Next Article in Journal
Proteomic Profiling and Rhizosphere-Associated Microbial Communities Reveal Adaptive Mechanisms of Dioclea apurensis Kunth in Eastern Amazon’s Rehabilitating Minelands
Next Article in Special Issue
Calypogeia (Calypogeiaceae, Marchantiophyta) in Pacific Asia: Updates from Molecular Revision with Particular Attention to the Genus in North Indochina
Previous Article in Journal
Genome-Wide Identification and Expression Analysis of SNARE Genes in Brassica napus
Previous Article in Special Issue
Characterization of 15-cis-ζ-Carotene Isomerase Z-ISO in Cultivated and Wild Tomato Species Differing in Ripe Fruit Pigmentation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Plastid Phylogenomic Analysis of Tordylieae Tribe (Apiaceae, Apioideae)

by
Tahir Samigullin
1,*,
Maria Logacheva
1,2,
Elena Terentieva
3,
Galina Degtjareva
3,
Michael Pimenov
3 and
Carmen Valiejo-Roman
1
1
Department of Evolutionary Biochemistry, A. N. Belozersky Research Institute of Physicochemical Biology, Lomonosov Moscow State University, Leninskie Gory 1–40, 119992 Moscow, Russia
2
Center of Life Sciences, Skolkovo Institute of Science and Technology, Bolshoy Boulevard 30, Bld. 1, 121205 Moscow, Russia
3
Botanical Garden, Faculty of Biology, Lomonosov Moscow State University, Leninskie Gory 1/12, 119992 Moscow, Russia
*
Author to whom correspondence should be addressed.
Plants 2022, 11(5), 709; https://doi.org/10.3390/plants11050709
Submission received: 30 December 2021 / Revised: 28 February 2022 / Accepted: 1 March 2022 / Published: 7 March 2022
(This article belongs to the Special Issue Plant Genosystematics)

Abstract

:
Based on the nrDNA ITS sequence data, the Tordylieae tribe is recognized as monophyletic with three major lineages: the subtribe Tordyliinae, the Cymbocarpum clade, and the Lefebvrea clade. Recent phylogenomic investigations showed incongruence between the nuclear and plastid genome evolution in the tribe. To assess phylogenetic relations and structure evolution of plastomes in Tordylieae, we generated eleven complete plastome sequences using the genome skimming approach and compared them with the available data from this tribe and close relatives. Newly assembled plastomes had lengths ranging from 141,148 to 150,103 base pairs and contained 122–127 genes, including 79–82 protein-coding genes, 35–37 tRNAs, and 8 rRNAs. We observed substantial differences in the inverted repeat length and gene content, accompanied by a complex picture of multiple JLA and JLB shifts. In concatenated phylogenetic analyses, Tordylieae plastomes formed at least three not closely related lineages with plastomes of the Lefebvrea clade as a sister group to plastomes from the Selineae tribe. The newly obtained data have increased our knowledge on the range of plastome variability in Apiaceae.

1. Introduction

During the most recent decade, active studies of angiosperm plastid genomes (plastomes) have shown that plastomes are relatively conserved but dynamic in terms of gene content and structural features, and many amazing examples of radical enlargement or reduction and rearrangements have been uncovered [1,2,3,4]. Most of the flowering plants, however, possess plastomes evolving in a calm manner and exhibit structural diversity only in the position of inverted repeats (IR) boundaries. In addition to the “ebb and flow” of the inverted repeats borders [5], the incorporation of “foreign” DNA of mitochondrial or uncertain origin is being reported more and more often [2,6].
In Apiaceae plastomes, gene order and genome structure are significantly conserved [7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28]. However, while for land plant’s plastomes (from early non-vascular plants to angiosperms), a general trend of IR enlarging can be seen [1,29], in the Apioideae subfamily of Apiaceae, a contrary tendency of IR shrinking is observed [26,30]. The shortest inverted repeats are concentrated within a distally branching group of clades (apioid superclade), uniting several tribes and clades with unclear relationships, including the Tordylieae tribe [31,32].
Tordylieae was established as a tribe, consisting of the genera Tordylium L., Condylocarpus Hoffm., Krubera Hoffm., and Hasselquistia L., by Koch (1824) [33]. Circumscription of the tribe was not stable and changed significantly in rank, name, and genera content, and in the system proposed by Pimenov and Leonov (1993) [34], Tordylieae included 23 genera. In addition to several large genera (Heracleum L., Pastinaca L., Tetrataenium (DC.) Manden., Tordylium, Semenovia Regel & Herder, the tribe also includes mono and oligotypic genera (Mandenovia Alava, Vanasushava P.K.Mukh. & Constance, Symphyoloma C.A.Mey., Pastinacopsis Golosk., Tordyliopsis DC., Ducrosia Boiss., Kalakia Alava, Tricholaser Gilli, etc.), almost all of them are rare plants, known from limited locations. Although Tordylieae, as a whole, was not the subject of special molecular phylogenetic studies, a lot of information regarding relationships and generic circumscription in the tribe has been obtained [35,36,37,38,39,40,41,42,43,44], and this information was summed up in the nrITS-based classification of the subfamily Apioideae [31]. According to this classification and the data obtained later [45,46,47], the tribe is recognized as monophyletic with the following major lineages: subtribe Tordyliinae Engl., containing such genera as Heracleum, Malabaila Hoffm., Pastinaca, Semenovia, and Tordylium; the Cymbocarpum clade, comprising the genera Cymbocarpum DC., Kalakia, and Ducrosia; and the Lefebvrea clade consisting of the “African peucedanoid group”. However, Tordylieae appeared to not be monophyletic in a recent broad nuclear phylogenomic coalescent analysis of sequences obtained using the universal Angiosperm353 probe set: the Cymbocarpum clade separated from the rest of Tordylieae, though quartet scores indicated notable discordance in the gene trees and local posterior probabilities supporting the position of the Cymbocarpum clade were not high [48].
Individual plastid markers (intron sequences of rps16, rpl16, rpoC1 genes) often did not show sufficient variability to provide resolution both within the Tordylieae and between the adjacent tribes or produced trees incongruent with the nrITS phylogeny [35,49,50]. A recent plastid phylogenomic investigation claimed new robust evidence for incongruence between the nuclear genome and plastome evolution in Tordylieae [20,26]. Within the Tordyliinae subtribe, Pastinaca and Heracleum formed a well-supported subclade (designated as Tordyliinae I) as a sister group to the Selineae tribe. Another subclade (Tordyliinae II) included Semenovia and Tetrataenium and was resolved as a part of a larger clade, which was a sister group to the Sinodielsia clade. These studies did not include representatives of the Lefebvrea and Cymbocarpum clades but revealed a noticeable difference in the plastome structure of Tordyliinae I and Tordyliinae II members. They experienced a similar IR expansion at the LSC/IRa border (JLA shift), but the insertion of the trnH and psbA sequences occurred in different spacers: the ycf2-trnL(CAA) spacer in Tordyliinae I and trnV(GAC)-rrn16 spacer in Tordyliinae II. Similar rearrangements caused by the JLA shift were also mentioned in several non-monocot angiosperm families (Actinidiaceae [51], Chenopodiaceae [52], Linaceae [53], Acanthaceae [54]) and in other Apiaceae species [26,55]. Moreover, two of ten plastomes of Angelica sinensis (Oliv.) Diels (member of Sinodielsia clade from the apioid superclade), and two of three available Semenovia plastomes showed absence of the insertion [21,28]. Therefore, its appearance, distribution across plastomes from members of the Tordylieae tribe and allied taxa that were yet unsampled, and utility of the specific plastome rearrangements as phylogenetic markers are of special interest. In this work, in order to address questions of phylogenetic relationships and structure evolution of plastomes in Tordylieae, and utility of specific rearrangements in the plastid genome as phylogenetic markers, we determined eleven complete plastome sequences (from Dasispermum suffruticosum (P.J.Bergius) B.L.Burtt, Ducrosia anethifolia Boiss., Kalakia marginata (Boiss.) Alava, Mandenovia komarovii (Manden.) Alava, Notobubon galbanum (L.) Magee, Pastinaca pimpinellifolia M.Bieb., Symphyoloma graveolens C.A.Mey., Tordylium lanatum Boiss., Tordylium maximum L., Tordylium pestalozzae Boiss., and Zosima korovinii Pimenov) using a genome skimming approach and compared them with the available data from the tribe and close relatives. Phylogenomic analyses and tracking of specific rearrangements showed polyphyly of Tordylieae plastomes accompanied with a complex picture of multiple JLA and JLB shifts.

2. Results and Discussion

2.1. General Overview of Plastomes

All newly assembled plastomes of species from Tordylieae possessed a quadripartite structure typical for angiosperms [56] with an overall length ranging from 141,148 (D. anethifolia) to 150,103 (T. maximum) base pairs (bp) (Table 1). The LSC regions ranged from 99,620 (Z. korovinii) to 91,637 bp (T. maximum) in size, whereas the SSC ranged from 17,676 (T. maximum) to 16,931 bp (D. suffruticosum); the pair of inverted repeats separated by the small single-copy region ranged from 20,395 (T. maximum) to 12,493 bp (T. pestalozzae) (Table 1). The overall GC content varied slightly between 37.1% and 37.5%. The eleven plastomes contained 122–127 genes, including 79–82 protein-coding genes, 35–37 tRNA genes, and 8 rRNA genes (Supplementary Table S1). All but T. pestalozzae plastid genomes contained two pseudogenes, in all plastomes, one was a truncated copy of the ycf1 gene at the SSC/IRb junction (JSB), while another was either a part of the ycf2 gene at the LSC/IRa junction (JLA) (D. suffruticosum, N. galbanum, and T. maximum), a fragment of the psbA gene at the LSC/IRb junction (JLB) (M. komarovii, S. graveolens, P. pimpinellifolia, Z. korovinii, K. marginata, and D. anethifolia), or an exon of the ndhB gene at JLA (T. lanatum). The Tordylium pestalozzae plastome contained only a truncated copy of the ycf1 gene.
The plastome of Ducrosia showed a 489-bp inversion in the LSC region; it affects the orientation of the three tRNAs (trnE, trnY, trnD). This inversion was flanked by 39 complementary bases, and similar inversions in the same region were also revealed in other Apioideae plastomes not closely related to each other: Cyclospermum leptophyllum (Urb.) Constance (Pyramidoptereae tribe), Carum carvi L. (Careae tribe) [55], Angelica gigas Nakai, and Angelica morii Hayata (Selineae tribe) [25]. Convergent inversions are not rare in plastid genomes and have also been documented in other families, e.g., Ranunculaceae [57], Oleaceae [58], Asteraceae [59], Fabaceae [60,61,62]. Moreover, in a recent study, Charboneau et al. noticed possible heteroplasmy in Astragalus for the presence of the inversions [62], so actually, the inversion of the trnE-trnY-trnD region in Ducrosia and other Apioideae plastomes might be present in both orientations, with one variant being in a minor proportion.

