Evaluation of the Potential Hypoglycaemic Properties of Mimusops zeyheri Sond. and Aloe marlothii A.Berger, Two Plants Used by Traditional Healers in South Africa
Abstract
:1. Introduction
2. Results and Discussion
2.1. Toxicity
2.2. Glucose Uptake
2.3. GLUT-4 Translocation
2.4. Gene Expressions
2.5. Real-Time Polymerase Chain Reaction
2.6. Protein Expression of IRS-1 and Akt
3. Conclusions and Recommendations
4. Materials and Methods
4.1. Plant Material Collection and Identification
4.2. Plant Extracts
4.3. Cell Culture
4.4. MTT Assay
4.5. Glucose Uptake Assay
4.6. GLUT-4 Translocation Analysis
4.7. Gene Expression
4.7.1. RNA Extraction
4.7.2. cDNA Synthesis
4.7.3. Conventional PCR Conditions
4.7.4. Quantitative Real-Time Polymerase Chain Reaction (IRS-1, PI3K, Akt1, Akt2, PPAR-γ, and GLUT-4)
4.8. Phosphorylation of Akt
4.9. Determination of Insulin Receptor Substrate-1 Protein Levels
4.10. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ashok, K.T.; Rao, J.M. Diabetes mellitus and multiple therapeutic approaches of phytochemicals: Present status and future prospects. Curr. Sci. 2002, 83, 30–38. [Google Scholar]
- Deutschländer, M.A.; Lall, N.; van de Venter, M. Plants species used in the treatment of diabetes by South African traditional healers: An inventory. Pharm. Biol. 2009, 47, 348–365. [Google Scholar] [CrossRef]
- lfadhli, E.M. Gestational diabetes mellitus. Saudi Med. J. 2015, 36, 399–406. [Google Scholar] [CrossRef] [PubMed]
- Adeyemi, S.O.; Bradley, G.; Afolayan, A.J. Ethnobotanical survey of medicinal plants used for the management of diabetes mellitus in the Nkonkobe municipality of South Africa. J. Med. Plants Res. 2009, 3, 1040–1044. [Google Scholar]
- Al-Khalili, L.; Chibalin, A.V.; Kannisto, K.; Zhang, B.B.; Permert, J.; Holman, G.D.; Ehrenborg, E.; Ding, H.; Zierath, R.; Krook, A. Insulin action in cultured human skeletal muscle cells during differentiation: Assessment of cell surface GLUT4 and GLUT1 content. Cell Mol. Life Sci. 2003, 60, 991–998. [Google Scholar] [CrossRef]
- Govers, R. Molecular mechanism of GLUT-4 in adipocytes. Diabetes Metab. 2014, 40, 400–410. [Google Scholar] [CrossRef]
- Gosmanov, A.R.; Umpierrez, G.; Karabell, A.H.; Cuervo, R.; Thomason, D.B. Impaired expression and insulin-stimulated phosphorylation of Akt-2 in muscle of obese patients with atypical diabetes. Am. J. Physiol. Endocrinol. Metab. 2004, 287, E8–E15. [Google Scholar] [CrossRef]
- Kandror, K.V.; Pilch, P.F. Compartmentalization of protein traffic in insulin-sensitive cells. Am. J. Physiol. 1996, 271, E1–E14. [Google Scholar] [CrossRef]
- Gould, G.W.; Holman, G.D. The glucose transporter family: Structure, function and tissue-specific expression. Biochem. J. 1993, 295, 329–341. [Google Scholar] [CrossRef]
- Lee, Y.C.; Huang, H.Y.; Chang, C.J.; Cheng, C.H.; Chen, Y.T. Mitochondrial GLUT10 facilitates dehydroascorbic acid import and protects cells against oxidative stress: Mechanistic insight into arterial tortuosity syndrome. Hum. Mol. Genet. 2010, 19, 721–3733. [Google Scholar] [CrossRef]
