arborescens, A. infectoria, and A. rosae, respectively [5]. In our previous study, we have isolated and identified A. alternata, A. tenuissima, and A. dumosa in rotten blueberry fruit in Liaoning, China. Munitz et al. have found that A. tenuissima was the dominant pathogen of blueberry fruit in Concordia, Entre Ríos Province, Argentina [6]. In recent years, controlling Alternaria fruit rot in blueberries has attracted attention. Fungicides such as natamycin have been reported to control Alternaria fruit rot in blueberries [7]. Ethanol vapor has been found to enable effective defense responses against Alternaria rot in blueberries [8]. Biological control has also been used to prevent Alternaria fruit rot, such as the use of Bacillus subtilis (F9-2 and F9-12) and Pseudomonas koreensis (F9-9) [9]. For the past few years, several studies have been conducted to test the ability of natural compounds to control fruit rot in fruits and vegetables during postharvest. Of these, L-arginine (Arg) has gained interest among researchers.
Arg belongs to a group of semi-essential amino acids that are safe and beneficial for human health [10]. There has been a growing interest in the potential functions of Arg related to plants’ stress responses. In previous studies, tomato fruit treated with Arg and methyl salicylate has been found to effectively resist rot caused by Botrytis cinerea [11]. Arg treatment was also found to induce resistance to Alternaria alternata in jujube fruit [12]. Our previous study found that Arg treatment maintained the quality of postharvest blueberries and activated the antioxidant system [13]. However, the effect and potential mechanism of Arg treatment in inducing resistance to A. tenuissima in blueberries remains unclear.
Plants have specific defense responses, such as the production of reactive oxygen species (ROS) and pathogenesis-related proteins (PRs), in the face of stress triggers [14]. In addition, jasmonic acid (JA) is a kind of endogenous plant hormone that is important for defense against pathogens in plants [15]. JA has been found to trigger a generation of secondary metabolites that induce systemic resistance (ISR) in plants, which can not only give rise to physiological changes that form defensive structures but also induce gene expression [16]. ISR mediated by JA, along with JA accumulation, is related to the regulation of resistance to necrotrophs in plants [17]. In the JA biosynthesis pathway, key enzymes such as lipoxygenase (LOX), 12-oxo-phytodienoic acid reductase (OPR), allene oxide cyclase (AOC), and allene oxide synthase (AOS), play important roles [18,19,20].
Through our previous research, we determined that Arg treatment maintains fruit quality in postharvest blueberries by improving their antioxidant capacity. However, it is still unclear whether Arg treatment can induce resistance to A. tenuissima-related decay in postharvest blueberries. Hence, this study aims to explore whether Arg treatment can induce postharvest resistance in blueberries contaminated by A. tenuissima. Through this study and the analysis of the activities and related gene expression levels of ROS metabolism and PRs, we aim to elucidate the mechanism of defense response initiation in Arg-treated blueberries. We also aim to monitor endogenous JA content and key gene expression levels related to metabolic pathways after Arg treatment. Our findings could be meaningful for controlling postharvest disease in blueberries and may provide novel evidence supporting the use of Arg.

2. Results

2.1. Arg Treatment Mitigated Disease Symptoms in Blueberries Inoculated with A. tenuissima

The blueberries began to rot two days post inoculation (Figure 1A). Over time, the disease index was found to increase gradually in both groups. During storage, Arg treatment was found to significantly reduce the disease index in the blueberries (p < 0.05). At six days, the disease index in the Arg-treated group was 32.05% lower than in the control. The fruit rot symptoms at six days are shown in Figure 1B. These findings indicate that Arg treatment inhibited the blueberry fruit rot caused by A. tenuissima.
Figure 1. Disease index (A) in control and L-arginine (Arg) treatment of inoculated blueberries. Symptoms of control and Arg-inoculated blueberry fruit at 6 d (B). The data and bar represent three repeating averages and standard deviations. The asterisk indicates a significant difference between the control and Arg groups based on the independent sample t-test (* p < 0.05, ** p < 0.01).

2.2. Effect of Arg Treatment on β-1,3-Glucanase (GLU) and Chitinase (CHI) Activities and Relative Gene Expression Levels in Inoculated Blueberries

It was observed that GLU activity in Arg-treated blueberries increased progressively and peaked at three days, before steadily declining (Figure 2A). The control blueberries displayed a similar pattern, with GLU activity peaking at four days. The GLU activity was found to be significantly higher in Arg-treated blueberries than control at 0.25, 0.5, 1, 2, and 3 days (p < 0.05). Furthermore, the CHI activity of Arg-treated fruit was significantly higher than the control group, at 0.25, 2, 4, 5, and 6 days (p < 0.05) (Figure 2C).
Figure 2. Changes in GLU (A) activity and VcGLU2 relative expression (B). The activity of chitinase (CHI) (C) and relative expression of VcCHI (D). The data and bar represent three repeating averages and standard deviations. * p < 0.05, ** p < 0.01.
We also measured the relative gene expressions of the involved enzymes. Throughout storage, Arg was found to increase VcGLU2 expression, which remained significantly higher in the Arg-treated blueberries at 0.25–2 days as compared to the controls (Figure 2B). Notably, VcCHI expression increased within the first two days but decreased thereafter (Figure 2D). VcCHI expression was found to be significantly higher in Arg-treated blueberries at 0.5 days and 1 day than in the controls.