2.2. Inverted Repeat Contractions and Expansions

Numerous indels have been accumulated in the studied plastomes, but their contribution to the genome length diversity is not high. This can be seen from the size variation of the SSC region (from 16,931 to 17,676 bp), the borders of which may be considered relatively stable, as they are in the same relative gene position. Substantial differences in length across the eleven plastomes and differences in total gene number (122, 124, 126, 127) are caused by contraction and expansion of the inverted repeats, reflecting their border shifts (Figure 1).
The longest IRs belong to T. maximum with JLB in ycf2; JLB in D. suffruticosum; and N. galbanum is situated within the same gene. In the plastomes of M. komarovii, S. graveolens, and P. pimpinellifolia, the inverted repeats are shortened, and JLB is followed by the ycf2 gene sequence. The shortest IRs are found in the Z. korovinii plastome, the position of JLB is several base pairs after the trnV(GAC) gene, and it is shared with D. anethifolia and K. marginata plastomes. In the plastome of T. pestalozzae, the inverted repeat includes the trnV(GAC) gene, while in the T. lanatum plastome the inverted repeat is expanded further with JLB situated within the intron of the ndhB gene. The last two JLB shifts are observed for the first time in the complete plastid genome studies and represent new examples of how variable the plastome organization within Apiaceae can be. Earlier studies using restriction fragment length polymorphism analysis allowed the definition of nine JLB junction types [30], while complete plastome sequences recovered new types [9,10,20,24,25,26], and nowadays, their number exceeds fifteen [26].
The IRa/LSC border is generally less prone to shift towards LSC because of the limited space where the insertion of the LSC sequence at JLB is not fatal. Indeed, rare known examples of such JLA shift from non-monocot angiosperms demonstrate the appearance of trnH(GUG) (sometimes with a partial sequence of psbA or a longer sequence, including matK, rps16, and trnQ(UUG) genes) in the rpl23-trnI spacer (in Actinidiaceae [51], Chenopodiaceae [52]), in the trnI-ycf2 spacer (in Linaceae [53]), in the ycf2-trnL spacer (in Acanthaceae [54]), and even invasion of the trnH sequence into the S10 operon was possible in Elaeagnus L. species [63], several Aristolochia L. species [64], Drimys granadensis L.f. [65], Stylidium debile F.Muell. [66], and Poeppiga procera (Poepp. ex Spreng.) C.Presl [67]. In our study, we have detected JLA shifts resulting in the inclusion of trnH and a partial sequence of psbA in IR with their appearance at JLB in the ycf2-trnL spacer in S. graveolens, M. komarovii, and P. pimpinellifolia plastomes similar to what was recently observed in two Heracleum and Pastinaca sativa L. plastomes [19,26]. Similar JLA shifts resulted in the appearance of the trnH and psbA partial sequence at JLB in the trnV-rrn16 spacer in Z. korovinii, D. anethifolia, and K. marginata plastomes, as it was already observed in Semenovia and Tetrataenium [20]. During annotation of plastomes of T. lanatum and T. pestalozzae, we did not find psbA or trnH gene sequences in the trnV-rrn16 spacer; however, the spacer contained an insertion of the non-coding sequence (957 and 1153 bp, respectively) that has significant similarity with the part of the rrn16-trnH spacer of the plastomes of Zosima, Ducrosia, and Kalakia. The insertion in the trnV-rrn16 spacer was verified and confirmed using PCR-amplification and Sanger sequencing in Z. korovinii, D. anethifolia, K. marginata, T. lanatum, and T. pestalozzae plastomes.
In the analyzed plastomes with insertions, which contain a partial psbA sequence, the LSC/IRb borders are notably stuck to the beginning of the insertions because the IRb expansion into LSC would inevitably cause the psbA gene disruption. At this point, the genomes of T. pestalozzae and T. lanatum demonstrate a departure of the JLB junction from the insertion place and hide an actual trajectory of the IR borders locomotion: they experienced expansion by the JLA shift followed by the acquisition of the insertion in the trnV-rrn16 spacer, then, two expansions of the JLB shifts—either separately in T. pestalozzae and T. lanatum, or one common for both and further expansion in T. lanatum only. Such “hidden” insertions are seen in alignment, but they may be easily overlooked when JLA shifts are screened by the annotated genes in the plastomes of other plants. For example, several Apiaceae plastomes in the Selineae tribe contain an insertion (ranging in length from 794 bp in Saposhnikovia divaricata (Turcz.) Schischk. to 1010 bp in Kitagawia praeruptora (Dunn) Pimenov [=Peucedanum praeruptorum Dunn]) at the 3′-end of the ycf2 gene, which is highly variable across land plants. This insertion retains similarity with the insertions in the trnV-rrn16 and ycf2-trnL spacers (Supplement Figure S1) of about 180 bp at its 3′-end. It might also have been generated by the JLA shift and awaits further detailed analysis.

2.3. Phylogenetic Analysis of Tordylieae Plastomes

Phylogenetic relationships were inferred using two matrices: complete plastome sequences with one inverted repeat excluded (“long” matrix) and protein-coding sequences (“CDS” matrix). The long data matrix contained only reliably aligned positions from intergenic regions, genes, and introns with the presence of gaps in less than half of the sequences. The only completely excluded intergenic spacer was the pseudo-ycf1-ndhF spacer because of high variability. Special attention was paid to the presence of small inversions as they increase the level of homoplasy and may affect the inferred topology, model parameters, and branch length estimation, as well as branch support assessment even in the full plastome data analyses [68,69,70]. Small inversions are widespread in the plastomes across the land plants [68,69,71] and have also been reported in Apioideae [15,42]. In our dataset, nineteen small inversions with a length ranging from 3 to 62 bases were identified, and one of them was found within the ycf1 gene. To restore the homology of the nucleotide bases, these inversions were reverse complemented. The resulting data matrix had 127,509 characters and contained 15,610 variable positions, 5326 of which were parsimony informative. The CDS data matrix contained only protein-coding sequences extracted from the long matrix; it had 67,875 characters and contained 6414 variable positions, 2144 of which were parsimony informative.
Our preliminary phylogenetic analyses showed that Ducrosia and Kalakia behaved as rogue-taxa [72] and destabilized the overall tree topology because of the absence of closest relatives, as we suppose. In the absence of Ducrosia and Kalakia, both unpartitioned and partitioned phylogenetic analyses resulted in the same topology; therefore, we present a phylogenetic tree reconstructed without Ducrosia and Kalakia (Figure 2) with insets indicating positions that they occupy when included in Bayesian analyses.
While most of internal branches of the tree gained the highest support irrespective of the used partitioning scheme and data set in all analyses, support for six branches varied (Table 2).
A sharp contrast of the high number of putative synapomorphies supporting sister relationships of Cachrys clade with Apieae (branch 6, Figure 2) with low “a la Bayes” support and posterior probability from CDS analyses is intriguing but will be investigated and discussed elsewhere.
Worth noticing are the short internal branches 1–5, connecting clades of Selineae tribe, Lefebvrea clade, Tordyliinae I, Sinodielsia clade, and Coriandrum + Nothosmyrnium + Tordyliinae II clade. The lower support of branches 2 and 4 in the CDS matrix analyses may be attributed to the different amount of phylogenetic information in the CDS and full data matrices, though the different fit of the model to the data or other reasons may also be relevant (discussed in [70]). A level of homoplasy in the CDS matrix is comparable with that in the full matrix (homoplasy index 0.164 and 0.175, respectively). Testing for substitutions saturation in the non-coding and protein-coding sequences showed no presence of saturation (Iss << Iss.c; p < 0.0001) in the examined data.
Despite the high support gained in all Bayesian and ML analyses for branch 2, the site concordance factor indicates that actually, there is no overwhelming support for any of the competing topologies. The sCF is close to its lower limit, and this branch is supported by the least number of putative synapomorphies. The sCFs for other short branches are higher but still show a probable presence of conflicting (or a low level of decisive) phylogenetic signal. Nevertheless, this tree is likely the best explanation of relationships of the available plastomes given used models and methods of phylogenetic inference.
As follows from the presented tree, the plastome of Z. korovinii has found its place among the plastomes of the Semenovia species (Tordyliinae II clade), while S. graveolens, M. komarovii, and P. pimpinellifolia settled down in the Tordyliinae I clade. The plastome of T. maximum became a separate lineage closely related to Heracleum + Pastinaca, and plastomes of two other Tordylium species formed a sister group to the Zosima + Semenovia + Tetrataenium clade. Plastomes from D. suffruticosum and N. galbanum, representing Lefebvrea clade of Tordylieae, together formed a sister group to the plastomes from the Selineae tribe. Relationships among the non-Tordylieae samples are identical to the recently presented Apioideae plastome’s phylogeny [26].
Thus, Tordylieae plastomes are of polyphyletic origin and form at least three not closely related lineages, which only partially correspond to the subtribal taxonomy. Plastomes of the Tordyliinae subtribe failed to form a monophyletic group in phylogenomic analyses [20,26,28], and our results are in good agreement with this statement. Plastomes of the genus Tordylium also turned out to be not monophyletic on our tree, the type species of the genus T. maximum separated from the congeneric species in the phylogenetic tree, and their plastomes differ by the presence/absence of insertion in the trnV-rrn16 spacer. It should be noted, that T. maximum, a European boreal species, is morphologically remote from the Mediterranean T. elegans and T. pestalozzae [73]. A possible polyphyly of Tordylium had also been suggested earlier based on nrITS data analysis [42,74]. Unfortunately, the genus received little attention in molecular phylogenetic studies and has never been sampled densely, so the questions addressing relationships between Tordylium species using nuclear and plastid sequences are still to be answered.
The close affinity of Symphyoloma, Mandenovia, Pastinaca, and Heracleum plastomes corresponds well to the results of nrITS studies [42,44,45].
Ducrosia and Kalakia presented the Cymbocarpum clade in our analyses, but despite the presence of insertion in the trnV-rrn16 spacer in both plastomes, the plastome of K. marginata seems to be not closely related to D. anethifolia, which in all analyses is entered in the Tordyliinae II clade (Figure 2, inset), while K. marginata was somewhat linked with the Tordyliinae I clade. Support for their placement and the placement itself varied depending on the data set used in the analyses and may change with the addition of other allied plastome sequences, so the plastome of K. marginata may represent a lineage in Tordylieae that is separate from Tordyliinae I. We expect that larger sampling with the inclusion of Cymbocarpum and other Tordylium species will help stabilize the positions of Ducrosia and Kalakia in the plastome tree.
The Lefebvrea clade looks like the only Tordylieae clade keeping monophyly, probably because of the undersampling of the “African peucedanoid group” in our analyses. According to the ITS-taxonomy [31], the group includes ten genera and earlier did not show monophyly in all phylogenetic analyses of the plastid markers (e.g., [75]). A sister relationship of the plastomes from the Lefebvrea clade and Selineae tribe, as well as relationships resolved with the short branches 1–5, also require confirmation with the inclusion of yet unsampled allied tribes and clades.
Taking into account the absence of several important apioid superclade lineages (Echinophoreae, Ormosciadium, Opopanax clade, etc.) and a well-known uncertainty in short branch inference, the plastome relationships in the presented tree should be treated with caution. The most comprehensive study of Apioideae molecular phylogeny using nrITS sequences (2911 accessions) has shown a monophyly of Tordylieae [76]. Recent analysis of nuclear phylogenomic data has confirmed at least monophyly of Tordyliinae and sister relationships of Tordyliinae with the Lefebvrea clade [48], which are not recovered in the obtained plastome phylogeny. At the same time, it is difficult to compare results of this investigation with the nuclear phylogenomic study [48] due to differences in taxon sampling: given the unpredictability of plastid phylogeny (i.e., non-monophyly of the Sinodielsia clade, Tordyliinae, and Pimpinelleae [26]), the inferred relationships of sampled representatives of the Lefebvrea clade should not automatically be applied to the entire Lefebvrea clade. Considering plastome and nuclear phylogeny discrepancies in a broader scale, Wen et al. suggested hybridization and incomplete lineage sorting as major sources of observed discordances [26]. Indeed, distant relationships of the Tordyliinae I and Tordyliinae II plastomes hardly can be altered with larger sampling but may be explained with chloroplast capture events, as proposed by Wen et al. [26]. At this stage, we also can hypothesize that ancient chloroplast capture due to hybridization might have played an important role in the Lefebvrea clade evolution.

