Somatic Embryogenesis and Agrobacterium-Mediated Gene Transfer Procedures in Chilean Temperate Japonica Rice Varieties for Precision Breeding
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Embryogenic Callus Induction
4.2. Somatic Embryo and Plantlet Production
4.3. Geminivirus-Based T-DNA Vector
4.4. Agrobacterium-Mediated Transformation of Somatic Embryos
4.5. Transgenic Condition Evaluation
- -
- GFP expression. Explants were evaluated for GFP expression via epifluorescence microscopy using an Axio Lab.A1 microscope using the LED module at 470 nm (B) 423052-9573-000 (Zeiss, Oberkochen, Germany). The images were captured using a Cannon EOS Rebel T3 system with a GFP filter.
- -
- RNA isolation. A modified Trizol (ThermoFisher Scientific) method was used for isolating RNA from transformed embryos, as described by Azizi et al. [33]. The resulting RNA pellets were air dried for 10 min and dissolved in 30 mL of diethylpyrocarbonate-treated water. For gene expression analyses, residual genomic DNA was removed via DNase I treatment (MilliporeSigma), following the manufacturer’s procedures.
- -
- Reverse transcription: PCR detection of GFP transcripts. One microgram of total RNA was reverse transcribed using SuperScript II Reverse Transcriptase (Invitrogen, Waltham, MA, USA), following the manufacturer’s instructions. Approximately 10 ng of the synthesized cDNA was used for PCR detection of the GFP transgene based on the manufacturer’s procedures using the GFP primers (eGFP-nst1-fw CACATGAAGCAGCACGACTT and eGFP-nst1-rv AGTTCACCTTGATGCCGTTC), which amplified a 265 bp fragment. The following cycle conditions were used: 95 °C for 3 min 1 cycle, 95 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min 35 cycles, and a final extension at 72 °C for 5 min, using a Bioer GeneExplorer Thermal Cycler (Bioer Technology Co., Hangzhou, China). Amplified products were electrophoresed on 1.5% (w/v) agarose gel containing 0.5 mg/L SerRed (Servicebio Technology, Wuhan, China) and visualized using an eBL100 Transilluminator (Eastwin Scientific Equipments Inc. Ltd., Suzhou, China).
4.6. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Saud, S.; Wang, D.; Fahad, S.; Alharby, H.F.; Bamagoos, A.A.; Mjrashi, A.; Alabdallah, N.M.; AlZahrani, S.S.; AbdElgawad, H.; Adnan, M.; et al. Comprehensive impacts of climate change on rice production and adaptive strategies in China. Front. Microbiol. 2022, 13, 926059. [Google Scholar] [CrossRef] [PubMed]
- Cordero-Lara, K. Temperate japonica rice (Oryza sativa L.) breeding: History, present and future challenges. Chil. J. Agric. Res. 2020, 80, 303–314. [Google Scholar] [CrossRef]
- Romero, F.M.; Gatica-Arias, A. CRISPR/Cas9: Development and application in rice breeding. Rice Sci. 2019, 26, 265–281. [Google Scholar] [CrossRef]
- Hiei, Y.; Komari, T. Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nat. Protoc. 2008, 3, 824–834. [Google Scholar] [CrossRef] [PubMed]
- Hiei, Y.; Ishida, Y.; Kasaoka, K.; Komari, T. Improved frequency of transformation in rice and maize by treatment of immature embryos with centrifugation and heat prior to infection with Agrobacterium tumefaciens. Plant Cell Tissue Organ. Cult. 2006, 87, 233–243. [Google Scholar] [CrossRef]
- Hiei, Y.; Komari, T. Improved protocols for transformation of indica rice mediated by Agrobacterium tumefaciens. Plant Cell Tissue Organ. Cult. 2006, 85, 271–283. [Google Scholar] [CrossRef]