- Mehnaz, A.; Tannishtha, B.; Susmita, M. The strategic involvement of IRS in cancer progression. Biochem. Biophys. Res. Commun. 2023, 680, 141–160. [Google Scholar]
- Russell, R.R., III; Yin, R.; Caplan, M.J.; Hu, X.; Ren, J.; Shukman, G.I.; Sinusas, A.J.; Young, L.H. Additive effects of hyperinsulinemia and ischemia on the myocardial GLUT1 and GLUT4 translocation in vivo. J. Am. Heart Assoc. 1998, 98, 2180–2186. [Google Scholar] [CrossRef] [PubMed]
- Saxena, A.; Vikram, N.K. Role of selected Indian plants in management of type 2 diadetes: A review. J. Altern. Complement. Med. 2004, 10, 369–378. [Google Scholar] [CrossRef] [PubMed]
- Shahidi, F.; McDonald, J.; Chandrasekara, A.; Zhong, Y. Phytochemicals of foods, beverages and fruit vinegars: Chemistry and health effects. Asia Pac. J. Clin. Nutr. 2008, 17, 380–382. [Google Scholar]
- Kelly, K. History of Medicine; Facts on file: New York, NY, USA, 2009; pp. 29–50. [Google Scholar]
- Afolayan, J.A.; Sunmonu, O.T. In vivo studies on antidiabetic plants used in South African herbal medicine. J. Clin. Biochem. Nutr. 2010, 47, 98–106. [Google Scholar] [CrossRef]
- Van Wyk, B.E.; Van Oudtsshoorn, B.; Gericke, N. Medicinal Plants of South Africa; Briza Publication: Pretoria, South Africa, 1997. [Google Scholar]
- Venter, F.; Venter, J.N. Making Most of Indigenous Trees; Briza Publications: Pretoria, South Africa, 1996; pp. 210–2011. [Google Scholar]
- Amusa, O.O.G. Herbal Medicine in Swaziland: An Overview of African Natural Plant Products: New Discoveries and Challenges in Chemistry and Quality; ACS Symposium Series; ACS Publications: Washington, DC, USA, 2009; Volume 1021, ISBN 13:9780841269873. [Google Scholar]
- Semenya, S.; Potgieter, M.; Erasmus, L. Ethnobotanical survey of medicinal plants used by the Bapedi healers to treat diabetes mellitus in the Limpopo province, South Africa. J. Ethnopharmacol. 2012, 41, 440–445. [Google Scholar] [CrossRef]
- Mashela, P.W.; Pofu, M.K.; Nzanza, N. Responses of Mmupudu (Mimusops zeyheri) indigenous fruit tree to three soil types. Afr. J. Agric. Res. 2013, 8, 1066–1069. [Google Scholar]
- Cousins, S.R.; Witkowski, E.T.F. African aloe ecology: A review. J. Arid Environ. 2012, 85, 1–17. [Google Scholar] [CrossRef]
- Van Der Merwe, D. Use of Ethnoveterinary Medicinal Plants in Cattle by Setswana-Speaking People in the Madikwe Area of the North West Province. Ph.D. Thesis, University of Pretoria, Pretoria, South Africa, 2000. [Google Scholar]
- Spickett, A.M.; Van der Merwe, D.; Matthee, O. The effect of orally administered Aloe marlothii leaves on Boophilus decoloratus tick burden on cattle. Exp. Appl. Acarol. 2007, 41, 139–146. [Google Scholar] [CrossRef]
- Dagne, E.; Bisrat, D.; Viljoen, A.; Van Wyk, B.E. Chemistry of Aloe Species. Curr. Org. Chem. 2000, 4, 1055–1078. [Google Scholar] [CrossRef]
- Guo, X.; Mey, N. Aloe vera: A review of toxicity and adverse clinical effects. J. Environ. Sci. Health C Environ. Carcinog. Ecotoxicol. Rev. 2016, 34, 77–96. [Google Scholar] [CrossRef] [PubMed]
- Mwale, M.; Masika, P.J. Toxicological studies on the leaf extract of Aloe ferox Mill. Extracts using Brine shrimp (Artemia salina L.) assay. Pak. J. Pharm. Sci. 2015, 28, 635–640. [Google Scholar]