2.3. Effect of Arg Treatment on Endogenous JA Content and Gene Expression Levels Involved in JA Biosynthesis in Inoculated Blueberries

According to Figure 3A, the JA content in the Arg-treated blueberries peaked at four days but subsequently decreased between four and six days. Meanwhile, the endogenous JA content of the Arg-treated blueberries increased before four days and remained significantly higher compared to that of the control blueberries at 1, 2, 3, and 4 days. It was found to be 2.33 times higher than the control at four days. These findings indicate that Arg treatment stimulated the synthesis of endogenous JA.
Figure 3. Changes in JA content (A), and the relative gene expression levels of VcLOX1 (B), VcAOS1 (C), VcAOC (D), VcAOC3 (E), VcOPR1 (F), VcOPR3 (G), VcMYC2 (H), and VcCOI1 (I) of control and L-arginine (Arg) treatment in inoculated blueberry fruit groups. The data and bars represent the average values and standard deviation of three replicates. * p < 0.05, ** p < 0.01.
Moreover, we analyzed the relative gene expression levels involved in JA biosynthesis, containing VcLOX1, VcAOS1, VcAOC, VcAOC3, VcOPR1, VcOPR3, VcMYC2, and VcCOI1 (Figure 3). As Figure 3B illustrates, VcLOX1 expression remained significantly higher in Arg group than the control blueberries during the initial time of storage (0.25, 0.5, and 1 day). VcAOS1 expression in the Arg-treated group rose sharply in two days, remaining significantly higher than the control at 0.5 and 2–4 days (Figure 3C). The expression of VcAOS1 in Arg-treated blueberries peaked at four days, approximately 3.12 times higher than in the controls. VcAOC expression in Arg-treated blueberries remained significantly higher than in the controls at 0.25, 0.5, and 3–5 days (p < 0.05) (Figure 3D). As demonstrated in Figure 3E, VcAOC3 expression was found to be significantly higher in the Arg treatment group at 1, 3, and 4 days (p < 0.05). The relative expression of VcOPR1 peaked at four days and subsequently declined (Figure 3F). VcOPR1 expression in the Arg-treated blueberries was observed to be significantly higher than in the control blueberries at 0.5–4 days. Nevertheless, the expression of VcOPR3 in Arg treatment remained significantly higher than control at 0.5 days and 1 day (Figure 3G). As shown in Figure 3H, Arg treatment upregulated VcMYC2 expression in blueberries. Notably, VcMYC2 expression in Arg-treated blueberries peaked at two days, 4.20 times higher than in the controls. As demonstrated in Figure 3I, Arg-treated blueberries exhibited higher VcCOI1 expression than the controls at 0.25 and 0.5 days (p < 0.05). Hence, it was indicated that VcLOX1, VcAOS1, VcAOC, VcAOC3, VcOPR1, VcOPR3, VcMYC2, and VcCOI1 were substantially upregulated in Arg-treated blueberries. Overall, exogenous Arg treatment enhanced the endogenous JA content of the blueberries, likely by activating related genes in the JA biosynthesis pathway.

2.4. Effect of Arg Treatment on Hydrogen Peroxide (H2O2) and Malondialdehyde (MDA) Content in Inoculated Blueberries

Changes in H2O2 content after inoculating A. tenuissima in the blueberries were determined (Figure 4A). Variation in H2O2 content exhibited similar trends in both groups. However, H2O2 content in the Arg treatment group was higher at 0.5 days and 1 day, indicating that Arg treatment catalyzed an early occurrence of oxidative stress. During the middle and late stages (2, 3, 5, and 6 days), it was observed that the Arg-treated blueberries produced significantly less H2O2 than the control blueberries. MDA content was significantly lower in the Arg-treated blueberries at 2–6 days than in the controls (Figure 4B).
Figure 4. The content of H2O2 (A) and MDA (B) of inoculated blueberry fruit in control and L-arginine (Arg) group. The data are expressed as three repeated mean ± standard deviation. ** p < 0.01.

2.5. Effect of Arg Treatment on Antioxidant Enzyme Activities and Related Gene Expression in Inoculated Blueberries

Following Arg treatment, the activity of superoxide dismutase (SOD) rose during the first two days and declined thereafter (Figure 5A). Compared to the controls, the Arg-treated blueberries exhibited higher SOD activity during storage; the difference was significant except at two and five days. The catalase (CAT) and ascorbate peroxidase (APX) activity of the Arg group were higher than at 0 d. CAT activity in the Arg-treated blueberries rose before the initial 0.5 days, and was three-fold higher than that of the controls (Figure 5C). Moreover, Arg-treated blueberries showed significantly higher CAT activity than the controls at 0.5, 1, 4, and 5 days. APX activity peaked at one day in both groups (Figure 5E) and remained significantly higher in the Arg treatment group at 0.25, 0.5, 3, and 4 days than in the controls. Peroxidase (POD) activity in the Arg-treated blueberries was found to be significantly higher than in the controls at 0.25, 0.5, and 3 days (Figure 5G).
Figure 5. The activities of SOD (A), CAT (C), APX (E), and POD (G). The relative expression of VcSODCC.2 (B), VcCAT2 (D), VcAPX1 (F), and VcPOD24 (H). The data and bars represent three repeating averages and standard deviations. * p < 0.05; ** p < 0.01.
The expression levels of the antioxidant enzymes in blueberries inoculated with A. tenuissima were evaluated (Figure 5). VcSODCC.2 expression in the Arg-treated group increased first and peaked at two days, significantly higher than control at initial time (0.25–2 days) (Figure 5B). As evinced in Figure 5D, the VcCAT2 expression in the Arg group was significantly higher than in the controls at 0.5–3 days of storage. Likewise, Arg treatment was found to promote VcAPX1 expression during storage (Figure 5F). The difference was significant at 1–3 d. However, there was a significant drop in VcPOD24 expression observed at 0.5 days in control (Figure 5H). The Arg-treated blueberries exhibited significantly higher VcPOD24 expression than control during storage at 0.5 and 4 days. Based on these findings, it is indicated that Arg treatment triggered an antioxidative response in blueberries infected by A. tenuissima.