2.4. Distribution of Insertion in the trnV-rrn16 Spacer across Tordylieae and Its Allies

The inferred phylogeny showed that all plastomes with psbA-trnH insertion in the ycf2-trnL spacer resided within the Tordyliinae I clade, forming a monophyletic group. The distribution of insertions in the trnV-rrn16 spacer, at first sight, assumes at least two appearances and one loss—in the common ancestor of two Semenovia species. The mechanisms responsible for the rearrangements at IR junctions are yet not clearly understood; they may involve gene conversion or homologous recombination induced by double-strand break and followed by Holliday junction resolution or illegal recombination [5,77]. In recent years, active studies of the double-strand break repair pathways have provided growing evidence that the error-prone microhomology-mediated mechanisms play important roles in the plastid DNA evolution and may be responsible for structural rearrangements [78,79,80].
Whatever mechanism (or combination of) drives the IR borders in plastome, the absence of the psbA-trnH insertion in the trnV-rrn16 spacer in Angelica sinensis (accessions MT921983 and MT921984), Semenovia gyirongensis Q.Y.Xiao & X.J.He (NC_042912), and Semenovia thomsonii (C.B.Clarke) Manden. (NC_057441) plastomes is surprising. To check the accuracy of LSC/IRb junction assembly, S. thomsonii and A. sinensis raw data were retrieved from the sequence read archive (SRR14561442 and SRR13247229, respectively; raw data for S. gyirongensis were not accessible). Read mapping showed a drop of coverage depth at the JLB junction, and these two plastomes were reassembled. For A. sinensis, three contigs, corresponding to LSC, SSC, and IR regions, were produced, while for S. thomsonii, four contigs resulted because of the split of IR. Contigs were joined in a single plastome sequence by virtue of overlapping ends, and the annotation of plastomes revealed the presence of psbA-trnH insertions in the trnV(GAC)-rrn16 spacer in both plastomes, confirmed with plastome alignment. Thus, in two out of three species, the “disappearance” of the insertion represents a misassembly rather than the real biological phenomenon; it is highly likely that the same is true for S. gyirongensis.
To assess the distribution of the insertion across a wider sample of Tordylieae, a short survey of 16 species, including Ducrosia assadii Alava, Cymbocarpum anethoides DC. ex C.A.Mey., 9 Semenovia, 3 Tordylium, and 2 Tetrataenium species (Supplementary Table S2), was performed using a pair of primers annealed to trnV(GAC) and trnH(GUG) sequences. The insertion was found in all examined specimens, indicating that its presence is widespread and stable and, surprisingly, that plastomes within Tordylium are even more dissimilar than presented in this study. Notably, the psbA pseudogene in the insertion in the Cymbocarpum and Kalakia plastomes are of the same length.
Among the insertions in the trnV(GAC)-rrn16 spacer, three are shorter as they do not contain psbA-trnH sequences (T. pestalozzae, T. lanatum, and N. japonicum, Figure 3).
The alignment of the plastome sequences (Figure 3) shows that the insertion sites in the trnV(GAC)-rrn16 spacer in the clade uniting Coriandrum and Nothosmyrnium with Tordyliinae II and in the Sinodielsia clade in A. sinensis plastome do not match and occur autonomously. Coriandrum’s insertion stands out by its length and differs from Nothosmyrnium and Tordyliinae II plastomes by the presence of the trnV(GAC) pseudogene in the insertion: this pseudogene is a 5′-truncated copy of the trnV gene. It is supposed to emerge as a consequence of a double-strand break repair through the sequence-dependent strand annealing mechanism [55] but might also have arisen earlier by duplication of the trnV gene. Considering the fact that the tandem duplication of tRNA (trnH(GUG)) genes in the Piper plastomes is observed at the IR border [81] (see also Haberle et al. [82]), this is a quite possible scenario. Anyway, as neither Nothosmyrnium nor Tordyliinae II plastomes contain the trnV pseudogene in IRs, one may conclude that the psbA-trnH insertion in Coriandrum is an independent event. It should also be noted that among all insertions examined, only Kalakia showed a high similarity (91%) of the last 70 bases of the non-coding part of the insertion with the trnK-rps16 spacer sequence, suggesting independent JLA shift in the Kalakia plastome and its separation from Ducrosia.
Thus, within the analyzed plastomes, due to the different positions of the LSC/IRb borders, similar but autonomous JLA shifts have caused three different placements of the psbA-trnH insertions, and within Tordylieae, the insertions in the trnV-rrn16 spacer happened more than once. At the same time, apparently, it is not so easy for a plastome to be gotten rid of once acquired and captured in IRs insertion without a trace; it should be extremely rare, if ever possible, and these insertions may serve as phylogenetic markers for certain clades. Insertion in the ycf2-trnL(CAA) spacer within Tordyliinae I seems to have a single origin and inherited by descendants; the origin may be attributed to the Heracleum + Pastinaca common ancestor on the plastome tree [74]. The mix of “long” (containing psbA-trnH sequences) and “short” insertions in the trnV-rrn16 spacer at this stage does not allow inferring whether the “long” insertions have shortened or “short” ones have expanded and whether they have a common origin. Unknown positions of the surveyed Tordylium species with the “long” insertion and unresolved placement of D. anethifolia complicate the situation. Nevertheless, for the members of the Semenovia + Tetrataenium clade, the insertion also has an obvious single origin, and we believe the same will be found in other members of this clade in the forthcoming plastome studies. During our survey, we indeed determined the presence of the insertion in S. eriocarpa (Bornm. & Gauba) Lyskov & Kljuykov; the species was just recently attributed to the genus Semenovia (formerly Seseli elbursense Pimenov & Kljuykov) based on the morphological features and nrITS and nrETS phylogenetic analysis [83]. The opposite statement cannot be completely true given possible independence of insertion events; however, the presence of the same insertion in the plastome from early branched Physospermopsis clade (GenBank accession MW820162, submitted as Hansenia forbesii) raises the question of whether the specimen is really not Tetrataenium or Semenovia.

3. Materials and Methods

3.1. Plant Material and DNA Extraction

Most samples were collected and identified by M. G. Pimenov and his colleagues during expeditions to the Caucasus, Turkey, and Iran. Additional samples were obtained from E (Royal Botanic Garden, Edinburgh, UK), MW (Moscow State University, Moscow, Russia) herbaria and the carpological collection of the Botanical Garden of Moscow State University. Investigated species and their voucher information are listed in Table 3.
Total genomic DNA (gDNA) from the herbarium material (fruit and leaf) was isolated using either a DNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s protocol or a modified version of Doyle and Doyle [84].