- Andersen, F.A. Final Report on the Safety Assessment of Aloe Andongensis Extract, Aloe Andongensis Leaf Juice, Aloe Arborescens Leaf Extract, Aloe Arborescens Leaf Juice, Aloe Arborescens Leaf Protoplasts, Aloe Barbadensis Flower Extract, Aloe Barbadensis Leaf, Aloe Barbadensis Leaf Extract, Aloe Barbadensis Leaf Juice, Aloe Barbadensis Leaf Polysaccharides, Aloe Barbadensis Leaf Water, Aloe Ferox Leaf Extract, Aloe Ferox Leaf Juice, and Aloe Ferox Leaf Juice Extract. Int. J. Toxicol. 2007, 26, 1–50. [Google Scholar]
- Karmakar, U.K.; Sultana, R.; Biswas, N. Antioxidant, analgesic and cytotoxic activities of Mimusops elengi Linn leaves. Int. J. Pharm. Sci. Res. 2011, 2, 2791–2797. [Google Scholar]
- Kadam, V.P.; Yadav, K.N.; Deoda, R.S.; Shivatare, R.S.; Patil, M.J. Mimusops elengi: A review on ethnobotany, phytochemical and pharmacological profile. J. Pharmocogn. Phytochem. 2012, 1, 64–74. [Google Scholar]
- Gami, B.; Pathak, S.; Parabia, M. Ethnobotanical, phytochemical and pharmacological review of Mimusops elengi Linn. Asian Pac. J. Trop. Biomed. 2012, 2, 743–748. [Google Scholar] [CrossRef]
- Molla, M.; Gemeda, N.; Abay, S.M. Investigating Potential Modes of Actions of Mimusops kummel Fruit Extract and Solvent Fractions for Their Antidiarrheal Activities in Mice. Evid.-Based Complement. Altern. Med. 2017, 2017, 4103410. [Google Scholar] [CrossRef]
- Joshi, H.; Charan, C.S.; Alkanad, M.A. Antiamnesic and Neuroprotective Effects of Leaves of Mimusops Elengi on Brain Aging and Chemically Induced Amnesia in Mice. Biomed. J. Sci. Tech. Res. 2018, 4, 3760–3764. [Google Scholar] [CrossRef]
- Lee, M.; Hwang, J.-T.; Kim, S.; Yoon, S.; Kim, M.-S.; Yang, H.-J.; Kwon, D.-Y. Gin senoside Rc, an active component of Panax ginseng, stimulates glucose uptake in C2C12 myotubes through an AMPK-dependent mechanism. J. Ethnopharmacol. 2010, 127, 771–776. [Google Scholar] [CrossRef]
- Nedachi, T.; Kanzaki, M. Regulation of glucose transporters by insulin and extracellular glucose in C2C12 myotubes. Am. J. Physiol. Endocrinol. Metab. 2006, 291, E817–E828. [Google Scholar] [CrossRef]
- Deutschländer, M.S.; van de Venter, M.; Roux, S.; Louw, J.; Lall, N. Hypoglycaemic activity of four plant extracts traditionally used in South Africa for diabetes. J Ethnopharmacol. 2009, 124, 619–624. [Google Scholar] [CrossRef] [PubMed]
- Jaiswal, N.; Yadav, P.P.; Maurya, R.; Srivastava, K.A.; Tamrakar, K.A. Karanjin from Pongamia pinnata induces GLUT-4 translocation in skeletal muscles cells in a phosphatidylinositol-3-kinase-independent manner. Eur. J. Pharmacol. 2011, 670, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Fallah, H.H.; Kianbakht, S.; Hajiaghaee, R.; Afkhami-Ardekani, M.; Bonakdaran, A.; Hashem, D.F. Aloe vera leaf gel in treatment of advanced Type 2 diabetes mellitus needing insulin therapy: A randomized double-blind placebo-controlled clinical trial. J. Med. Plant Res. 2012, 11, 19–27. [Google Scholar]
- Manjunath, K.; Bhanu Prakash, G.; Subash, K.R.; Tadvi, N.A.; Manikanta, M.; Umamaheswara Rao, K. Effect of Aloe vera leaf extract on blood glucose levels in alloxan induced diabetic rats. Natl. J. Physiol. Pharm. Pharmacol. 2016, 6, 471–474. [Google Scholar]