2.6. Effect of Arg Treatment on Total Phenolic, Flavonoid, and Anthocyanin Content in Inoculated Blueberries

Total phenolic content in both groups remained steady even at prolonged storage times. At 0.25, 2, 3, and 4 days, total phenolic content in the Arg-treated blueberries was significantly higher than in the controls (Figure 6A). Notably, at day 2, the total phenolic content following Arg treatment was 26.9% higher than control. Moreover, the flavonoid content in the Arg group was significantly higher than control at 0.5 and 2–4 days, peaking at 4 days (Figure 6B). The anthocyanin content increased first and declined thereafter in both groups, with the Arg-treated blueberries exhibiting significantly higher content at 2–4 days (Figure 6C).
Figure 6. Content of total phenolics (A), flavonoids (B), and anthocyanin (C) of control and L-arginine (Arg) treatment in inoculated blueberry fruit. * p < 0.05, ** p < 0.01.

3. Discussion

Our findings indicate that Arg treatment inhibited the disease index and improved resistance to A. tenuissima in blueberries. Arg treatment was found to enhance the activities and gene transcription levels of GLU and CHI and activate ROS metabolism. In addition, Arg treatment promoted JA accumulation by upregulating gene expression involved in JA biosynthesis.
ROS may function as signaling molecules that induce disease resistance-related responses [21]. Considering that the H2O2 content in the Arg-treated group increased initially during storage, it was indicated that Arg treatment resulted in an occurrence of oxygen stress (Figure 4). The same finding has been shown for blueberries treated with burdock fructooligosaccharides and cherry tomatoes treated with melatonin [22,23]. However, further evidence has also demonstrated that excessive ROS can adversely affect disease resistance [24,25,26]. Fruits and vegetables have a self-regulatory protection mechanism that activates the antioxidant defense system, thereby inhibiting excessive ROS accumulation and reducing oxidative damage [27,28]. This antioxidant defense system contains antioxidant enzymes, including APX, SOD, CAT, and POD, which can prevent the over-production of ROS [29]. At 0–0.5 d, the SOD activity in control group remained at low levels under the stress of pathogen. However, the SOD activity in Arg-treated fruit was significantly higher than in control, and Arg treatment induced the resistance of blueberry fruit to pathogen in this process (p < 0.05). At 0.5–2 d, the SOD activity in Arg-treated fruit was enhanced, which could be due to the antioxidant defense system in Arg-treated blueberry fruit was stimulated to defense pathogen. Through our study, we discovered that Arg treatment could increase CAT, SOD, POD, and APX activity and promote related gene expression in blueberries (Figure 5). Similar to our results, blueberries treated with thymol have been shown to exhibit higher SOD, CAT, and POD activity to control postharvest disease against Aspergillus niger [30].
GLU and CHI are PRs, which are hydrolases produced to improve plant resistance to foreign pathogenic bacteria [31]. Research has found that low-dose UV-C irradiation and melatonin treatment could enhance GLU and CHI enzyme activity and related gene expression, thereby promoting resistance to fungal decay [32,33]. Quercetin treatment has been proven to activate GLU and CHI and upregulate the related gene expression levels, thereby inducing resistance to Penicillium expansum in kiwifruit [34]. In our study, we determined Arg treatment improved GLU and CHI activity in blueberries as well as the gene expression of VcGLU2 and VcCHI, thereby inducing resistance to A. tenuissima (Figure 2). In addition, polyphenolic compounds, as an abundant secondary metabolite in plants, are known to have a key role in inhibiting pathogenic growth [35]. Arg treatment was found to maintain higher content of total phenolics, flavonoids, and anthocyanin in postharvest blueberries, thereby improving disease resistance (Figure 6).
The JA biosynthesis pathway acts an essential role in plant resistance to disease [36,37]. Plants activate the JA signaling pathway as a part of their defense responses, the possible mechanism of which is that JA can induce the transcription of related genes and promote secondary metabolism [38]. Endogenous JA content is involved in a plant’s resistance to a pathogen, which is induced by elicitor treatment [39]. In our study, Arg treatment was found to promote JA accumulation in blueberries. Similarly, in previous research, endogenous JA content was found to increase in peaches treated with sodium nitroprusside, thereby enhancing their resistance to Monilinia fructicola [40]. The biosynthesis of JA is mainly catalyzed by key enzymes (LOX, AOS, AOC, and OPR). When JA levels were low, the JAZ degradation rate reduced and the release of transcription factor MYC2 was inhibited, thus inhibiting JA response in plants [41]. Methyl jasmonate (MeJA) was found to induce the relative expression of PpLOX, PpOPR3, and PpAOS in peaches to resist Rhizopus stolonifera [42]. MeJA also promotes key gene expression required for JA biosynthesis (PavLOX, PavAOS, PavOPR3, and PavMYC2) and improves resistance to A. tenuissima in sweet cherries [43]. Similarly, blueberries treated with melatonin have been found to induce resistance through the JA signaling pathway [44]. In the present study, Arg treatment could induce the gene expression levels in the blueberries involved in JA biosynthesis (VcLOX1, VcAOS1, VcAOC, VcAOC3, VcOPR1, VcOPR3, VcMYC2, and VcCOI1), ultimately activating the JA signaling pathway (Figure 3). Furthermore, the findings indicated that Arg treatment induced resistance to A. tenuissima in blueberries through triggering JA biosynthesis. Therefore, our findings provided evidence indicating that Arg treatment activated PRs and antioxidant enzymes, stimulated JA production, and further enhanced resistance to A. tenuissima in blueberries (Figure 7).
Figure 7. Supposed L-arginine (Arg) mechanism that induces resistance against A. tenuissima in postharvest blueberry fruit. This figure was drawn by Figdraw.
In sum, these findings provide additional evidence indicating that Arg stimulates the production of JA, further enhancing resistance to A. tenuissima in blueberry fruit. In our upcoming study, we aim to explore the role of Arg in controlling the postharvest blueberry fruit against A. tenuissima. Our research will focus on the molecular biology aspect of the transcription factors (TFs), further exploring the regulation mechanism of Arg on disease resistance.