3.2. Genome Sequencing, Plastome Assembly, and psbA-trnH Insertion Survey

The DNA concentration was determined using a Qubit dsDNA HS Assay Kit (Life Technologies, Eugene, OR, USA). Total DNA (1 μg) was fragmented by sonication using a Covaris S220 instrument (Covaris Inc., Woburn, MA, USA). The DNA library was prepared using a TruSeq DNA Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. The library was sequenced using an Illumina Hiseq2000 or Nextseq500 instrument with a read length of 100 (for Hiseq2000) or 75 bp (for Nextseq500) from each end of the fragment. The resulting reads were processed using the CLC Genomics Workbench software v.5.5. (www.clcbio.com) and Trimmomatic version 0.32 [85]. De novo assembly was performed using a CLC Genomics Workbench and IDBA version 1.1.3 [86]. The resulting contigs, showing homology to plastid genomes, were joined by overlapping ends. To check the accuracy of assembly, trimmed paired reads were mapped to the whole assembled plastome sequence and to the “left” and “right” halves of the circularized plastome using Novoalign v.4.03.00 (www.novocraft.com) followed by manual inspection with Tablet version 1.21.02.08 [87]. This approach allows the definition of IR borders and to confirm the beginning and end of the plastome’s monomer. Genome annotations were performed with the web application GeSeq [88] and checked manually using the Artemis annotation tool [89]; plastome gene maps were drawn using OGDraw version 1.3.1 [90]. Raw data were submitted to GenBank and can be found within the BioProject PRJNA772711.
For the reassembly of A. sinensis and S. thomsonii plastomes, raw data were retrieved from the sequence read archive (SRR13247229 and SRR14561442, respectively). Data processing, genome assembly, and read mapping were performed as described. Reassembled annotated plastomes of A. sinensis and S. thomsonii are available in the Third-Party Annotation Section of the DDBJ/ENA/GenBank databases under the accession numbers TPA BK059532 and BK059899, respectively.
In order to confirm the presence of insertions in the trnV(GAC)-rrn16 spacer in assembled plastomes of Z. korovinii, D. anethifolia, K. marginata, T. lanatum, and T. pestalozzae, we designed primers for PCR amplification and sequencing. To assess the distribution of insertions in the trnV(GAC)-rrn16 spacer, another pair of primers was used (Table 4); their orientation does not allow the amplification when trnV and trnH are located at the IRa/LSC boundary.
PCR amplification was performed on a Biometra T3000 Thermocycler using an Encyclo PCR kit (Evrogen JSC, Moscow, Russia). Each PCR reaction cycle proceeded as follows: (1) 40 s at 95 °C to denature the double-stranded template DNA; (2) 30 s at 58 °C to anneal primers to single-stranded template DNA; and (3) 30 s at 72 °C to extend primers. The first cycle was preceded by an initial denaturation step of 2 min at 95 °C. To allow completion of unfinished DNA strands and to terminate PCR reaction, a 7-min 72 °C extension period followed the completion of 30 thermal cycles. Each PCR product was purified with a Cleanup Mini kit (Evrogen, Moscow, Russia). PCR products were sequenced (Evrogen, Moscow, Russia) with an ABI 310 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA).
The following 16 species of Tordylieae were surveyed for the presence of insertion in the trnV(GAC)-rrn16 spacer: Cymbocarpum anethoides DC.; Ducrosia assadii Alava; Semenovia alaica Lazkov; Semenovia dasycarpa Regel & Schmalh.) Korovin ex Pimenov & V.N.Tikhom.; Semenovia dichotoma (Boiss.) Manden.; Semenovia eriocarpa (Bornm. & Gauba) Lyskov & Kljuykov; Semenovia glabrior (C.B.Clarke) Pimenov & Kljukov; Semenovia heterodonta (Korov.) Manden.; Semenovia pamirica (Lipsky) Manden.; Semenovia pimpinellioides (Nevski) Manden.; Semenovia tragioides (Boiss.) Manden.; Tetrataenium cardiocarpum (Rech.f. & Riedl) Manden; Tetrataenium olgae (Regel & Schmalh.) Manden; Tordylium apulum Rchb.; Tordylium elegans (Boiss. & Balansa) Alava & Hub.-Mor.; Tordylium hasselquistiae DC. Voucher information and GenBank accession numbers are presented in Supplementary Table S2. PCR amplification and sequencing were performed as described.

3.3. Phylogenetic Analysis

For phylogenetic analysis, we selected 42 plastid genome sequences from the apioid superclade of the Apioideae subfamily. Earlier, the most representative plastome phylogenetic studies showed that the apioid superclade is a monophyletic group with Careae and Pyramidoptereae tribes branching first [25,26]; therefore, plastomes of Carum carvi (Careae), Crithmum maritimum L., and Cyclospermum leptophyllum (Pyramidoptereae) were used as an outgroup. The Selineae tribe is the most represented tribe in the GenBank plastome database, but as the tribe was also inferred monophyletic [25,26], we restricted ourselves to only four early diverged representatives of Selineae. The list of the retrieved from GenBank plastomes with currently adopted species names and accession numbers are presented in Supplementary Table S3.
Plastome sequences were aligned using MAFFT version 7.471 [91,92] and corrected manually in Bioedit [93]. In aligned plastomes, nineteen small inversions were identified and reverse complemented prior to the analyses. Regions where positional homology could not be firmly determined were excluded along with the gap-rich positions and one copy of the inverted repeat. In addition to the truncated plastome “long”-data matrix, all protein-coding sequences were combined in the “CDS”-data matrix, and both matrices were subjected to phylogenetic analyses.
Plastome’s phylogenetic relations inference was performed using the Bayesian approach and maximum likelihood analysis. The Bayesian inference was performed with the MrBayes version 3.2.6 [94] using four independent runs of 25 million generations and four chains sampling every 1000th generation. The first two million generations were discarded as burn-in, and the remaining trees were combined in a majority-rule consensus tree to obtain the Bayesian posterior probabilities (PP). The maximum likelihood analyses were performed with the IQ-tree version 2.1.1 [95]. Internal branch support was assessed with the approximate likelihood-based approach “a la Bayes” [96]. Additionally, to assess variation of phylogenetic signal in our data, the site concordance factor for internal branches—a measure of concordance at the level of individual sites [97]—was estimated in IQ-tree.
To achieve a better fit of the nucleotide substitution models to the data, partitioned analysis was applied to the long data matrix with model parameters unlinked across partitions. The partitions were defined either according to the coding properties—non-coding, protein coding, rRNA, and tRNA genes (four partitions)—or according to the plastome structure—SSC, IR, and LSC regions (three partitions). As sequences in the inverted repeat and single-copy regions have different rates of substitutions [98], the heterotachy model implemented in IQ-tree [99] was used for the three-partition dataset to accommodate a possible substitution rate heterogeneity in the lineages due to IR border shifts. In this case, the region between the ycf2 and rrn16 genes was treated as a separate partition; branch support was assessed using 500 nonparametric bootstrap resamplings. Bayesian analysis using partitioned data and covarion model has also been tried, but Markov chains did not show a tendency to converge after 5 million generations, and the analysis was terminated.
The GTR + Γ model of nucleotide substitutions was selected for both data matrices as the most appropriate according to the Akaike information criterion [100] in PAUP version 4.0a [101] and used in unpartitioned and “three partitions” phylogenetic analyses. For analysis of the “four partitions” data, models GTR + F + R3, GTR + F + R2, F81 + F + I, and K2P + I were selected for non-coding, protein coding, rRNA, and tRNA partitions, accordingly, by Bayesian information criterion in the IQ-tree built-in ModelFinder utility [102].
The test for substitutions saturation in the non-coding and protein-coding sequences was performed in DAMBE [103].

4. Conclusions

The new data obtained in this study have expanded our knowledge on the range of plastome variability in Apiaceae and demonstrated high mobility of the LSC/IR boundaries within Tordylieae. The more data accumulated, the more chaotic JLB movements within the apioid superclade seem, diminishing the value of the JLB junction type for phylogenetic purposes—closely related plastomes may have different junction types (as in T. pestalozzae and T. lanatum), and a shared junction type may be confusing when preceding events are hidden (as A. sinensis). On the contrary, the presence of the specific rearrangements marks specific lineages and may serve as a phylogenetic marker for certain clades.
With eleven new plastid genomes of Tordylieae, the degree of observed nuclear/plastome discordance has become higher. Plastome clades revealed in our study within Tordylieae coincide more or less with those from nuclear sequences analyses; however, they appeared to be not closely related. Concatenated phylogenetic analyses were unanimous in the highly supported close relationship of the sampled plastomes of the Lefebvrea clade with those of the Selineae tribe and in splitting plastomes of the Cymbocarpum clade into independent lineages of Kalakia and Ducrosia with the latter nested within the Tordyliinae II clade. However, despite the high support values obtained, the relationships of plastid genomes revealed in this study should be examined further with larger sampling. Currently, both nuclear transcriptome [104] and plastome phylogenetic analyses reveal short branches separating Sinodielsia clade, Tordylieae, and Selineae lineages ([26], this study), and both still suffer from missing lineages and tribes. Possible incomplete lineage sorting and hybridization accompanying fast radiation of these clades may complicate the task of true relationship inference, and additional data and analyses will contribute to our understanding of apioid superclade diversification ways.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11050709/s1, Figure S1: Alignment of matching sequences of insertions in ycf2, trnV-rrn16, and ycf2-trnL spacers, Table S1: Gene contents in the eleven Tordylieae plastomes, Table S2: Survey for the presence of insertion in the trnV(GAC)-rrn16 spacer, Table S3: List of chloroplast genome sequences retrieved from GenBank for phylogenetic analysis.

Author Contributions

Conceptualization, T.S. and C.V.-R.; validation, T.S. and C.V.-R.; formal analysis, T.S. and M.L.; investigation, M.L., E.T., G.D. and C.V.-R.; resources, C.V.-R.; data curation, M.L., E.T., G.D. and C.V.-R.; writing—original draft preparation, T.S.; writing—review and editing, T.S., M.L., E.T., G.D., M.P. and C.V.-R.; visualization, T.S.; supervision, T.S. and C.V.-R.; project administration, T.S.; funding acquisition, T.S. All authors have read and agreed to the published version of the manuscript.

Funding

The reported study was funded by RFBR, project number 20-04-01128. The APC was funded by T.S.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The plastome sequence data presented in this study and the raw data are deposited in GenBank (accession numbers OL839263–OL839272 and NC_027450; BioProject number PRJNA772711; SRA accession numbers SRR16481207, SRR17212745, SRR17212746, SRR17215687–SRR17215693, and SRR17248036).