- Beppu, H.T.; Nagamura, Y.; Fujita, K. Hypoglycemic and antidiabetic effects in mice of Aloe arborescens Miller var. natalensis Berger. Phytother. Res. 1993, 7, S37–S42. [Google Scholar] [CrossRef]
- Loots, D.T.; Pieters, M.; Islam, M.S.; Botes, L. Antidiabetic effects of Aloe ferox and Aloe greatheadii var. davyana leaf gel extracts in a low-dose streptozotocin diabetes rat model. S. Afr. J. Sci. 2011, 107, 1–6. [Google Scholar] [CrossRef]
- Zahid, H.; Rizwani, G.H.; Shareef, H.; Mahmud, S.; Ali, T. Hypoglycemic and Hypolipidemic Effects of Mimusops elengi Linn Extracts on Normoglycaemic and Alloxan-Induced Diabetic Rats. Int. J. Pharm. Biol. Arch. 2012, 3, 56–62. [Google Scholar]
- Suzuki, K.; Kono, T. Evidence that insulin cause translocation of glucose transport activity to the plasma membrane from intracellular storage site. Proc. Natl. Acad. Sci. USA 1980, 77, 2542–2545. [Google Scholar] [CrossRef]
- Wei, L.; Rong-Ji, D.; Yu-Hong, Y.; Liang, L.; Chong-Ming, W.; Wei-Wei, L.; Wei-Wei, M.; Xin-Sheng, Z.; Yu-Lin, D. Antidiabetic effect of cephalotaxus sinesis leaves and GLUT-4 translocation facilitating activity of its flavonoids constituents. Biol. Pharm. Bull. 2007, 30, 1123–1129. [Google Scholar]
- Naresh, G.; Jaiswal, N.; Sukanya, P.; Srivastava, A.K.; Tamrakar, A.K.; Narender, T. Glucose uptake stimulatory effect of 4-hydroxypipecolic acid by increased GLUT 4 translocation in skeletal muscle cells. Bioorg. Med. Chem. Lett. 2012, 22, 5648–5651. [Google Scholar] [CrossRef]
- Shepherd, P.R.; Kahn, B.B. Glucose transporters and insulin action: Implication for insulin resistance and diabetes mellitus. N. Engl. J. Med. 1999, 341, 248–257. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.; Hininger-Favier, K.A.; Meghan, B.R.; Dawson, D.H.; Coves, S.; Roussel, M.A.; Anderson, A.R. Green tea polyphenol extract regulates the expression of genes involved in uptake and glucose insulin signaling in rats fed a high fructose diet. J. Agric. Food Chem. 2007, 55, 6372–6378. [Google Scholar] [CrossRef] [PubMed]
- Noipha, K.; Ratanachaiyavong, S.; Purintrapiban, J.; Herunsalee, A.; Ninla-aesong, P. Effect of Tinospora crispa on glucose uptake in skeletal muscle: Role of glucose transporter 1 expression and extracellular signal-regulated kinase1/2 activation. Asian biomed. 2011, 5, 361–369. [Google Scholar]
- Seabi, I.M.; Motaung, S.C.K.M.; Ssemakalu, C.C.; Mokgotho, M.P.; Mogale, A.M.; Shai, L.J. Effects of Cassia abbreviata Oliv. and Helinus integrifolius (Lam.) Kuntze on Glucose Uptake, Glut-4 Expression and Translocation in Muscle (C2C12 Mouse Myoblasts) Cells. Int. J. Pharmacogn. Phytochem. 2016, 8, 1003–1009. [Google Scholar]
- Taderera, T.; Chagonda, L.S.; Gomo, E.; Katerere, D.; Shai, L.J. Annona stenophylla aqueous extract stimulate glucose uptake in established C2C12 cell lines. Afr. Health Sci. 2019, 19, 2219–2229. [Google Scholar] [CrossRef]
- Leonardini, A.; Laviola, L.; Perrini, S.; Natalicchio, A.; Giorgino, F. Cross-Talk between PPARγ and insulin signaling and modulation of insulin sensitivity. PPAR Res. 2009, 2019, 818945. [Google Scholar] [CrossRef]