4. Materials and Methods

4.1. Pathogen

The strain B20190712E1, previously isolated from rotten blueberries, was identified as A. tenuissima [22]. It was cultured on potato dextrose agar at 25 °C for 15 days and a spore suspension of 1 × 105 CFU mL−1 was prepared.

4.2. Arg Treatment and Pathogen Inoculation

The blueberries (cv. Bluecrop) were picked in Shenyang, Liaoning, China (123°27′ E, 41°48′ N). Blueberries with the same size and level of maturity were selected for further testing.
A 2% (w/v) sodium hypochlorite solution was used to soak and disinfect the blueberries for three minutes. Samples were washed carefully using distilled water, dried, and divided into two groups, each containing 3 kg of blueberries. In the control group, the blueberries were sprayed with sterile water; for the Arg treatment group, the blueberries were sprayed with 1 mM Arg solution. Both groups were applied with the same amount. After 12 h, the spore suspension (10 μL) containing 1.0 × 105 CFU mL−1 of A. tenuissima was inoculated at the pedicle. The experiments were repeated three times. The treated blueberries were subsequently stored at 20 °C and 80% RH, and samples were taken at 0, 0.25, 0.5, 1, 2, 3, 4, 5, and 6 days after inoculation.

4.3. Assessment of Disease Index

The disease index of blueberry fruit was measured according to methods developed by Wang [45]. The percentage of the total damaged surface area in each blueberry in relation to the total epidermal area of the blueberry was graded. The scale was as follows: Scale 0, no visible rot on the fruit; scale 1, slight decay observed on the fruit and a decayed area lower than 25%; scale 2, moderate decay and a decayed area between 25% and 50%; scale 3, severe decay and a decayed area higher than 50%. The experiment was conducted three times. Each group contained approximately 120 blueberry fruits. The disease index calculation can be expressed as follows:
Disease Index (%) = ∑(S × N)/(N0 × S0) × 100%
where S represents the disease scale, N represents the number of fruits of the corresponding scale, N0 represents the total quantity of fruits, and S0 represents the maximum scale.

4.4. Assessment of JA Content

An ELISA kit was used to measure JA content according to the instructions (Jiangsu Meimian Industrial, Yancheng, China).

4.5. Measurement of GLU and CHI Activity

ELISA kits (Jiangsu Baolai Technology, Yancheng, China) were utilized to determine GLU and CHI activity, with reference to Shu [46] for modifications.

4.6. Measurement of ROS Levels and Key Antioxidant Enzyme Activities

4.6.1. Determination of H2O2 and MDA Levels

H2O2 content was determined by methods developed by Yan [47], with a few changes. First, 3.0 g of blueberry tissue was weighed and homogenized with 5.0 mL of pre-cooled acetone, and then centrifuged (12,000× g at 4 °C for 20 min). Subsequently, the precipitate was washed with pre-cooled acetone, dissolved in sulfuric acid solution (3 mL 2 mol L−1), and examined at 412 nm.
To measure MDA content, we followed the methods developed by Ma [48]. We homogenized 3.0 g of blueberry tissue in 10% (w/v) trichloroacetic acid (TCA). This mixture was subsequently centrifuged (10,000× g at 4 °C for 20 min). The supernatant was collected and its absorbance was determined at 450, 532, and 600 nm.

4.6.2. Analysis of Antioxidant Enzyme Activity

The method developed by Ge [49] was used to measure SOD activity with some modifications. One SOD activity unit was determined to be the quantity of enzyme that inhibited 50% of the photochemical reduction of nitroblue tetrazolium (NBT), estimated at 560 nm.
The method developed by Wang [50] was utilized with some changes for the assessment of CAT activity. Approximately 3.0 g blueberry tissue was added to 5 mL of extraction buffer, which contained 5 mmol L−1 dithiothreitol (DTT) and 5% polyvinylpolypyrrolidone. The mixture underwent homogenization and was centrifuged at 4 °C and 12,000× g for 30 min. A CAT enzymatic reaction system of 0.01 reduction per gram in one minute was determined to be one unit of CAT activity.
The APX activity was assayed using methods described by Ren [51], with some changes. First, 3.0 g blueberry fruit tissue was ground in 5 mL extraction buffer, which contained 0.1 mmol L−1 EDTA, 1 mmol L−1 ascorbic acid, and 2% PVPP. Then, the mixture was centrifuged. One unit of APX was determined to be the required quantity to achieve a 0.01 reduction in the fruit sample (290 nm) every minute.
POD activity was assayed with slight modifications based on methods developed by Alijani [52]. The extraction buffer contained 4% crosslinked polyvinyl-poly-pyrrolidone (PVPP) (w/v), 1 mmol polyethylene glycol 6000 (PEG 6000), and 1% Triton X-100 (v/v). A total of 3.0 g of fresh blueberry tissue was homogenized in extraction buffer (5 mL) and centrifuged. One unit of POD activity was defined as the amount of POD required to enhance the absorbance (470 nm) by 1 nm in one minute.