Acknowledgments

The authors thank two anonymous reviewers for helpful comments and L. Brovko for editing the manuscript.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Mower, J.P.; Vickrey, T.L. Structural Diversity Among Plastid Genomes of Land Plants. In Advances in Botanical Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 85, pp. 263–292. ISBN 978-0-12-813457-3. [Google Scholar]
  2. Ruhlman, T.A.; Jansen, R.K. Plastid Genomes of Flowering Plants: Essential Principles. In Chloroplast Biotechnology; Humana: New York, NY, USA, 2021; pp. 3–47. [Google Scholar]
  3. Ruhlman, T.A.; Jansen, R.K. Aberration or Analogy? The Atypical Plastomes of Geraniaceae. In Advances in Botanical Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 85, pp. 223–262. ISBN 978-0-12-813457-3. [Google Scholar]
  4. Wicke, S.; Naumann, J. Molecular Evolution of Plastid Genomes in Parasitic Flowering Plants. In Advances in Botanical Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 85, pp. 315–347. ISBN 978-0-12-813457-3. [Google Scholar]
  5. Goulding, S.E.; Wolfe, K.H.; Olmstead, R.G.; Morden, C.W. Ebb and Flow of the Chloroplast Inverted Repeat. MGG Mol. Gen. Genet. 1996, 252, 195–206. [Google Scholar] [CrossRef] [PubMed]
  6. Logacheva, M.D.; Krinitsina, A.A.; Belenikin, M.S.; Khafizov, K.; Konorov, E.A.; Kuptsov, S.V.; Speranskaya, A.S. Comparative Analysis of Inverted Repeats of Polypod Fern (Polypodiales) Plastomes Reveals Two Hypervariable Regions. BMC Plant Biol. 2017, 17, 255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Ruhlman, T.; Lee, S.-B.; Jansen, R.K.; Hostetler, J.B.; Tallon, L.J.; Town, C.D.; Daniell, H. Complete Plastid Genome Sequence of Daucus Carota: Implications for Biotechnology and Phylogeny of Angiosperms. BMC Genom. 2006, 7, 222. [Google Scholar] [CrossRef] [PubMed]
  8. Downie, S.R.; Peery, R.M.; Jansen, R.K. Another First for the Apiaceae: Evidence for Mitochondrial DNA Transfer into the Plastid Genome. J. Fac. Pharm. Istanb. Univ. 2015, 44, 131–144. [Google Scholar]
  9. Downie, S.R.; Jansen, R.K. A Comparative Analysis of Whole Plastid Genomes from the Apiales: Expansion and Contraction of the Inverted Repeat, Mitochondrial to Plastid Transfer of DNA, and Identification of Highly Divergent Noncoding Regions. Syst. Bot. 2015, 40, 336–351. [Google Scholar] [CrossRef]
  10. Samigullin, T.H.; Logacheva, M.D.; Terenteva, E.I.; Degtjareva, G.V.; Vallejo-Roman, C.M. Plastid Genome of Seseli Montanum: Complete Sequence and Comparison with Plastomes of Other Members of the Apiaceae Family. Biochem. Mosc. 2016, 81, 981–985. [Google Scholar] [CrossRef]
  11. Yuan, C.; Zhong, W.; Mou, F.; Gong, Y.; Pu, D.; Ji, P.; Huang, H.; Yang, Z.; Zhang, C. The Complete Chloroplast Genome Sequence and Phylogenetic Analysis of Chuanminshen (Chuanminshen Violaceum Sheh et Shan). Physiol. Mol. Biol. Plants 2017, 23, 35–41. [Google Scholar] [CrossRef] [Green Version]
  12. Yang, J.; Yue, M.; Niu, C.; Ma, X.-F.; Li, Z.-H. Comparative Analysis of the Complete Chloroplast Genome of Four Endangered Herbals of Notopterygium. Genes 2017, 8, 124. [Google Scholar] [CrossRef]
  13. Spooner, D.M.; Ruess, H.; Iorizzo, M.; Senalik, D.; Simon, P. Entire Plastid Phylogeny of the Carrot Genus (Daucus, Apiaceae): Concordance with Nuclear Data and Mitochondrial and Nuclear DNA Insertions to the Plastid. Am. J. Bot. 2017, 104, 296–312. [Google Scholar] [CrossRef] [Green Version]
  14. Samigullin, T.H.; Logacheva, M.D.; Degtjareva, G.V.; Terentieva, E.I.; Vallejo-Roman, C.M. Complete Plastid Genome of Critically Endangered Plant Prangos Trifida (Apiaceae: Apioideae). Conserv. Genet. Resour. 2018, 10, 847–849. [Google Scholar] [CrossRef]
  15. Mustafina, F.U.; Yi, D.; Choi, K.; Shin, C.H.; Tojibaev, K.S.; Downie, S.R. A Comparative Analysis of Complete Plastid Genomes from Prangos Fedtschenkoi and Prangos Lipskyi (Apiaceae). Ecol. Evol. 2018, 9, 364–377. [Google Scholar] [CrossRef] [PubMed]
  16. Park, I.; Yang, S.; Kim, W.J.; Noh, P.; Lee, H.O.; Moon, B.C. The Complete Chloroplast Genome of Cnidium Officinale Makino. Mitochondrial DNA Part B Resour. 2018, 3, 490–491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Zhang, H.; Wang, X.-F.; Cao, D.; Niu, J.-F.; Wang, Z.-Z. The Complete Chloroplast Genome Sequence of Angelica Tsinlingensis (Apioideae). Mitochondrial DNA Part B Resour. 2018, 3, 480–481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Park, I.; Yang, S.; Kim, W.; Song, J.-H.; Lee, H.-S.; Lee, H.; Lee, J.-H.; Ahn, S.-N.; Moon, B. Sequencing and Comparative Analysis of the Chloroplast Genome of Angelica Polymorpha and the Development of a Novel Indel Marker for Species Identification. Molecules 2019, 24, 1038. [Google Scholar] [CrossRef] [Green Version]
  19. Kang, L.; Yu, Y.; Zhou, S.-D.; He, X.-J. Sequence and Phylogenetic Analysis of Complete Plastid Genome of a Medicinal Plant Heracleum Moellendorffii. Mitochondrial DNA Part B 2019, 4, 1251–1252. [Google Scholar] [CrossRef] [Green Version]
  20. Kang, L.; Xie, D.; Xiao, Q.; Peng, C.; Yu, Y.; He, X. Sequencing and Analyses on Chloroplast Genomes of Tetrataenium Candicans and Two Allies Give New Insights on Structural Variants, DNA Barcoding and Phylogeny in Apiaceae Subfamily Apioideae. PeerJ 2019, 7, e8063. [Google Scholar] [CrossRef] [Green Version]
  21. Xiao, Q.-Y.; Feng, T.; Yu, Y.; Luo, Q.; He, X.-J. The Complete Chloroplast Genome of Semenovia Gyirongensis (Tribe Tordylieae, Apiaceae). Mitochondrial DNA Part B 2019, 4, 1863–1864. [Google Scholar] [CrossRef] [Green Version]
  22. Luo, L.; Yu, Y. The Complete Chloroplast Genome of Cryptotaenia Japonica. Mitochondrial DNA Part B 2019, 4, 1650–1651. [Google Scholar] [CrossRef] [Green Version]
  23. Gou, W.; Jia, S.-B.; Price, M.; Guo, X.-L.; Zhou, S.-D.; He, X.-J. Complete Plastid Genome Sequencing of Eight Species from Hansenia, Haplosphaera and Sinodielsia (Apiaceae): Comparative Analyses and Phylogenetic Implications. Plants 2020, 9, 1523. [Google Scholar] [CrossRef]
  24. Ren, T.; Li, Z.-X.; Xie, D.-F.; Gui, L.-J.; Peng, C.; Wen, J.; He, X.-J. Plastomes of Eight Ligusticum Species: Characterization, Genome Evolution, and Phylogenetic Relationships. BMC Plant Biol. 2020, 20, 519. [Google Scholar] [CrossRef]
  25. Wang, M.; Wang, X.; Sun, J.; Wang, Y.; Ge, Y.; Dong, W.; Yuan, Q.; Huang, L. Phylogenomic and Evolutionary Dynamics of Inverted Repeats across Angelica Plastomes. BMC Plant Biol. 2021, 21, 26. [Google Scholar] [CrossRef] [PubMed]
  26. Wen, J.; Xie, D.-F.; Price, M.; Ren, T.; Deng, Y.-Q.; Gui, L.-J.; Guo, X.-L.; He, X.-J. Backbone Phylogeny and Evolution of Apioideae (Apiaceae): New Insights from Phylogenomic Analyses of Plastome Data. Mol. Phylogenet. Evol. 2021, 161, 107183. [Google Scholar] [CrossRef] [PubMed]
  27. Yuan, C.; Sha, X.; Xiong, M.; Zhong, W.; Wei, Y.; Li, M.; Tao, S.; Mou, F.; Peng, F.; Zhang, C. Uncovering Dynamic Evolution in the Plastid Genome of Seven Ligusticum Species Provides Insights into Species Discrimination and Phylogenetic Implications. Sci. Rep. 2021, 11, 8844. [Google Scholar] [CrossRef] [PubMed]
  28. Xiao, Q.-Y.; Feng, T.; Luo, Q.; He, X.-J. The Complete Chloroplast Genome of Semenovia Thomsonii (Tordylieae: Apiaceae), a New Record from Xizang, China. Mitochondrial DNA Part B Resour. 2021, 6, 1911–1913. [Google Scholar] [CrossRef]
  29. Zhu, A.; Guo, W.; Gupta, S.; Fan, W.; Mower, J.P. Evolutionary Dynamics of the Plastid Inverted Repeat: The Effects of Expansion, Contraction, and Loss on Substitution Rates. New Phytol. 2016, 209, 1747–1756. [Google Scholar] [CrossRef] [Green Version]
  30. Plunkett, G.M.; Downie, S.R. Expansion and Contraction of the Chloroplast Inverted Repeat in Apiaceae Subfamily Apioideae. Syst. Bot. 2000, 25, 648. [Google Scholar] [CrossRef]
  31. Downie, S.R.; Spalik, K.; Katz-Downie, D.S.; Reduron, J.-P. Major Clades within Apiaceae Subfamily Apioideae as Inferred by Phylogenetic Analysis of nrDNA ITS Sequences. Plant Divers. Evol. 2010, 128, 111–136. [Google Scholar] [CrossRef] [Green Version]
  32. Plunkett, G.M.; Pimenov, M.G.; Reduron, J.-P.; Kljuykov, E.V.; van Wyk, B.-E.; Ostroumova, T.A.; Henwood, M.J.; Tilney, P.M.; Spalik, K.; Watson, M.F.; et al. Apiaceae. In Flowering Plants. Eudicots; Springer: Cham, Switzerland, 2018; pp. 9–206. [Google Scholar]