- Herve, P.; Kayano, T. Japonica rice varieties (Oryza sativa, Nipponbare, and others). Methods Mol. Biol. 2006, 343, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Shri, M.; Rai, A.; Verma, P.K.; Misra, P.; Dubey, S.; Kumar, S.; Verma, S.; Gautam, N.; Tripathi, R.D.; Trivedi, P.K.; et al. An improved Agrobacterium-mediated transformation of recalcitrant indica rice (Oryza sativa L.) cultivars. Protoplasma 2013, 250, 631–636. [Google Scholar] [CrossRef]
- Molina-Risco, M.; Ibarra, O.; Faion-Molina, M.; Kim, B.; Septiningsih, E.M.; Thomson, M.J. Optimizing Agrobacterium-mediated transformation and CRISPR-Cas9 gene editing in the tropical japonica rice variety Presidio. Int. J. Mol. Sci. 2021, 22, 10909. [Google Scholar] [CrossRef]
- Da Silva, G.J.; Schreinert, R.; Medeiros, T.; Dienes, N.; Peters, J.A.; Costa, A. Somatic embryogenesis and plant regeneration in Brazilian rice genotypes. Aus J. Crop Sci. 2015, 9, 1126–1130. [Google Scholar]
- Mahmood, M.A.; Naqvi, R.Z.; Rahman, S.U.; Amin, I.; Mansoor, S. Plant virus-derived vectors for plant genome engineering. Viruses 2023, 15, 531. [Google Scholar] [CrossRef] [PubMed]
- Zegeye, W.A.; Tsegaw, M.; Zhang, Y.; Cao, L. CRISPR-based genome editing: Advancements and opportunities for rice Improvement. Int. J. Mol. Sci. 2022, 23, 4454. [Google Scholar] [CrossRef] [PubMed]
- Baltes, N.J.; Gil-Humanes, J.; Cermak, T.; Atkins, P.A.; Voytas, D.F. DNA replicons for plant genome engineering. Plant Cell. 2014, 26, 151–163. [Google Scholar] [CrossRef] [PubMed]
- Čermák, T.; Baltes, N.J.; Čegan, R.; Zhang, Y.; Voytas, D.F. High-frequency, precise modification of the tomato genome. Genome Biol. 2015, 16, 232. [Google Scholar] [CrossRef] [PubMed]
- Acha, G.; Vergara, R.; Muñoz, M.; Mora, R.; Aguirre, C.; Muñoz, M.; Kalazich, J.; Prieto, H. A traceable DNA-Replicon derived vector to speed up gene editing in potato: Interrupting genes related to undesirable postharvest tuber traits as an example. Plants 2021, 10, 1882. [Google Scholar] [CrossRef] [PubMed]
- Quiroz-Figueroa, F.R.; Rojas-Herrera, R.; Galaz-Avalos, R.M.; Loyola-Vargas, V.M. Embryo production through somatic embryogenesis can be used to study cell differentiation in plants. Plant Cell Tissue Org. Cult. 2006, 86, 285–301. [Google Scholar] [CrossRef]
- Merkle, S.A.; Parrott, W.A.; Williams, E.G. Applications of somatic embryogenesis and embryo cloning. Dev. Crop Sci. 1990, 19, 67–101. [Google Scholar] [CrossRef]
- Battacharya, P.; Sen, S.K. Potentiality of leaf sheath cells for regeneration of rice (Oryza sativa 1.) plants. Theor. Appl. Genet. 1980, 58, 87–90. [Google Scholar] [CrossRef]
- Indoliya, Y.; Tiwari, P.; Chauhan, A.; Goel, R.; Shri, M.; Bag, S.K.; Chakrabarty, D. Decoding regulatory landscape of somatic embryogenesis reveals differential regulatory networks between japonica and indica rice subspecies. Sci. Rep. 2016, 6, 23050. [Google Scholar] [CrossRef]
- Ho, W.; Vasil, I.K. Somatic embryogenesis and plant regeneration from leaf tissues and anthers of Pennisetum purpureum schum. Theor. Appl. Genet. 1983, 59, 269–273. [Google Scholar]
- Zafar, K.; Sedeek, K.E.M.; Rao, G.S.; Khan, M.Z.; Amin, I.; Kamel, R.; Mukhtar, Z.; Zafar, M.; Mansoor, S.; Mahfouz, M.M. Genome editing technologies for rice improvement: Progress, prospects, and safety concerns. Front. Genome Ed. 2020, 2, 5. [Google Scholar] [CrossRef] [PubMed]
- Sood, P.; Bhattacharya, A.; Sood, A. Problems and possibilities of monocot transformation. Biol. Plant. 2011, 55, 1–15. [Google Scholar] [CrossRef]
- Singh, R.K.; Prasad, M. Advances in Agrobacterium tumefaciens-mediated genetic transformation of graminaceous crops. Protoplasma 2016, 253, 691–707. [Google Scholar] [CrossRef] [PubMed]
- Mohammed, M.; Abd Samad, A.; Rahmat, Z. Agrobacterium-Mediated transformation of rice: Constraints and possible solutions. Rice Sci. 2019, 26, 133–146. [Google Scholar] [CrossRef]
- Ghobeishavi, H.; Uliaie, E.D.; Alavikia, S.S.; Valizadeh, M. Study of factors influencing somatic embryogenesis in rice (Oryza sativa L.). Int. J. Adv. Biol. Biom. Res. 2015, 3, 43–50. [Google Scholar]
- Gao, L.Z.; Innan, H. Nonindependent domestication of the two rice subspecies, Oryza sativa ssp. indica and ssp. japonica, demonstrated by multilocus microsatellites. Genetics 2008, 179, 965–976. [Google Scholar] [CrossRef] [PubMed]
- Madeira, C. A review of the future impact of climate change in Chile: Economic output and other outcomes. Mitig. Adapt. Strateg. Glob. Change 2022, 27, 2756. [Google Scholar] [CrossRef]
- Nakagawa, T.; Suzuki, T.; Murata, S.; Nakamura, S.; Hino, T.; Maeo, K.; Tabata, R.; Kawai, T.; Tanaka, K.; Niwa, Y.; et al. Improved Gateway binary vectors: High-performance vectors for creation of fusion constructs in transgenic analysis of plants. Biosci. Biotechnol. Biochem. 2007, 71, 2095–2100. [Google Scholar] [CrossRef]
- Sun, W.; Ma, Z.; Chen, H.; Liu, M. MYB gene family in potato (Solanum tuberosum L.): Genome-wide identification of hormone-responsive reveals their potential functions in growth and development. Int. J. Mol. Sci. 2019, 20, 4847. [Google Scholar] [CrossRef]
- Engler, C.; Marillonnet, S. Golden Gate cloning. Methods Mol. Biol. 2014, 1116, 119–131. [Google Scholar] [CrossRef]
- Zhang, J.; Xu, R.j.; Elliott, M.C.; Chen, D.F. Agrobacterium-mediated transformation of élite indica and japonica rice cultivars. Mol. Biotechnol. 1997, 8, 223–231. [Google Scholar] [CrossRef]
- Durga Sahithya, M.; Srinath, M.; Swathi Bai, M.; Sirisha, C.; Srinivas Naik, K. Transgenic rice lines expressing rice Endochitinase (Chi11) confers improved resistance to Sheath Blight and Rice Blast fungal pathogens. Int. J. Innov. Res. Technol. 2022, 9, 330–349. [Google Scholar]
- Azizi, P.; Rafii, M.Y.; Mahmood, M.; Abdullah, S.N.; Hanafi, M.M.; Latif, M.; Sahebi, M.; Ashkani, S. Evaluation of RNA extraction methods in rice and their application in expression analysis of resistance genes against Magnaporthe oryzae. Biotechnol. Biotechnol. Equip. 2017, 31, 75–84. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barrera, M.; Olmedo, B.; Zúñiga, C.; Cepeda, M.; Olivares, F.; Vergara, R.; Cordero-Lara, K.; Prieto, H. Somatic Embryogenesis and Agrobacterium-Mediated Gene Transfer Procedures in Chilean Temperate Japonica Rice Varieties for Precision Breeding. Plants 2024, 13, 416. https://doi.org/10.3390/plants13030416
Barrera M, Olmedo B, Zúñiga C, Cepeda M, Olivares F, Vergara R, Cordero-Lara K, Prieto H. Somatic Embryogenesis and Agrobacterium-Mediated Gene Transfer Procedures in Chilean Temperate Japonica Rice Varieties for Precision Breeding. Plants. 2024; 13(3):416. https://doi.org/10.3390/plants13030416
Chicago/Turabian StyleBarrera, Marion, Blanca Olmedo, Carolina Zúñiga, Mario Cepeda, Felipe Olivares, Ricardo Vergara, Karla Cordero-Lara, and Humberto Prieto. 2024. "Somatic Embryogenesis and Agrobacterium-Mediated Gene Transfer Procedures in Chilean Temperate Japonica Rice Varieties for Precision Breeding" Plants 13, no. 3: 416. https://doi.org/10.3390/plants13030416
APA StyleBarrera, M., Olmedo, B., Zúñiga, C., Cepeda, M., Olivares, F., Vergara, R., Cordero-Lara, K., & Prieto, H. (2024). Somatic Embryogenesis and Agrobacterium-Mediated Gene Transfer Procedures in Chilean Temperate Japonica Rice Varieties for Precision Breeding. Plants, 13(3), 416. https://doi.org/10.3390/plants13030416