4.7. Measurement of Total Phenolic, Flavonoid, and Anthocyanin Content

Phenolic, flavonoid, and anthocyanin content was evaluated using the method presented by Wang [53], with some changes. The mass of gallic acid equivalents was used to characterize the total phenolic content measured at 280 nm. Flavonoid and anthocyanin content were expressed as the mass of rutin and cyanidin-3-glucoside equivalents, respectively. The absorbance was determined at 280, 325, 600, and 530 nm.

4.8. Real-Time Quantitative PCR (RT-qPCR)

Several differentially expressed genes involved in ROS, PRs, and JA biosynthesis pathways were identified by transcriptomic analysis of inoculated control and Arg-treated blueberries. Primer 5.0 (Premier Biosoft, Palo Alto, CA, USA) was used to design gene primers (Appendix A Table A1) and the primers were synthesized by Sangon (Shanghai, China). RT-qPCR amplification and analysis were conducted by the UltraSYBR Master Mix Kit (CWBIO, Beijing, China). The relative gene expression was computed by the 2−∆∆CT method. For internal reference, we used the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene [54].

4.9. Statistical Analysis

The experiments were repeated three times. In this study, the t-test was performed to analyze data using SPSS Statistics 25, and p-values where p < 0.05 were considered to be statistically significant. In addition, GraphPad Prism 8 (GraphPad Software Inc., La Jolla, CA, USA) was used for data analysis and graphics.

5. Conclusions

Arg treatment was found to induce resistance to A. tenuissima in postharvest blueberries. In particular, Arg was observed to trigger an initial increase in H2O2, leading to an early defense response in the Arg-treated blueberries. Arg treatment was found to protect the blueberry fruit from oxidative damage. Arg also induced resistance to A. tenuissima by facilitating the gene expression of GLU, CHI, and antioxidant enzymes. Furthermore, Arg treatment stimulated JA production by inducing the expression of key genes in JA biosynthesis, thus triggering the defense response. Therefore, Arg treatment may be a promising and effective method to control Alternaria fruit rot in postharvest blueberries.

Author Contributions

Conceptualization, J.W.; methodology, J.W.; formal analysis, R.Z.; supervision, Y.L.; methodology, L.Y.; software, H.R.; validation, M.G.; investigation, B.S.; resources, Y.Z.; data curation, Y.X.; writing—original draft preparation, J.W.; writing—review and editing, J.W. and X.Y; visualization, B.S.; supervision, Y.Z.; project administration, Y.X.; funding acquisition, X.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R & D Program of China (2022YFD1600500) and the Liaoning Revitalization Talents Program (XLYC2002053).

Data Availability Statement

Data are available from the authors upon request. The data are not publicly available due to privacy.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Primers for real-time RT-qPCR assays.
Table A1. Primers for real-time RT-qPCR assays.
GeneForward (5′-3′)Reverse (5′-3′)
GADPH
VcPOD24
VcCAT2
ACTACCATCCACTCTATCACCG
AAGCAGCCTAAATGGGACG
ATGGAGTATTTGCTGGGTCTG
AACACCTTACCAACAGCCTTG
TGAGCACCTGATAACACTACAAGAGGATCTAGCGCATAGTATGGTAC
VcAPX1CTCCTGCTAGGGCTTTGGCCCTCGCTCACAGTCGGGTA
VcSODCC.2
VcGLU2
VcCHI
VcAOC
VcAOC3
VcCOI1
VcAOS1
VcLOX1
VcOPR1
VcOPR3
VcMYC2
AAGATGGGTACTGTGAAAGCG
ATGCTTCTCGCCCTTGC
ATCCGCTCATCGCTTACA
TCTGACCGCCACCTCTACCG
TTACGAGATGAACGAGGGAGA
TGGGTGCCATAAACTCCG
GGCTACCGAATCCTTTCTTACCT
GGATCACCATGATGCGCTAA
TTTTAGGTTTCAGGGACAGGA
ACCAAGGAACAAGTGGAGGCA
GGTAGGAAACCAGCAAACGG
GAATTGCAGCCGTTGGTG
GTGATATTGGTGTCTGGGTAATG
CACTCCAATGCACCGTTA
AAGCTGGGCTGCCACGA
CAGCTTGTTACTGAACGGGAC
CAGAAGCATCCACCTCACG
GTTGGCATCTCCGAAACTGG
ATGGCTTCAGTGTTCCGTCA
TTGGTCGGGCAGTGGTG
TCGTGGATGAAATCGGAGC
CGCAATCGCATCACCAAGT