  33. Koch, W.D.J. Generum Tribuumque Plantarum Umbelliferarum Nova Dispositio. Nova Acta Acad. Caesareae Leopold. Carol. Ger. Nat. Curiosorum 1824, 12, 55–156. [Google Scholar]
  34. Pimenov, M.G.; Leonov, M.V. The Genera of the Umbelliferae. A Nomenclator; Royal Botanic Gardens, Kew: London, UK, 1993; ISBN 978-0-947643-58-4. [Google Scholar]
  35. Downie, S.R.; Katz-Downie, D.S.; Watson, M.F. A Phylogeny of the Flowering Plant Family Apiaceae Based on Chloroplast DNA rpl16 and rpoC1 Intron Sequences: Towards a Suprageneric Classification of Subfamily Apioideae. Am. J. Bot. 2000, 87, 273–292. [Google Scholar] [CrossRef] [Green Version]
  36. Downie, S.R.; Watson, M.F.; Spalik, K.; Katz-Downie, D.S. Molecular Systematics of Old World Apioideae (Apiaceae): Relationships among Some Members of Tribe Peucedaneae Sensu Lato, the Placement of Several Island-Endemic Species, and Resolution within the Apioid Superclade. Can. J. Bot. 2000, 78, 506–528. [Google Scholar] [CrossRef]
  37. Downie, S.R.; Plunkett, G.M.; Watson, M.F.; Spalik, K.; Katz-Downie, D.S.; Valiejo-Roman, C.M.; Terentieva, E.I.; Troitsky, A.V.; Lee, B.-Y.; Lahham, J.; et al. Tribes and Clades within Apiaceae Subfamily Apioideae: The Contribution of Molecular Data. Edinb. J. Bot. 2001, 58, 301–330. [Google Scholar] [CrossRef]
  38. Spalik, K.; Downie, S.R. Intercontinental Disjunctions in Cryptotaenia (Apiaceae, Oenantheae): An Appraisal Using Molecular Data. J. Biogeogr. 2007, 34, 2039–2054. [Google Scholar] [CrossRef]
  39. Ajani, Y.; Ajani, A.; Cordes, J.M.; Watson, M.F.; Downie, S.R. Phylogenetic Analysis of nrDNA ITS Sequences Reveals Relationships within Five Groups of Iranian Apiaceae Subfamily Apioideae. Taxon 2008, 57, 383–401. [Google Scholar] [CrossRef]
  40. Winter, P.J.D.; Magee, A.R.; Phephu, N.; Tilney, P.M.; Downie, S.R.; van Wyk, B.-E. A New Generic Classification for African Peucedanoid Species (Apiaceae). Taxon 2008, 57, 347–364. [Google Scholar] [CrossRef]
  41. Zhou, J.; Peng, H.; Downie, S.R.; Liu, Z.-W.; Gong, X. A Molecular Phylogeny of Chinese Apiaceae Subfamily Apioideae Inferred from Nuclear Ribosomal DNA Internal Transcribed Spacer Sequences. Taxon 2008, 57, 402–416. [Google Scholar] [CrossRef]
  42. Logacheva, M.D.; Valiejo-Roman, C.M.; Pimenov, M.G. ITS Phylogeny of West Asian Heracleum Species and Related Taxa of Umbelliferae–Tordylieae W.D.J.Koch, with Notes on Evolution of Their psbA-trnH Sequences. Plant Syst. Evol. 2008, 270, 139–157. [Google Scholar] [CrossRef]
  43. Magee, A.R.; van Wyk, B.-E.; Tilney, P.M.; Downie, S.R. Generic Delimitations and Relationships of the Cape Genera Capnophyllum, Dasispermum, and Sonderina, the North African Genera Krubera and Stoibrax, and a New Monotypic Genus of the Subfamily Apioideae (Apiaceae). Syst. Bot. 2009, 34, 580–594. [Google Scholar] [CrossRef]
  44. Logacheva, M.D.; Valiejo-Roman, C.M.; Degtjareva, G.V.; Stratton, J.M.; Downie, S.R.; Samigullin, T.H.; Pimenov, M.G. A Comparison of nrDNA ITS and ETS Loci for Phylogenetic Inference in the Umbelliferae: An Example from Tribe Tordylieae. Mol. Phylogenet. Evol. 2010, 57, 471–476. [Google Scholar] [CrossRef]
  45. Yu, Y.; Downie, S.R.; He, X.; Deng, X.; Yan, L. Phylogeny and Biogeography of Chinese Heracleum (Apiaceae Tribe Tordylieae) with Comments on Their Fruit Morphology. Plant Syst. Evol. 2011, 296, 179–203. [Google Scholar] [CrossRef]
  46. Banasiak, Ł.; Piwczyński, M.; Uliński, T.; Downie, S.R.; Watson, M.F.; Shakya, B.; Spalik, K. Dispersal Patterns in Space and Time: A Case Study of Apiaceae Subfamily Apioideae. J. Biogeogr. 2013, 40, 1324–1335. [Google Scholar] [CrossRef]
  47. Mousavi, S.; Mozaffarian, V.; Mummenhoff, K.; Downie, S.R.; Zarre, S. An Updated Lineage-Based Tribal Classification of Apiaceae Subfamily Apioideae with Special Focus on Iranian Genera. Syst. Biodivers. 2021, 19, 89–109. [Google Scholar] [CrossRef]
  48. Clarkson, J.J.; Zuntini, A.R.; Maurin, O.; Downie, S.R.; Plunkett, G.M.; Nicolas, A.N.; Smith, J.F.; Feist, M.A.E.; Gutierrez, K.; Malakasi, P.; et al. A Higher-Level Nuclear Phylogenomic Study of the Carrot Family (Apiaceae). Am. J. Bot. 2021, 108, 1252–1269. [Google Scholar] [CrossRef] [PubMed]
  49. Downie, S.R.; Ramanath, S.; Katz-Downie, D.S.; Llanas, E. Molecular Systematics of Apiaceae Subfamily Apioideae: Phylogenetic Analyses of Nuclear Ribosomal DNA Internal Transcribed Spacer and Plastid rpoC1 Intron Sequences. Am. J. Bot. 1998, 85, 563–591. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Doğru-Koca, A.; Bagheri, A.; Moradi, A. Investigations on the Phylogenetic Position of the Ditypic Genus Froriepia Reveal Yildirimlia, a New Genus of Apiaceae. Taxon 2020, 69, 1259–1272. [Google Scholar] [CrossRef]
  51. Wang, W.-C.; Chen, S.-Y.; Zhang, X.-Z. Chloroplast Genome Evolution in Actinidiaceae: clpP Loss, Heterogenous Divergence and Phylogenomic Practice. PLoS ONE 2016, 11, e0162324. [Google Scholar] [CrossRef]
  52. Sharpe, R.M.; Williamson-Benavides, B.; Edwards, G.E.; Dhingra, A. Methods of Analysis of Chloroplast Genomes of C3, Kranz Type C4 and Single Cell C4 Photosynthetic Members of Chenopodiaceae. Plant Methods 2020, 16, 119. [Google Scholar] [CrossRef]
  53. de Santana Lopes, A.; Pacheco, T.G.; dos Santos, K.G.; Vieira, L.d.N.; Guerra, M.P.; Nodari, R.O.; de Souza, E.M.; de Oliveira Pedrosa, F.; Rogalski, M. The Linum usitatissimum L. Plastome Reveals Atypical Structural Evolution, New Editing Sites, and the Phylogenetic Position of Linaceae within Malpighiales. Plant Cell Rep. 2018, 37, 307–328. [Google Scholar] [CrossRef]
  54. Chen, H.; Shao, J.; Zhang, H.; Jiang, M.; Huang, L.; Zhang, Z.; Yang, D.; He, M.; Ronaghi, M.; Luo, X.; et al. Sequencing and Analysis of Strobilanthes Cusia (Nees) Kuntze Chloroplast Genome Revealed the Rare Simultaneous Contraction and Expansion of the Inverted Repeat Region in Angiosperm. Plant Sci. 2018, 324. [Google Scholar] [CrossRef] [Green Version]
  55. Peery, R. Understanding Angiosperm Genome Interactions and Evolution: Insights from Sacred Lotus (Nelumbo Nucifera) and the Carrot Family (Apiaceae). Ph.D. Thesis, University of Illinois at Urbana-Champaign, Champaign, IL, USA, 2015. [Google Scholar]
  56. Jansen, R.K.; Ruhlman, T.A. Plastid Genomes of Seed Plants. In Genomics of Chloroplasts and Mitochondria; Bock, R., Knoop, V., Eds.; Springer: Dordrecht, The Netherlands, 2012; Volume 35, pp. 103–126. ISBN 978-94-007-2919-3. [Google Scholar]
  57. Hoot, S.; Palmer, J. Structural Rearrangements, Including Parallel Inversions, within the Chloroplast Genome of Anemone and Related Genera. J. Mol. Evol. 1994, 38, 274–281. [Google Scholar] [CrossRef] [Green Version]
  58. Lee, H.-L.; Jansen, R.K.; Chumley, T.W.; Kim, K.-J. Gene Relocations within Chloroplast Genomes of Jasminum and Menodora (Oleaceae) Are Due to Multiple, Overlapping Inversions. Mol. Biol. Evol. 2007, 24, 1161–1180. [Google Scholar] [CrossRef] [Green Version]
  59. Kim, K.-J.; Choi, K.-S.; Jansen, R.K. Two Chloroplast DNA Inversions Originated Simultaneously During the Early Evolution of the Sunflower Family (Asteraceae). Mol. Biol. Evol. 2005, 22, 1783–1792. [Google Scholar] [CrossRef] [PubMed]
  60. Martin, G.E.; Rousseau-Gueutin, M.; Cordonnier, S.; Lima, O.; Michon-Coudouel, S.; Naquin, D.; de Carvalho, J.F.; Aïnouche, M.; Salmon, A.; Aïnouche, A. The First Complete Chloroplast Genome of the Genistoid Legume Lupinus Luteus: Evidence for a Novel Major Lineage-Specific Rearrangement and New Insights Regarding Plastome Evolution in the Legume Family. Ann. Bot. 2014, 113, 1197–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Schwarz, E.N.; Ruhlman, T.A.; Sabir, J.S.M.; Hajrah, N.H.; Alharbi, N.S.; Al-Malki, A.L.; Bailey, C.D.; Jansen, R.K. Plastid Genome Sequences of Legumes Reveal Parallel Inversions and Multiple Losses of rps16 in Papilionoids. J. Syst. Evol. 2015, 53, 458–468. [Google Scholar] [CrossRef]
  62. Charboneau, J.L.M.; Cronn, R.C.; Liston, A.; Wojciechowski, M.F.; Sanderson, M.J. Plastome Structural Evolution and Homoplastic Inversions in Neo-Astragalus (Fabaceae). Genome Biol. Evol. 2021, 13, evab215. [Google Scholar] [CrossRef] [PubMed]
  63. Choi, K.S.; Son, O.; Park, S. The Chloroplast Genome of Elaeagnus Macrophylla and trnH Duplication Event in Elaeagnaceae. PLoS ONE 2015, 10, e0138727. [Google Scholar] [CrossRef] [PubMed]