- Song, X.M.; Kawano, Y.; Krook, A.; Ryder, J.W.; Efendic, S.; Roth, R.A.; Wallberg-Henriksson, H.; Zierath, J.R. Muscle fiber type-specific defects in insulin signal transduction to glucose transport in diabetic GK rats. Diabetes 1999, 48, 664–670. [Google Scholar] [CrossRef]
- Kanzaki, M. Insulin receptor signals regulating GLUT-4 translocation and actin dynamics. Endocr. J. 2006, 53, 267–293. [Google Scholar] [CrossRef]
- Mäkinen, S.; Datta, N.; Rangarajan, S.; Nguyen, Y.H.; Olkkonen, V.M.; Latva-Rasku, A.; Nuutila, P.; Laakso, M.; Koistinen, H.A. Finnish-specific AKT2 gene variant leads to impaired insulin signalling in myotubes. J. Mol. Endocrinol. 2023, 70, e210285. [Google Scholar] [CrossRef]
- Dhanya, R.; Arya, A.D.; Nisha, P.; Jayamurthy, P. Quercetin, a Lead Compound against Type 2 Diabetes Ameliorates Glucose Uptake via AMPK Pathway in Skeletal Muscle Cell Line. Front. Pharmacol. 2017, 8, 336. [Google Scholar] [CrossRef]
- Yao, Z.; Meng, J.; Long, J.; Li, L.; Qiu, W.; Li, C.; Zhang, J.V.; Ren, P.-G. Orphan receptor GPR50 attenuates inflammation and insulin signalling in 3T3-L1 preadipocytes. FEBS Open Bio 2023, 13, 89–101. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, Y.; Han, F.; Yu, H.; Yang, T.; Guan, W.; Guo, X. The role of the PI3K/AKT/Mtor protein synthesis pathway in the skeletal muscle atrophy induced by COPD. Int. J. Clin. Exp. Med. 2016, 9, 5677–5687. [Google Scholar]
- Zhu, R.; Zheng, J.; Chen, L.; Gu, B.; Huang, S. Astragaloside IV facilitates glucose transport in C2C12 myotubes through the IRS1/AKT pathway and suppresses the palmitate-induced activation of the IKK/IkHα pathway. Int. J. Mol. Med. 2016, 37, 1697–1705. [Google Scholar] [CrossRef]
- Cai, S.; Sun, W.; Fan, Y.; Guo, X.; Xu, G.; Xu, T.; Hou, Y.; Zhao, B.; Feng, X. Effect of mulberry leaf (Folium Mori) on insulin resistance via IRS1/PI3K/Glut-4 signalling pathway in type 2 diabetes mellitus rats. Pharm. Biol. 2016, 54, 2685–2691. [Google Scholar] [CrossRef]
- Koch, C.; Augustine, R.A.; Steger, J.; Ganjam, G.K.; Benzler, J.; Pracht, C.; Lowe, C.; Schwartz, M.W.; Shepherd, P.R.; Anderson, G.M.; et al. Leptin rapidly improves glucose homeostasis in obese mice by increasing hypothalamic insulin sensitivity. J. Neurosci. 2010, 30, 16180–16187. [Google Scholar] [CrossRef]
- Seo, Y.J.; Lee, K.; Chei, S.; Jeon, Y.J.; Lee, B.Y. Ishige okamurae Extract Ameliorates the Hyperglycemia and Body Weight Gain of db/db Mice through Regulation of the PI3K/Akt Pathway and Thermogenic Factors by FGF21. Mar. Drugs 2019, 17, 407. [Google Scholar] [CrossRef]
- Li, H.B.; Yang, Y.R.Y.; Mo, Z.J.; Ding, Y.; Jiang, W.J. Silibinin improves palmitate-induced insulin resistance in C2C12 myotubes by attenuating IRS-1/PI3K/Akt pathway inhibition. Braz. J. Med. Biol. Res. 2015, 48, 440–446. [Google Scholar] [CrossRef]
- Abdelmohsen, G.; Dawoud, G.T.M.; Mohamed, M.S.M. Investigation of the Biochemical and Ultrastructural Mechanisms Underlying the Antimicrobial Activity of Mimusops spp. Extracts. Baghdad Sci. J. 2020, 17, 452–462. [Google Scholar]