References

  1. Dai, H.; Li, B.; Song, Z.; Tian, J.; Wei, B.; Lang, X.; Zhou, Q. Anthocyanin treatment delays the senescence of blueberry fruit by regulating abscisic acid and anthocyanin synthesis processes. Food Qual. Saf. 2024, 8, fyad053. [Google Scholar] [CrossRef]
  2. Song, X.; Dai, H.; Wang, S.; Ji, S.; Zhou, X.; Li, J.; Zhou, Q. Putrescine Treatment Delayed the softening of postharvest blueberry fruit by inhibiting the expression of cell wall metabolism key gene VcPG1. Plants 2022, 11, 1356. [Google Scholar] [CrossRef]
  3. Pratap-Singh, A.; Shojaei, M.; Singh, A.; Ye, Y.; Mandal, R.; Yan, Y.; Pico, J.; Gerbrandt, E.M.; Castellarin, S.D. Effects of pulsed light on the post harvest quality and shelf-life of highbush blueberries (cv. Draper). Appl. Food Res. 2023, 3, 100273. [Google Scholar] [CrossRef]
  4. Bell, S.R.; Hernández Montiel, L.G.; González Estrada, R.R.; Gutiérrez Martínez, P. Main diseases in postharvest blueberries, conventional and eco-friendly control methods: A review. LWT Food Sci. Technol. 2021, 149, 112046. [Google Scholar] [CrossRef]
  5. Zhu, X.; Xiao, C. Phylogenetic, morphological, and pathogenic characterization of Alternaria species associated with fruit rot of blueberry in California. Phytopathology 2015, 105, 1555–1567. [Google Scholar] [CrossRef] [PubMed]
  6. Munitz, M.S.; Garrido, C.E.; Gonzalez, H.H.L.; Resnik, S.L.; Montti, M.T. Mycoflora and potential mycotoxin production of freshly harvested blueberry in Concordia, Entre Ríos Province, Argentina. Int. J. Fruit. Sci. 2013, 13, 312–325. [Google Scholar] [CrossRef]
  7. Wang, F.; Saito, S.; Michailides, T.J.; Xiao, C.L. Postharvest use of natamycin to control Alternaria rot on blueberry fruit caused by Alternaria alternata and A. arborescens. Postharvest Biol. Technol. 2021, 172, 111383. [Google Scholar] [CrossRef]
  8. Ji, Y.; Hu, W.; Liao, J.; Xiu, Z.; Jiang, A.; Yang, X.; Guan, Y.; Feng, K.; Saren, G. Effect of ethanol vapor treatment on the growth of Alternaria alternata and Botrytis cinerea and defense-related enzymes of fungi-inoculated blueberry during storage. Front. Microbiol. 2021, 12, 618252. [Google Scholar] [CrossRef] [PubMed]
  9. Kurniawan, O.; Wilson, K.; Mohamed, R.; Avis, T.J. Bacillus and Pseudomonas spp. provide antifungal activity against gray mold and Alternaria rot on blueberry fruit. Biol. Control 2018, 126, 136–141. [Google Scholar] [CrossRef]
  10. McNeal, C.J.; Meininger, C.J.; Reddy, D.; Wilborn, C.D.; Wu, G.Y. Safety and effectiveness of Arginine in adults. J. Nutr. 2016, 146, 2587–2593. [Google Scholar] [CrossRef]
  11. Zhang, X.H.; Min, D.D.; Li, F.J.; Ji, N.N.; Meng, D.M.; Li, L. Synergistic effects of L-Arginine and methyl salicylate on alleviating postharvest disease caused by Botrysis cinerea in tomato fruit. J. Agric. Food Chem. 2017, 65, 4890–4896. [Google Scholar] [CrossRef]
  12. Chang, L.; Yu, Y.; Zhang, L.; Wang, X.; Zhang, S. Arginine induces the resistance of postharvest jujube fruit against Alternaria rot. Food Qual. Saf. 2022, 6, fyac008. [Google Scholar] [CrossRef]
  13. Wang, J.; Wang, Y.; Li, Y.; Yang, L.; Sun, B.; Zhang, Y.; Xu, Y.; Yan, X. L-Arginine treatment maintains postharvest quality in blueberry fruit by enhancing antioxidant capacity during storage. J. Food Sci. 2023, 88, 3666–3680. [Google Scholar] [CrossRef] [PubMed]
  14. Shoresh, M.; Harman, G.E.; Mastouri, F. Induced systemic resistance and plant responses to fungal biocontrol agents. Annu. Rev. Phytopathol. 2010, 48, 21–43. [Google Scholar] [CrossRef] [PubMed]
  15. Lv, J.; Zhang, M.; Zhang, J.; Ge, Y.; Li, C.; Meng, K.; Li, J. Effects of methyl jasmonate on expression of genes involved in ethylene biosynthesis and signaling pathway during postharvest ripening of apple fruit. Sci. Hortic. 2018, 229, 157–166. [Google Scholar] [CrossRef]
  16. Zhang, L.; Zhang, F.; Melotto, M.; Yao, J.; He, S.Y. Jasmonate signaling and manipulation by pathogens and insects. J. Exp. Bot. 2017, 68, 1371–1385. [Google Scholar] [CrossRef] [PubMed]
  17. Fu, Z.Q.; Dong, X. Systemic acquired resistance: Turning local infection into global defense. Annu. Rev. Plant Biol. 2013, 64, 839–863. [Google Scholar] [CrossRef]
  18. Hause, B.; Wasternack, C.; Strack, D. Jasmonates in stress responses and development. Phytochemistry 2009, 70, 1483–1484. [Google Scholar] [CrossRef]
  19. Wasternack, C.; Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 2013, 111, 1021–1058. [Google Scholar] [CrossRef]