  64. Li, X.; Zuo, Y.; Zhu, X.; Liao, S.; Ma, J. Complete Chloroplast Genomes and Comparative Analysis of Sequences Evolution among Seven Aristolochia (Aristolochiaceae) Medicinal Species. Int. J. Mol. Sci. 2019, 20, 1045. [Google Scholar] [CrossRef] [Green Version]
  65. Cai, Z.; Penaflor, C.; Kuehl, J.V.; Leebens-Mack, J.; Carlson, J.E.; dePamphilis, C.W.; Boore, J.L.; Jansen, R.K. Complete Plastid Genome Sequences of Drimys, Liriodendron, and Piper: Implications for the Phylogenetic Relationships of Magnoliids. BMC Evol. Biol. 2006, 6, 77. [Google Scholar] [CrossRef] [Green Version]
  66. Li, L.; Liu, G.-M.; Zhang, Z.-R.; Corlett, R.T.; Yu, W.-B. Characteristics of the Complete Chloroplast Genome Sequences of Stylidium Debile and Stylidium Petiolare (Stylidiaceae). Mitochondrial DNA Part B Resour. 2021, 6, 3134–3136. [Google Scholar] [CrossRef]
  67. Bai, H.-R.; Oyebanji, O.; Zhang, R.; Yi, T.-S. Plastid Phylogenomic Insights into the Evolution of Subfamily Dialioideae (Leguminosae). Plant Divers. 2021, 43, 27–34. [Google Scholar] [CrossRef]
  68. Graham, S.W.; Reeves, P.A.; Burns, A.C.E.; Olmstead, R.G. Microstructural Changes in Noncoding Chloroplast DNA: Interpretation, Evolution, and Utility of Indels and Inversions in Basal Angiosperm Phylogenetic Inference. Int. J. Plant Sci. 2000, 161, S83–S96. [Google Scholar] [CrossRef] [Green Version]
  69. Borsch, T.; Quandt, D. Mutational Dynamics and Phylogenetic Utility of Noncoding Chloroplast DNA. Plant Syst. Evol. 2009, 282, 169–199. [Google Scholar] [CrossRef]
  70. Escobari, B.; Borsch, T.; Quedensley, T.S.; Gruenstaeudl, M. Plastid Phylogenomics of the Gynoxoid Group (Senecioneae, Asteraceae) Highlights the Importance of Motif-Based Sequence Alignment amid Low Genetic Distances. Am. J. Bot. 2021, 108, 2235–2256. [Google Scholar] [CrossRef] [PubMed]
  71. Kim, K.-J.; Lee, H.-L. Widespread Occurrence of Small Inversions in the Chloroplast Genomes of Land Plants. Mol. Cells 2005, 19, 104–113. [Google Scholar] [PubMed]
  72. Aberer, A.J.; Krompass, D.; Stamatakis, A. Pruning Rogue Taxa Improves Phylogenetic Accuracy: An Efficient Algorithm and Webservice. Syst. Biol. 2013, 62, 162–166. [Google Scholar] [CrossRef] [Green Version]
  73. Al-Eisawi, D.; Jury, S.L. A Taxonomic Revision of the Genus Tordylium L. (Apiaceae). Bot. J. Linn. Soc. 1988, 97, 357–403. [Google Scholar] [CrossRef]
  74. Samigullin, T.; Vallejo-Roman, C.; Degtjareva, G.; Terentieva, E. Structural Rearrangements in Plastid Genomes of Apiaceae as Phylogenetic Markers. BIO Web Conf. 2021, 38, 107. [Google Scholar] [CrossRef]
  75. Calviño, C.I.; Teruel, F.E.; Downie, S.R. The Role of the Southern Hemisphere in the Evolutionary History of Apiaceae, a Mostly North Temperate Plant Family. J. Biogeogr. 2016, 43, 398–409. [Google Scholar] [CrossRef]
  76. Zhou, J.; Gao, Y.; Wei, J.; Liu, Z.-W.; Downie, S.R. Molecular Phylogenetics of Ligusticum (Apiaceae) Based on nrDNA ITS Sequences: Rampant Polyphyly, Placement of the Chinese Endemic Species, and a Much-Reduced Circumscription of the Genus. Int. J. Plant Sci. 2019, 181, 306–323. [Google Scholar] [CrossRef]
  77. Wang, R.-J.; Cheng, C.-L.; Chang, C.-C.; Wu, C.-L.; Su, T.-M.; Chaw, S.-M. Dynamics and Evolution of the Inverted Repeat-Large Single Copy Junctions in the Chloroplast Genomes of Monocots. BMC Evol. Biol. 2008, 8, 36. [Google Scholar] [CrossRef] [Green Version]
  78. Maréchal, A.; Brisson, N. Recombination and the Maintenance of Plant Organelle Genome Stability. New Phytol. 2010, 186, 299–317. [Google Scholar] [CrossRef]
  79. Hastings, P.J.; Ira, G.; Lupski, J.R. A Microhomology-Mediated Break-Induced Replication Model for the Origin of Human Copy Number Variation. PLoS Genet. 2009, 5, e1000327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  80. Kwon, T.; Huq, E.; Herrin, D.L. Microhomology-Mediated and Nonhomologous Repair of a Double-Strand Break in the Chloroplast Genome of Arabidopsis. Proc. Natl. Acad. Sci. USA 2010, 107, 13954–13959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  81. Simmonds, S.E.; Smith, J.F.; Davidson, C.; Buerki, S. Phylogenetics and Comparative Plastome Genomics of Two of the Largest Genera of Angiosperms, Piper and Peperomia (Piperaceae). Mol. Phylogenet. Evol. 2021, 163, 107229. [Google Scholar] [CrossRef] [PubMed]
  82. Haberle, R.C.; Fourcade, H.M.; Boore, J.L.; Jansen, R.K. Extensive Rearrangements in the Chloroplast Genome of Trachelium Caeruleum Are Associated with Repeats and tRNA Genes. J. Mol. Evol. 2008, 66, 350–361. [Google Scholar] [CrossRef]
  83. Lyskov, D.; Kljuykov, E.; Terentieva, E.; Ukrainskaja, U.; Samigullin, T. The End of the Long Road: Iranian Endemic Seseli Elbursense (Apiaceae) Has Taken Its Place in the Genus Semenovia. Phytotaxa 2020, 435, 1–15. [Google Scholar] [CrossRef]
  84. Doyle, J.J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  85. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Green Version]
  86. Peng, Y.; Leung, H.C.M.; Yiu, S.M.; Chin, F.Y.L. IDBA-UD: A de Novo Assembler for Single-Cell and Metagenomic Sequencing Data with Highly Uneven Depth. Bioinformatics 2012, 28, 1420–1428. [Google Scholar] [CrossRef] [Green Version]
  87. Milne, I.; Stephen, G.; Bayer, M.; Cock, P.J.A.; Pritchard, L.; Cardle, L.; Shaw, P.D.; Marshall, D. Using Tablet for Visual Exploration of Second-Generation Sequencing Data. Brief. Bioinform. 2013, 14, 193–202. [Google Scholar] [CrossRef]
  88. Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq—Versatile and Accurate Annotation of Organelle Genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
  89. Carver, T.; Berriman, M.; Tivey, A.; Patel, C.; Böhme, U.; Barrell, B.G.; Parkhill, J.; Rajandream, M.-A. Artemis and ACT: Viewing, Annotating and Comparing Sequences Stored in a Relational Database. Bioinformatics 2008, 24, 2672–2676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  90. Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) Version 1.3.1: Expanded Toolkit for the Graphical Visualization of Organellar Genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  91. Katoh, K. MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  92. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  93. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  94. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Green Version]
  95. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [Green Version]
  96. Anisimova, M.; Gil, M.; Dufayard, J.-F.; Dessimoz, C.; Gascuel, O. Survey of Branch Support Methods Demonstrates Accuracy, Power, and Robustness of Fast Likelihood-Based Approximation Schemes. Syst. Biol. 2011, 60, 685–699. [Google Scholar] [CrossRef]
  97. Minh, B.Q.; Hahn, M.W.; Lanfear, R. New Methods to Calculate Concordance Factors for Phylogenomic Datasets. Mol. Biol. Evol. 2020, 37, 2727–2733. [Google Scholar] [CrossRef]
  98. Wolfe, K.H.; Li, W.H.; Sharp, P.M. Rates of Nucleotide Substitution Vary Greatly among Plant Mitochondrial, Chloroplast, and Nuclear DNAs. Proc. Natl. Acad. Sci. USA 1987, 84, 9054–9058. [Google Scholar] [CrossRef] [Green Version]
  99. Crotty, S.M.; Minh, B.Q.; Bean, N.G.; Holland, B.R.; Tuke, J.; Jermiin, L.S.; Haeseler, A.V. GHOST: Recovering Historical Signal from Heterotachously Evolved Sequence Alignments. Syst. Biol. 2019, 69, 249–264. [Google Scholar] [CrossRef] [PubMed]
  100. Akaike, H. A New Look at the Statistical Model Identification. IEEE Trans. Autom. Control 1974, 19, 716–723. [Google Scholar] [CrossRef]
  101. Swofford, D. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
  102. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic Estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Green Version]
  103. Xia, X. DAMBE5: A Comprehensive Software Package for Data Analysis in Molecular Biology and Evolution. Mol. Biol. Evol. 2013, 30, 1720–1728. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  104. Wen, J.; Yu, Y.; Xie, D.-F.; Peng, C.; Liu, Q.; Zhou, S.-D.; He, X.-J. A Transcriptome-Based Study on the Phylogeny and Evolution of the Taxonomically Controversial Subfamily Apioideae (Apiaceae). Ann. Bot. 2020, 125, 937–953. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Circular gene maps of eleven plastid genomes of Tordylieae tribe representatives. Genes plotted outside the circle are transcribed counterclockwise, inside genes—clockwise. Genes are colored according to their function, intron-containing genes are marked with asterisks. LSC = large single-copy region, SSC = small single-copy region, IRA and IRB = inverted repeats A and B, respectively.