- Baraskar, K.; Thakur, P.; Shrivastava, R.; Shrivastava, V.K. Ameliorative effects of gallic acid on GLUT-4 expression and insulin resistance in high fat diet-induced obesity animal model mice, Mus musculus. J. Diabetes Metab. Disord. 2023, 22, 721–733. [Google Scholar] [CrossRef]
- Yimam, M.; Zhao, J.; Corneliusen, B.; Pantier, M.; Brownell, L.; Jia, Q. Blood glucose lowering activity of aloe based composition, UP780, in alloxan induced insulin dependent mouse diabetes model. Diabetol. Metab. Syndr. 2014, 6, 61–79. [Google Scholar] [CrossRef]
- Mosmann, H.M.T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxic assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Van de Venter, M.; Roux, S.; Bungu, L.C.; Louw, J.; Crouch, N.R.; Grace, O.M.; Maharaj, V.; Pillay, P.; Sewnarian, P.; Bhagwandin, N.; et al. Antidiabetic screening and scoring of 11 plants traditionally used in South Africa. J. Ethnopharmacol. 2008, 119, 81–86. [Google Scholar] [CrossRef]
Name of Plant | Family Name | Vernacular Name | Plant Part Used | Mode of Preparation |
---|---|---|---|---|
Mimusops zeyheri Sond. | Sapotaceae | Mmupudu | Leaf | Cooked for 10–25 min |
Aloe marlothii A.Berger | Asphodelaceae | Kgopha | Leaves and roots | Cooked for 5 min |
Genes | Primers |
---|---|
IRS-1 | Forward: TATCTGCATGGGTGGCAAGG Reverse: GGGTAGGCAGGCATCATCTC |
PI3K Akt1 | Forward: TGACGCTTTCAAACGCTATC Reverse: CAGAGAGTACTCTTGCATTC Forward: AAGGCCACAGGCCGCTACTA Reverse: AAGAAGAGCTCGCCCCGTT |
Akt2 | Forward: CGCCCTCTCGGTCGGTCTTCATCAG Reverse: TTCCAGCCATGAGCTACGTC |
PPAR-γ | Forward: GGTGAAACTCTGGGATTC Reverse: CAACCATTGGGTCAGCTCTCTT |
GLUT-4 | Forward: CAACTGGACCTGTAACTTCATTGT Reverse: ACGGCAAATAGAAGGAAGACGTA |
GAPDH | Forward: ACCACAGTCCATGCCATCAC Reverse: TCCACCACCCTGTTGCTGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kamga-Simo, F.D.Y., III; Kamatou, G.P.; Kgopa, A.H.; Mokgotho, M.P.; Shai, L.J. Evaluation of the Potential Hypoglycaemic Properties of Mimusops zeyheri Sond. and Aloe marlothii A.Berger, Two Plants Used by Traditional Healers in South Africa. Plants 2024, 13, 3323. https://doi.org/10.3390/plants13233323
Kamga-Simo FDY III, Kamatou GP, Kgopa AH, Mokgotho MP, Shai LJ. Evaluation of the Potential Hypoglycaemic Properties of Mimusops zeyheri Sond. and Aloe marlothii A.Berger, Two Plants Used by Traditional Healers in South Africa. Plants. 2024; 13(23):3323. https://doi.org/10.3390/plants13233323
Chicago/Turabian StyleKamga-Simo, Ferdinand De Yogam, III, Guy Paulin Kamatou, Ananias Hodi Kgopa, Matlou Phineas Mokgotho, and Leshweni Jeremia Shai. 2024. "Evaluation of the Potential Hypoglycaemic Properties of Mimusops zeyheri Sond. and Aloe marlothii A.Berger, Two Plants Used by Traditional Healers in South Africa" Plants 13, no. 23: 3323. https://doi.org/10.3390/plants13233323
APA StyleKamga-Simo, F. D. Y., III, Kamatou, G. P., Kgopa, A. H., Mokgotho, M. P., & Shai, L. J. (2024). Evaluation of the Potential Hypoglycaemic Properties of Mimusops zeyheri Sond. and Aloe marlothii A.Berger, Two Plants Used by Traditional Healers in South Africa. Plants, 13(23), 3323. https://doi.org/10.3390/plants13233323