  20. Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu. Rev. Plant Biol. 2002, 53, 275–297. [Google Scholar] [CrossRef]
  21. Wang, M.Y.; Zhao, L.N.; Zhang, X.Y.; Dhanasekaran, S.; Abdelhai, M.H.; Yang, Q.Y.; Jiang, Z.H.; Zhang, H.Y. Study on biocontrol of postharvest decay of table grapes caused by Penicillium rubens and the possible resistance mechanisms by Yarrowia lipolytica. Biol. Control 2018, 130, 110–117. [Google Scholar] [CrossRef]
  22. Wang, Y.; Wang, J.; Li, Y.; Yang, L.; Sun, B.; Zhang, Y.; Xu, F.; Yan, X. Controlling effect and mechanism of burdock fructooligosaccharide against Alternaria fruit rot in blueberry during postharvest. Postharvest Biol. Technol. 2023, 196, 112175. [Google Scholar] [CrossRef]
  23. Li, S.; Xu, Y.; Bi, Y.; Zhang, B.; Shen, S.; Jiang, T.; Zheng, X. Melatonin treatment inhibits gray mold and induces disease resistance in cherry tomato fruit during postharvest. Postharvest Biol. Technol. 2019, 157, 110962. [Google Scholar] [CrossRef]
  24. Yun, Z.; Gao, H.; Chen, X.; Chen, Z.; Zhang, Z.; Li, T.; Qu, H.; Jiang, Y. Effects of hydrogen water treatment on antioxidant system of litchi fruit during the pericarp browning. Food Chem. 2021, 336, 127618. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, L.; Shi, X.; Hou, H.; Lin, Q.; Zhu, S.; Wang, G. 6-Benzyladenine treatment maintains storage quality of Chinese flowering cabbage by inhibiting chlorophyll degradation and enhancing antioxidant capacity. Plants 2023, 12, 334. [Google Scholar] [CrossRef] [PubMed]
  26. Mittler, R. ROS are good. Trends Plant Sci. 2017, 22, 11–19. [Google Scholar] [CrossRef] [PubMed]
  27. Et-tazy, L.; Lamiri, A.; Satia, L.; Essahli, M.; Krimi Bencheqroun, S. In vitro antioxidant and antifungal activities of four essential oils and their major compounds against post-harvest fungi associated with chickpea in storage. Plants 2023, 12, 3587. [Google Scholar] [CrossRef]
  28. Tan, X.; Zhao, Y.; Shan, W.; Kuang, J.; Lu, W.; Su, X.; Tao, N.; Lakshmanan, P.; Chen, J. Melatonin delays leaf senescence of postharvest Chinese flowering cabbage through ROS homeostasis. Food Res. Int. 2020, 138, 109790. [Google Scholar] [CrossRef]
  29. Sang, Y.; Liu, Y.; Tang, Y.; Yang, W.; Guo, M.; Chen, G. Transcriptome sequencing reveals mechanism of improved antioxidant capacity and maintained postharvest quality of winter jujube during cold storage after salicylic acid treatment. Postharvest Biol. Technol. 2022, 189, 111929. [Google Scholar] [CrossRef]
  30. Ding, J.; Liu, C.; Huang, P.; Zhang, Y.; Hu, X.; Li, H.; Liu, Y.; Chen, L.; Liu, Y.; Qin, W. Effects of thymol concentration on postharvest diseases and quality of blueberry fruit. Food Chem. 2023, 402, 134227. [Google Scholar] [CrossRef]
  31. Yan, Z.; Wang, H.; Kou, X.; Wu, C.; Fan, G.; Li, T.; Zhou, D. Metabolomics analysis reveals that MeJA treatment induces postharvest blueberry resistance to Botrytis cinerea. Postharvest Biol. Technol. 2022, 194, 112075. [Google Scholar] [CrossRef]
  32. Sun, T.; Ouyang, H.; Sun, P.; Zhang, W.; Wang, Y.; Cheng, S.; Chen, G. Postharvest UV-C irradiation inhibits blackhead disease by inducing disease resistance and reducing mycotoxin production in ‘Korla’ fragrant pear (Pyrus sinkiangensis). Int. J. Food Microbiol. 2022, 362, 109485. [Google Scholar] [CrossRef]
  33. Huang, K.; Sui, Y.; Miao, C.; Chang, C.; Wang, L.; Cao, S.; Huang, X.; Li, W.; Zou, Y.; Sun, Z.; et al. Melatonin enhances the resistance of ginger rhizomes to postharvest fungal decay. Postharvest Biol. Technol. 2021, 182, 111706. [Google Scholar] [CrossRef]
  34. Zhang, M.; Xu, L.; Zhang, L.; Guo, Y.; Qi, X.; He, L. Effects of quercetin on postharvest blue mold control in kiwifruit. Sci. Hortic. 2018, 228, 18–25. [Google Scholar] [CrossRef]
  35. Asghari, M.; Rezaei-Rad, R. 24-Epibrassinolide enhanced the quality parameters and phytochemical contents of table grape. J. Appl. Bot. Food. Qual. 2018, 91, 226–231. [Google Scholar] [CrossRef]
  36. Yu, X.; Zhang, W.; Zhang, Y.; Zhang, X.; Lang, D.; Zhang, X. The roles of methyl jasmonate to stress in plants. Funct. Plant Biol. 2019, 46, 197–212. [Google Scholar] [CrossRef]
  37. Liu, C.; Chen, L.; Zhao, R.; Li, R.; Zhang, S.; Yu, W.; Sheng, J.; Shen, L. Melatonin induces disease resistance to Botrytis Cinerea in tomato fruit by activating jasmonic acid signaling pathway. J. Agric. Food Chem. 2019, 67, 6116–6124. [Google Scholar] [CrossRef]
  38. Ye, Y.; Xiao, Y.; Han, Y.; Shan, W.; Fan, Z.; Xu, Q.; Kuang, J.; Lu, W.; Lakshmanan, P.; Chen, J. Banana fruit VQ motif-containing protein5 represses cold-responsive transcription factor MaWRKY26 involved in the regulation of JA biosynthetic genes. Sci. Rep. 2016, 6, 23632. [Google Scholar] [CrossRef]
  39. Wang, B.; Bi, Y. The role of signal production and transduction in induced resistance of harvested fruits and vegetables. Food Qual. Saf. 2021, 5, fyab011. [Google Scholar] [CrossRef]
  40. Shi, J.; Liu, N.; Gu, R.; Zhu, L.; Zhang, C.; Wang, Q.; Lei, Z.; Liu, Y.; Ren, J. Signals induced by exogenous nitric oxide and their role in controlling brown rot disease caused by Monilinia fructicola in postharvest peach fruit. J. Gen. Plant Pathol. 2015, 81, 68–76. [Google Scholar] [CrossRef]
  41. Huan, C.; Yang, X.; Wang, L.; Kebbeh, M.; Wang, Y.; Dai, B.; Shen, S.; Zheng, X.; Zhou, H. Methyl jasmonate treatment regulates α-linolenic acid metabolism and jasmonate acid signaling pathway to improve chilling tolerance in both stony hard and melting flesh peaches. Postharvest Biol. Technol. 2022, 190, 111960. [Google Scholar] [CrossRef]
  42. Ji, N.; Wang, J.; Zuo, X.; Li, Y.; Li, M.; Wang, K.; Jin, P.; Zheng, Y. PpWRKY45 is involved in methyl jasmonate primed disease resistance by enhancing the expression of jasmonate acid biosynthetic and pathogenesis-related genes of peach fruit. Postharvest Biol. Technol. 2021, 172, 111390. [Google Scholar] [CrossRef]
  43. Pan, L.; Chen, X.; Xu, W.; Fan, S.; Wan, T.; Zhang, J.; Cai, Y. Methyl jasmonate induces postharvest disease resistance to decay caused by Alternaria alternata in sweet cherry fruit. Sci. Hortic. 2022, 292, 110624. [Google Scholar] [CrossRef]
  44. Qu, G.F.; Wu, W.N.; Ba, L.J.; Ma, C.; Ji, N.; Cao, S. Melatonin enhances the postharvest disease resistance of blueberries fruit by modulating the jasmonic acid signaling pathway and phenylpropanoid metabolites. Front. Chem. 2022, 10, 957581. [Google Scholar] [CrossRef]
  45. Wang, H.B.; Kou, X.H.; Wu, C.E.; Fan, G.J.; Li, T.T. Methyl jasmonate induces the resistance of postharvest blueberry against gray mold caused by Botrytis cinerea. J. Sci. Food Agric. 2020, 100, 4272–4281. [Google Scholar] [CrossRef]
  46. Shu, P.; Min, D.; Ai, W.; Li, J.; Guo, Y. L-arginine treatment attenuates postharvest decay and maintains quality of strawberry fruit by promoting nitric oxide synthase pathway. Postharvest Biol. Technol. 2020, 168, 111253. [Google Scholar] [CrossRef]
  47. Yan, H.; Chen, H.; Zhao, J.; Yao, T.; Ding, X. Postharvest H2O2 treatment affects flavor quality, texture quality and ROS metabolism of ‘Hongshi’ kiwifruit fruit kept at ambient conditions. Food Chem. 2023, 405, 134908. [Google Scholar] [CrossRef]
  48. Ma, W.; Li, J.; Murtaza, A.; Iqbal, A.; Zhang, J.; Zhu, L.; Xu, X.; Pan, S.; Hu, W. High-pressure carbon dioxide treatment alleviates browning development by regulating membrane lipid metabolism in fresh-cut lettuce. Food Control 2022, 134, 108749. [Google Scholar] [CrossRef]
  49. Ge, Y.; Tane, Q.; Li, C.; Duan, B.; Li, X.; Wei, M.; Li, J. Acibenzolar-S-methyl treatment enhances antioxidant ability and phenylpropanoid pathway of blueberries during low temperature storage. LWT Food Sci. Technol. 2019, 110, 48–53. [Google Scholar] [CrossRef]
  50. Wang, W.; Ma, X.; Zou, M.; Jiang, P.; Hu, W.; Li, J.; Zhi, Z.; Chen, J.; Li, S.; Ding, T.; et al. Effects of ultrasound on spoilage microorganisms, quality, and antioxidant capacity of postharvest cherry tomatoes. J. Food Sci. 2015, 80, C2117–C2126. [Google Scholar] [CrossRef]
  51. Ren, Y.L.; Wang, Y.F.; Bi, Y.; Ge, Y.H.; Wang, Y.; Fan, C.F.; Li, D.Q.; Deng, H.W. Postharvest BTH treatment induced disease resistance and enhanced reactive oxygen species metabolism in muskmelon (Cucumis melo L.) fruit. Eur. Food Res. Technol. 2012, 234, 963–971. [Google Scholar] [CrossRef]
  52. Alijani, Z.; Amini, J.; Karimi, K.; Pertot, I. Characterization of the mechanism of action of Serratia rubidaea Mar61-01 against Botrytis cinerea in strawberries. Plants 2023, 12, 154. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, J.; Bi, Y.; Zhang, Z.; Zhang, H.; Ge, Y. Reduction of latent infection and enhancement of disease resistance in muskmelon by preharvest application of harpin. J. Agric. Food Chem. 2011, 59, 12527–12533. [Google Scholar] [CrossRef] [PubMed]
  54. Li, X.; Sun, H.; Pei, J.; Dong, Y.; Wang, F.; Chen, H.; Sun, Y.; Wang, N.; Li, H.; Li, Y. De novo sequencing and comparative analysis of the blueberry transcriptome to discover putative genes related to antioxidants. Gene 2012, 511, 54–61. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.