Figure 1. Circular gene maps of eleven plastid genomes of Tordylieae tribe representatives. Genes plotted outside the circle are transcribed counterclockwise, inside genes—clockwise. Genes are colored according to their function, intron-containing genes are marked with asterisks. LSC = large single-copy region, SSC = small single-copy region, IRA and IRB = inverted repeats A and B, respectively.
Plants 11 00709 g001
Figure 2. Maximum a posteriori probability tree (PP = 1) inferred with Bayesian analysis of complete plastome sequences from 40 representatives of the apioid superclade. Plastomes derived for this study are marked with red. Support for enumerated branches 1–6 is presented in Table 2; others gained the highest support in all analyses. The pie chart represents the site concordance (purple)/discordance (red and yellow) factor. The inset shows Kalakia (A) and Ducrosia (B,C) placement and support when included in Bayesian analyses of CDS (A,C) and long (A,B) data sets.
Figure 2. Maximum a posteriori probability tree (PP = 1) inferred with Bayesian analysis of complete plastome sequences from 40 representatives of the apioid superclade. Plastomes derived for this study are marked with red. Support for enumerated branches 1–6 is presented in Table 2; others gained the highest support in all analyses. The pie chart represents the site concordance (purple)/discordance (red and yellow) factor. The inset shows Kalakia (A) and Ducrosia (B,C) placement and support when included in Bayesian analyses of CDS (A,C) and long (A,B) data sets.
Plants 11 00709 g002
Figure 3. Spacer with an indication of trnV pseudogene, psbA pseudogene, trnH and trnV gene sequences, and the distribution of the insertions across the analyzed plastomes. Nucleotide bases in alignment are color-coded; a similar color pattern means a similar sequence. The positions of Kalakia and Ducrosia are shown as unresolved. Reassembled in this study, the plastomes of Semenovia thomsonii and Angelica sinensis are presented. Note no matching insertion site in Angelica.
Figure 3. Spacer with an indication of trnV pseudogene, psbA pseudogene, trnH and trnV gene sequences, and the distribution of the insertions across the analyzed plastomes. Nucleotide bases in alignment are color-coded; a similar color pattern means a similar sequence. The positions of Kalakia and Ducrosia are shown as unresolved. Reassembled in this study, the plastomes of Semenovia thomsonii and Angelica sinensis are presented. Note no matching insertion site in Angelica.
Plants 11 00709 g003
Table 1. Characteristics of plastid genomes (IR: inverted repeat, LSC: large single-copy region, SSC: small single-copy region) and accession numbers of eleven plastid genomes from Tordylieae tribe species.
Table 1. Characteristics of plastid genomes (IR: inverted repeat, LSC: large single-copy region, SSC: small single-copy region) and accession numbers of eleven plastid genomes from Tordylieae tribe species.
TaxonSize (bp)LSC Size (bp)SSC Size (bp)IR Size (bp)GC Content (%)Total GenesProtein-Coding Genes (Pseudogenes)tRNA GenesrRNA GenesGenBank Accession NumberMean Coverage Depth (X)
Dasispermum suffruticosum (P.J.Bergius) B.L.Burtt144,90291,68116,93118,14535.212682 (2)368OL83926361
Ducrosia anethifolia Boiss.141,14898,93117,52312,34737.412279 (2)358OL83926425.8
Kalakia marginata (Boiss.) Alava142,15598,75817,49712,95037.512279 (2)358OL83926523.7
Mandenovia komarovii (Manden.) Alava149,34592,33217,48519,76437.412782 (2)378OL839266121
Notobubon galbanum (L.) Magee147,46693,64117,44318,19137.512682 (2)368OL83926751.9
Pastinaca pimpinellifolia M.Bieb.149,75892,24217,65419,93137.412782 (2)378NC_02745082.8
Symphyoloma graveolens C.A.Mey.149,24592,15917,51619,78537.512782 (2)378OL839268115
Tordylium lanatum Boiss.143,40294,15717,52115,86237.212481 (2)358OL83926989.7
Tordylium maximum L.150,10391,63717,67620,39537.312682 (2)368OL83927080.6
Tordylium pestalozzae Boiss.141,83099,35517,48812,49337.112279 (1)358OL83927133.1
Zosima korovinii Pimenov141,64499,62017,49812,26337.412279 (2)358OL839272173
Table 2. Support for branches 1–6 gained in phylogenetic analyses of CDS and full data matrices in unpartitioned and partitioned phylogenetic analyses. PP = posterior probability, aBayes = “a la Bayes” support, BS = nonparametric bootstrap support, sCF/sDF = site concordance/discordance factor.
Table 2. Support for branches 1–6 gained in phylogenetic analyses of CDS and full data matrices in unpartitioned and partitioned phylogenetic analyses. PP = posterior probability, aBayes = “a la Bayes” support, BS = nonparametric bootstrap support, sCF/sDF = site concordance/discordance factor.
BranchCDS, PP/aBayesUnpartitioned, PP/aBayes4 Partitions, PP/aBayes3 Partitions, PP/aBayes4 Partitions + Heterotachy, aBayes/BSsCF/sDF1/sDF2Putative Synapomorphies
11/11/11/11/11/9743.5/28.6/28.99
20.97/0.951/0.990.99/1/11/9336.4/33.2/30.42
31/11/11/11/11/10042.6/32.8/25.620
40.99/0.991/11/11/11/9941.4/30.5/28.112
51/11/11/11/11/10042.6/31.9/25.56
60.82/0.841/11/11/11/9947.3/16.2/36.546
Table 3. Voucher information for studied species, including collector name and date. Samples from the carpological collection of the Botanical Garden of Moscow State University are indicated with an asterisk (*).
Table 3. Voucher information for studied species, including collector name and date. Samples from the carpological collection of the Botanical Garden of Moscow State University are indicated with an asterisk (*).
Species NameVoucher NumberLocalityCollector, Date
Dasispermum suffruticosumMW0589014Republic of South Africa, 34°21′ S, 18°55′ EPimenov et al., 12 January 2003
Ducrosia anethifoliaMW0744172Iran, prov. Fars, 29°41′ N, 52°45′ EPimenov et al., 8 June 2001
Kalakia marginataE №3567Iran, IranshakrLamond, 1 June 1971
Mandenovia komaroviiMW0701533Russia, Daghestan, left bank of the river Avarskoe Kojsu, near Tlyarata villagePimenov et al., 15 August 1978
Notobubon galbanumMW0589116Republic of South Africa, 34°05′ S, 18°25′ EPimenov et al., 13 January 2003
Pastinaca pimpinellifolia*Russia, North CaucasusKljuykov et al., 5 August 2005
Symphyoloma graveolensMW0700962Russia, Daghestan, Andijski distr., Danukh villageAmirhanov, 5 August 1989
Tordylium lanatum*Turkey, Antalya, ElmaliPimenov et al., 11 July 2007
Tordylium maximum*Turkey, prov. Kastamonu, Kure-Inebolu, Ercisler derePimenov et al., 21 August 2008
Tordylium pestalozzaeMW0745191Turkey, Ephesus C1 Izmir: between Ephesus and Mariamane, 37°55′ N, 27°20′ EPimenov and Kljuykov, 27 May 1995
Zosima koroviniiMW0864736Kyrgyzstan, bank of river At-Bashi, Baybichetau range, tract Kara-TerekPimenov and Kljuykov, 1 August 1987
Table 4. Primer sequences used for amplification and sequencing.
Table 4. Primer sequences used for amplification and sequencing.
PurposePrimer: Name and Sequence
Insertion in assembled genomestrnV-rrn16_U: AGTTCGAGCCTGATTATCC
trnV-rrn16_L: ATTACTTATAGCTTCCTTGTT
Survey of 16 Tordylieae speciestrnV-rrn16_U: AGTTCGAGCCTGATTATCC
trnV-trnH_L: CAATCCACTGCCTTGATCC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Samigullin, T.; Logacheva, M.; Terentieva, E.; Degtjareva, G.; Pimenov, M.; Valiejo-Roman, C. Plastid Phylogenomic Analysis of Tordylieae Tribe (Apiaceae, Apioideae). Plants 2022, 11, 709. https://doi.org/10.3390/plants11050709

AMA Style

Samigullin T, Logacheva M, Terentieva E, Degtjareva G, Pimenov M, Valiejo-Roman C. Plastid Phylogenomic Analysis of Tordylieae Tribe (Apiaceae, Apioideae). Plants. 2022; 11(5):709. https://doi.org/10.3390/plants11050709

Chicago/Turabian Style

Samigullin, Tahir, Maria Logacheva, Elena Terentieva, Galina Degtjareva, Michael Pimenov, and Carmen Valiejo-Roman. 2022. "Plastid Phylogenomic Analysis of Tordylieae Tribe (Apiaceae, Apioideae)" Plants 11, no. 5: 709. https://doi.org/10.3390/plants11050709

APA Style

Samigullin, T., Logacheva, M., Terentieva, E., Degtjareva, G., Pimenov, M., & Valiejo-Roman, C. (2022). Plastid Phylogenomic Analysis of Tordylieae Tribe (Apiaceae, Apioideae). Plants, 11(5), 709. https://doi.org/10.3390/plants11050709

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop