Transcriptional Regulation of Genes Involved in Zinc Uptake, Sequestration and Redistribution Following Foliar Zinc Application to Medicago sativa
Abstract
1. Introduction
2. Results
2.1. Effects of Foliar Zn Application on Plant Zn Redistribution and Expression of Genes Involved in Zn Transport-Related Processes
2.1.1. Shoot and Root Zn Concentration and Content
2.1.2. Phylogenetic Analysis
2.1.3. Gene Expression Analysis
2.2. Functional Modules of Genes Encoding Zn Transport-Related Processes
3. Discussion
3.1. Zn Redistribution within the Plant after Foliar Zn Application
3.2. Phylogenetic and Gene Expression Analysis
3.3. Functional Modules of Genes Encoding Zn Transport-Related Processes
4. Materials and Methods
4.1. Plant Growth and Experimental Design
4.2. Measurement of Zn Concentration
4.3. Gene Selection and Design and Validation of New RT-qPCR Assay
4.4. RNA Extraction and Gene Expression Analysis
4.5. Bioinformatic and Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Prasad, A.S. Discovery of human zinc deficiency: Its impact on human health and disease. Adv. Nutr. 2013, 4, 176–190. [Google Scholar] [CrossRef]
- Cakmak, I.; McLaughlin, M.J.; White, P. Zinc for better crop production and human health. Plant Soil 2017, 411, 1–4. [Google Scholar] [CrossRef]
- Koren, O.; Tako, E. Chronic dietary zinc deficiency alters gut microbiota composition and function. Multidiscip. Digital Publ. Inst. Proc. 2020, 61, 16. [Google Scholar] [CrossRef]
- Desta, M.K.; Broadley, M.R.; McGrath, S.P.; Hernandez-Allica, J.; Hassall, K.L.; Gameda, S.; Amede, T.; Haefele, S.M. Plant vailable zinc is influenced by landscape position in the Amhara region, Ethiopia. Plants 2021, 10, 254. [Google Scholar] [CrossRef]
- McDonald, P.; Edwards, R.A.; Greenhalgh, J.F.D.; Morgan, C.A. Animal Nutrition; Pearson Education Limited: Harlow, UK, 2002. [Google Scholar]
- Ciccolini, V.; Pellegrino, E.; Coccina, A.; Fiaschi, A.I.; Cerretani, D.; Sgherri, C.; Quartacci, M.F.; Ercoli, L. Biofortification with iron and zinc improves nutritional and nutraceutical properties of common wheat flour and bread. J. Agric. Food Chem. 2017, 65, 5443–5452. [Google Scholar] [CrossRef] [PubMed]
- Capstaff, N.M.; Miller, A.J. Improving the yield and nutritional quality of forage crops. Front. Plant Sci. 2018, 9, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Huma, Z.E.; Khan, Z.I.; Noorka, I.R.; Ahmad, K.; Bayat, A.R.; Wajid, K. Bioaccumulation of zinc and copper in tissues of chicken fed corn grain irrigated with different water regimes. Int. J. Environ. Res. 2019, 13, 689–703. [Google Scholar] [CrossRef]
- Broadley, M.R.; White, P.J.; Hammond, J.P.; Zelko, I.; Lux, A. Zinc in plants. New Phytol. 2007, 173, 677–702. [Google Scholar] [CrossRef]
- Sasaki, H.; Hirose, T.; Watanabe, Y.; Ohsugi, R. Carbonic anhydrase activity and CO2-transfer resistance in Zn-deficient rice leaves. Plant Physiol. 1998, 118, 929–934. [Google Scholar] [CrossRef]
- Albert, I.L.; Nadassy, K.; Wodak, S.J. Analysis of zinc binding sites in protein crystal structures. Protein Sci. 1998, 7, 1700–1716. [Google Scholar] [CrossRef]
- White, P.J.; Pongrac, P. Heavy-metal toxicity in plants. In Plant Stress Physiology; CABI: Wallingford, UK, 2017; pp. 301–331. [Google Scholar]
- Broadley, M.R.; Brown, P.; Cakmak, I.; Rengel, Z.; Zhao, F. Function of nutrients: Micronutrients. In Marschner’s Mineral Nutrition of Higher Plants; Academic Press: London, UK, 2012; pp. 191–248. [Google Scholar]
- Alloway, B.J. Zinc in Soils and Crop Nutrition; IZA and IFA: Brussels, Belgium; Paris, France, 2008. [Google Scholar]
- Chaney, R.L. Zinc phytotoxicity. In Zinc in Soils and Plants; Springer: Dordrecht, The Netherlands, 1993; pp. 135–150. [Google Scholar]
- Di Baccio, D.; Tognetti, R.; Minnocci, A.; Sebastiani, L. Responses of the Populus x euramericana clone I-214 to excess zinc: Carbon assimilation, structural modifications, metal distribution and cellular localization. Environ. Exp. Bot. 2009, 67, 153–163. [Google Scholar] [CrossRef]
- White, P.J.; Broadley, M.R. Biofortifying crops with essential mineral elements. Trends Plant Sci. 2005, 10, 586–593. [Google Scholar] [CrossRef]
- Saltzman, A.; Birol, E.; Bouis, H.E.; Boy, E.; De Moura, F.F.; Islam, Y.; Pfeiffer, W.H. Biofortification: Progress toward a more nourishing future. Glob. Food Secur. 2013, 2, 9–17. [Google Scholar] [CrossRef]
- Gregory, P.J.; Wahbi, A.; Adu-Gyamfi, J.; Heiling, M.; Gruber, R.; Joy, E.J.M.; Broadley, M.R. Approaches to reduce zinc and iron deficits in food systems. Glob. Food Secur. 2017, 15, 1–10. [Google Scholar] [CrossRef]
- White, P.J.; Broadley, M.R. Physiological limits to zinc biofortification of edible crops. Front. Plant Sci. 2011, 2, 80. [Google Scholar] [CrossRef]
- Rawat, N.; Neelam, K.; Tiwari, V.K.; Dhaliwal, H.S. Biofortification of cereals to overcome hidden hunger. Plant Breeding 2013, 132, 437–445. [Google Scholar] [CrossRef]
- Cakmak, I. HarvestPlus zinc fertilizer project: HarvestZinc. Better Crops 2012, 96, 17–19. [Google Scholar]
- White, P.J.; Broadley, M.R. Biofortification of crops with seven mineral elements often lacking in human diets–iron, zinc, copper, calcium, magnesium, selenium and iodine. New Phytol. 2009, 182, 49–84. [Google Scholar] [CrossRef] [PubMed]
- Olsen, L.I.; Palmgren, M.G. Many rivers to cross: The journey of zinc from soil to seed. Front. Plant Sci. 2014, 5, 30. [Google Scholar] [CrossRef]
- Caldelas, C.; Weiss, D.J. Zinc homeostasis and isotopic fractionation in plants: A review. Plant Soil 2017, 411, 17–46. [Google Scholar] [CrossRef]
- Hacisalihoglu, G. Zinc (Zn): The last nutrient in the alphabet and shedding light on Zn efficiency for the future of crop production under suboptimal zn. Plants 2020, 9, 1471. [Google Scholar] [CrossRef] [PubMed]
- Grotz, N.; Fox, T.; Connolly, E.; Park, W.; Guerinot, M.L.; Eide, D. Identification of a family of zinc transporter genes from Arabidopsis that respond to zinc deficiency. Proc. Natl. Acad. Sci. USA 1998, 95, 7220–7224. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Eide, D. The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by zinc limitation. Proc. Natl. Acad. Sci. USA 1996, 93, 2454–2458. [Google Scholar] [CrossRef] [PubMed]
- López-Millán, A.F.; Ellis, D.R.; Grusak, M.A. Identification and characterization of several new members of the ZIP family of metal ion transporters in Medicago truncatula. Plant Mol. Biol. 2004, 54, 583–596. [Google Scholar] [CrossRef]
- Milner, M.J.; Seamon, J.; Craft, E.; Kochian, L.V. Transport properties of members of the ZIP family in plants and their role in Zn and Mn homeostasis. J. Exp. Bot. 2013, 64, 369–381. [Google Scholar] [CrossRef]
- Tiong, J.; McDonald, G.; Genc, Y.; Shirley, N.; Langridge, P.; Huang, C.Y. Increased expression of six ZIP family genes by zinc (Zn) deficiency is associated with enhanced uptake and root-to-shoot translocation of Zn in barley (Hordeum vulgare). New Phytol. 2015, 207, 1097–1109. [Google Scholar] [CrossRef] [PubMed]
- Mäser, P.; Thomine, S.; Schroeder, J.I.; Ward, J.M.; Hirsch, K.; Sze, H.; Talke, I.N.; Amtmann, A.; Maathuis, F.J.M.; Sanders, D.; et al. Phylogenetic relationship within cation transporter families of Arabidopsis. Plant Physiol. 2001, 126, 1646–1667. [Google Scholar] [CrossRef]
- Eckhardt, U.; Marques, A.M.; Buckhout, T.J. Two iron-regulated cation transporters from tomato complement metal uptake-deficient yeast mutants. Plant Mol. Biol. 2001, 45, 437–448. [Google Scholar] [CrossRef]
- Ramesh, S.A.; Shin, R.; Eide, D.J.; Schachtman, D.P. Differential metal selectivity and gene expression of two zinc transporters from rice. Plant Physiol. 2003, 133, 126–134. [Google Scholar] [CrossRef]
- Ishimaru, Y.; Suzuki, M.; Tsukamoto, T.; Suzuki, K.; Nakazono, M.; Kobayashi, T.; Wada, Y.; Watanabe, S.; Matsuhashi, S.; Nakanishi, H.; et al. Rice plants take up iron as an Fe3þ-phytosiderophore and as Fe2þ. Plant J. 2006, 45, 335–346. [Google Scholar] [CrossRef]
- Eide, D.; Broderius, M.; Fett, J.; Guerinot, M.L. A novel iron-regulated metal transporter from plants identified by functional expression in yeast. Proc. Natl. Acad. Sci. USA 1996, 93, 5624–5628. [Google Scholar] [CrossRef] [PubMed]
- Bughio, N.; Yamaguchi, H.; Nishizawa, N.K.; Nakanishi, H.; Mori, S. Cloning an iron-regulated metal transporter from rice. J. Exp. Bot. 2002, 53, 1677–1682. [Google Scholar] [CrossRef]
- Vert, G.; Grotz, N.; Dédaldéchamp, F.; Gaymard, F.; Guerinot, M.L.; Briat, J.F.; Curie, C. IRT1, an Arabidopsis transporter essential for iron uptake from the soil and for plant growth. Plant Cell 2002, 14, 1223–1233. [Google Scholar] [CrossRef]
- Pedas, P.; Ytting, C.K.; Fuglsang, A.T.; Jahn, T.P.; Schjoerring, J.K.; Husted, S. Manganese efficiency in barley: Identification and characterization of the metal ion transporter HvIRT1. Plant Physiol. 2008, 148, 455–466. [Google Scholar] [CrossRef] [PubMed]
- Kolaj-Robin, O.; Russell, D.; Hayes, K.A.; Pembroke, J.T.; Soulimane, T. Cation diffusion facilitator family: Structure and function. FEBS Lett. 2015, 589, 1283–1295. [Google Scholar] [CrossRef]
- Curie, C.; Cassin, G.; Couch, D.; Divol, F.; Higuchi, K.; Le Jean, M.; Misson, J.; Shikora, A.; Czernic, P.; Mari, S. Metal movement within the plant: Contribution of nicotianamine and yellow stripe 1-like transporters. Ann. Bot. 2009, 103, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Sinclair, S.A.; Krämer, U. The zinc homeostasis network of land plants. BBA Mol. Cell. Res. 2012, 1823, 1553–1567. [Google Scholar] [CrossRef]
- Deinlein, U.; Weber, M.; Schmidt, H.; Rensch, S.; Trampczynska, A.; Hansen, T.H.; Husted, S.; Schjoerring, J.K.; Talke, I.N.; Krämer, U.; et al. Elevated nicotianamine levels in Arabidopsis halleri roots play a key role in zinc hyperaccumulation. Plant Cell 2012, 24, 708–723. [Google Scholar] [CrossRef] [PubMed]
- Foroughi, S.; Baker, A.J.M.; Roessner, U.; Johnson, A.A.T.; Bacic, A.; Callahan, D.L. Hyperaccumulation of zinc by Noccaea caerulescens results in a cascade of stress responses and changes in the elemental profile. Metallomics 2014, 6, 1671–1682. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Lam, H.-M.; Nguyen, H.T.; Siddique, K.H.M.; Varshney, R.K.; Colmer, T.D.; Cowling, W.; Bramley, H.; Mori, T.A.; Hodgson, J.M.; et al. Neglecting legumes has compromised human health and sustainable food production. Nat. Plants 2016, 2, 16112. [Google Scholar] [CrossRef]
- Aarts, M.G. Nicotianamine secretion for zinc excess tolerance. Plant Physiol. 2014, 166, 751–752. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Clemens, S.; Deinlein, U.; Ahmadi, H.; Höreth, S.; Uraguchi, S. Nicotianamine is a major player in plant Zn homeostasis. Biometals 2013, 26, 623–632. [Google Scholar] [CrossRef] [PubMed]
- Haydon, M.J.; Kawachi, M.; Wirtz, M.; Hillmer, S.; Hell, R.; Krämer, U. Vacuolar nicotianamine has critical and distinct roles under iron deficiency and for zinc sequestration in Arabidopsis. Plant Cell 2012, 24, 724. [Google Scholar] [CrossRef] [PubMed]
- Desbrosses-Fonrouge, A.G.; Voigt, K.; Schröder, A.; Arrivault, S.; Thomine, S.; Krämer, U. Arabidopsis thaliana MTP1 is a Zn transporter in the vacuolar membrane which mediates Zn detoxification and drives leaf Zn accumulation. FEBS Lett. 2005, 579, 4165–4174. [Google Scholar] [CrossRef] [PubMed]
- Hussain, D.; Haydon, M.J.; Wang, Y.; Wong, E.; Sherson, S.M.; Young, J.; Camakaris, J.; Harper, J.F.; Cobbett, C.S. P-type ATPase heavy metal transporters with roles in essential zinc homeostasis in Arabidopsis. Plant Cell 2004, 16, 1327–1339. [Google Scholar] [CrossRef]
- Palmer, C.M.; Guerinot, M.L. Facing the challenges of Cu, Fe and Zn homeostasis in plants. Nat. Chem. Biol. 2009, 5, 333–340. [Google Scholar] [CrossRef] [PubMed]
- Burleigh, S.H.; Kristensen, B.K.; Bechmann, I.E. A plasma membrane zinc transporter from Medicago truncatula is up-regulated in roots by Zn fertilization, yet down-regulated by arbuscular mycorrhizal colonization. Plant Molec. Biol. 2003, 52, 1077–1088. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, A.; Yamaji, N.; Mitani-Ueno, N.; Kashino, M.; Ma, J.F. A node-localized transporter OsZIP3 is responsible for the preferential distribution of Zn to developing tissues in rice. Plant J. 2015, 84, 374–384. [Google Scholar] [CrossRef]
- Fageria, N.K.; Filho, M.B.; Moreira, A.; Guimarães, C.M. Foliar fertilization of crop plants. J. Plant Nutr. 2009, 32, 1044–1064. [Google Scholar] [CrossRef]
- White, P.J. Long-distance transport in the xylem and phloem. In Marschner’s Mineral Nutrition of Higher Plants; Academic Press: London, UK, 2012; pp. 49–70. [Google Scholar]
- Cakmak, I.; Torun, A.; Millet, E.; Feldman, M.; Fahima, T.; Korol, A.; Nevo, E.; Braun, H.J.; Özkan, H. Triticum dicoccoides: An important genetic resource for increasing zinc and iron concentration in modern cultivated wheat. J. Soil Sci. Plant Nut. 2004, 50, 1047–1054. [Google Scholar] [CrossRef]
- Cakmak, I. Enrichment of cereal grains with zinc: Agronomic or genetic biofortification? Plant Soil 2008, 302, 1–17. [Google Scholar] [CrossRef]
- Cakmak, I.; Pfeiffer, W.H.; McClafferty, B. Biofortification of durum wheat with zinc and iron. Cereal Chem. 2010, 87, 10–20. [Google Scholar] [CrossRef]
- White, P.J.; Thompson, J.A.; Wright, G.; Rasmussen, S.K. Biofortifying Scottish potatoes with zinc. Plant Soil 2017, 411, 151–165. [Google Scholar] [CrossRef]
- Erenoglu, E.B.; Kutman, U.B.; Ceylan, Y.; Yildiz, B.; Cakmak, I. Improved nitrogen nutrition enhances root uptake, root-to-shoot translocation and remobilization of zinc (65Zn) in wheat. New Phytol. 2011, 189, 438–448. [Google Scholar] [CrossRef] [PubMed]
- O’Rourke, J.A.; Fu, F.; Bucciarelli, B.; Yang, S.S.; Samac, D.A.; Lamb, J.F.; Li, J.; Dai, X.; Zhao, P.X.; Vance, C.P. The Medicago sativa gene index 1.2: A web-accessible gene expression atlas for investigating expression differences between Medicago sativa subspecies. BMC Genom. 2015, 16, 502. [Google Scholar] [CrossRef]
- Hanikenne, M.; Krämer, U.; Demoulin, V.; Baurain, D. A comparative inventory of metal transporters in the green alga Chlamydomonas reinhardtii and the red alga Cyanidioschizon merolae. Plant Physiol. 2005, 137, 428–446. [Google Scholar] [CrossRef]
- Wintz, H.; Fox, T.; Wu, Y.Y.; Feng, V.; Chen, W.; Chang, H.S.; Zhu, T.; Vulpe, C. Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis. J. Biol. Chem. 2003, 278, 47644–47653. [Google Scholar] [CrossRef]
- Sinclair, S.A.; Senger, T.; Talke, I.N.; Cobbett, C.S.; Haydon, M.J.; Kraemer, U. Systemic upregulation of MTP2-and HMA2-mediated Zn partitioning to the shoot supplements local Zn deficiency responses. Plant Cell 2018, 30, 2463–2479. [Google Scholar] [CrossRef] [PubMed]
- Baker, A.J.; Whiting, S.N. In search of the Holy Grail—A further step in understanding metal hyperaccumulation? New Phytol. 2002, 155. [Google Scholar] [CrossRef]
- Hanikenne, M.; Talke, I.N.; Haydon, M.J.; Lanz, C.; Nolte, A.; Motte, P.; Kroymann, J.; Weigel, D.; Krämer, U. Evolution of metal hyperaccumulation required cis-regulatory changes and triplication of HMA4. Nature 2008, 453, 391–395. [Google Scholar] [CrossRef] [PubMed]
- Ó Lochlainn, S.; Bowen, H.C.; Fray, R.G.; Hammond, J.P.; King, G.J.; White, P.J.; Broadley, M.R. Tandem quadruplication of HMA4 in the zinc (Zn) and cadmium (Cd) hyperaccumulator Noccaea caerulescens. PLoS ONE 2011, 6, e17814. [Google Scholar] [CrossRef]
- Andrés-Colás, N.; Sancenón, V.; Rodríguez-Navarro, S.; Mayo, S.; Thiele, D.J.; Ecker, J.R.; Puig, S.; Peñarrubia, L. The Arabidopsis heavy metal P-type ATPase HMA5 interacts with metallochaperones and functions in copper detoxification of roots. Plant J. 2006, 45, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Sankaran, R.P.; Huguet, T.; Grusak, M.A. Identification of QTL affecting seed mineral concentrations and content in the model legume Medicago truncatula. Theor. Appl. Genet. 2009, 119, 241–253. [Google Scholar] [CrossRef] [PubMed]
- Hermand, V.; Julio, E.; de Borne, F.D.; Punshon, T.; Ricachenevsky, F.K.; Bellec, A.; Gosti, F.; Berthomieu, P. Inactivation of two newly identified tobacco heavy metal ATPases leads to reduced Zn and Cd accumulation in shoots and reduced pollen germination. Metallomics 2014, 6, 1427–1440. [Google Scholar] [CrossRef] [PubMed]
- Deshpande, P.; Dapkekar, A.; Oak, M.D.; Paknikar, K.M.; Rajwade, J.M. Zinc complexed chitosan/TPP nanoparticles: A promising micronutrient nanocarrier suited for foliar application. Carbohyd. Polym. 2017, 165, 394–401. [Google Scholar] [CrossRef] [PubMed]
- Talke, I.N.; Hanikenne, M.; Krämer, U. Zinc-dependent global transcriptional control, transcriptional deregulation, and higher gene copy number for genes in metal homeostasis of the hyperaccumulator Arabidopsis halleri. Plant Physiol. 2006, 142, 148–167. [Google Scholar] [CrossRef] [PubMed]
- Becher, M.; Talke, I.N.; Krall, L.; Krämer, U. Cross-species microarray transcript profiling reveals high constitutive expression of metal homeostasis genes in shoots of the zinc hyperaccumulator Arabidopsis halleri. Plant J. 2004, 37, 251–268. [Google Scholar] [CrossRef]
- Weber, M.; Harada, E.; Vess, C.; Roepenack-Lahaye, E.V.; Clemens, S. Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identifies nicotianamine synthase, a ZIP transporter and other genes as potential metal hyperaccumulation factors. Plant J. 2004, 37, 269–281. [Google Scholar] [CrossRef] [PubMed]
- Gustin, J.L.; Loureiro, M.E.; Kim, D.; Na, G.; Tikhonova, M.; Salt, D.E. MTP1-dependent Zn sequestration into shoot vacuoles suggests dual roles in Zn tolerance and accumulation in Zn-hyperaccumulating plants. Plant J. 2009, 57, 1116–1127. [Google Scholar] [CrossRef]
- Jean, M.L.; Schikora, A.; Mari, S.; Briat, J.F.; Curie, C. A loss-of-function mutation in AtYSL1 reveals its role in iron and nicotianamine seed loading. Plant J. 2005, 44, 769–782. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhao, S.; Li, D.; Xu, X.; Li, C. Genome-wide analysis of the ZRT, IRT-Like protein (ZIP) family and their responses to metal stress in Populus trichocarpa. Plant Mol. Biol. Rep. 2017, 35, 534–549. [Google Scholar] [CrossRef]
- Ivanov, R.; Bauer, P. Sequence and coexpression analysis of iron-regulated ZIP transporter genes reveals crossing points between iron acquisition strategies in green algae and land plants. Plant Soil 2017, 418, 61–73. [Google Scholar] [CrossRef]
- Sharma, S.S.; Dietz, K.J.; Mimura, T. Vacuolar compartmentalization as indispensable component of heavy metal detoxification in plants. Plant Cell Environ. 2016, 39, 1112–1126. [Google Scholar] [CrossRef]
- Pita-Barbosa, A.; Ricachenevsky, F.K.; Wilson, M.; Dottorini, T.; Salt, D.E. Transcriptional plasticity buffers genetic variation in zinc homeostasis. Sci. Rep. 2019, 9, 19482. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zhou, X.; Huang, Y.; Zhu, L.; Zhang, S.; Zhao, Y.; Chen, R. Identification and characterization of the zinc-regulated transporters, iron-regulated transporter-like protein (ZIP) gene family in maize. BMC Plant Biol. 2013, 13, 114. [Google Scholar] [CrossRef] [PubMed]
- Yilmaz, O.; Kazar, G.A.; Cakmak, I.; Ozturk, L. Differences in grain zinc are not correlated with root uptake and grain translocation of zinc in wild emmer and durum wheat genotypes. Plant Soil 2017, 411, 69–79. [Google Scholar] [CrossRef]
- Nölte, J. ICP Emission Spectrometry: A Practical Guide; Wiley-VCH: Weinheim, Germany, 2003; Volume 1. [Google Scholar]
- Haydon, M.J.; Cobbett, C.S. A novel major facilitator superfamily protein at the tonoplast influences zinc tolerance and accumulation in Arabidopsis. Plant Physiol. 2007, 143, 1705–1719. [Google Scholar] [CrossRef] [PubMed]
- Nicot, N.; Hausman, J.F.; Hoffmann, L.; Evers, D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 2005, 56, 2907–2914. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Shen, X.; Li, D.; Ma, L.; Dong, J.; Wang, T. Identification and characterization of MtMTP1, a Zn transporter of CDF family, in the Medicago truncatula. Plant Physiol. Biochem. 2009, 47, 1089–1094. [Google Scholar] [CrossRef] [PubMed]
- Desjardins, P.; Conklin, D. NanoDrop microvolume quantitation of nucleic acids. JOVE 2010, 5, e2565. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: Oxford, UK, 2000. [Google Scholar]
- Anderson, M.J. A new method for non-parametric multivariate analysis of variance. Austral. Ecol. 2001, 26, 32–46. [Google Scholar] [CrossRef]
- Anderson, M.; Braak, C.T. Permutation tests for multi-factorial analysis of variance. J. Stat. Comput. Sim. 2003, 73, 85–113. [Google Scholar] [CrossRef]
- Anderson, M.J.; Ellingsen, K.E.; McArdle, B.H. Multivariate dispersion as a measure of beta diversity. Ecol. Lett. 2006, 9, 683–693. [Google Scholar] [CrossRef] [PubMed]
- Clarke, K.R.; Gorley, R.N. Getting Started with PRIMER v7; Plymouth Marine Laboratory: Plymouth, UK, 2015. [Google Scholar]
- Wickham, H. ggplot2. WIREs Comput. Stat. 2011, 3, 180–185. [Google Scholar] [CrossRef]





| Response Variables | Explanatory Variables | Zn Application (Zn) | Plant Compartment (Comp) | Zn x Comp | Residual |
|---|---|---|---|---|---|
| ZIP genes | Pseudo F | 5.56 | 8.16 | 1.76 | |
| P(perm) | 0.002 | 0.001 | 0.082 | ||
| Explained variance (%) | 29.1 | 22.9 | 9.7 | 38.3 | |
| PERMDISP P(perm) | 0.412 | 0.852 | |||
| Other genes | Pseudo F | 3.06 | 5.59 | 1.76 | |
| P(perm) | 0.007 | 0.015 | 0.1 | ||
| Explained variance (%) | 17.3 | 19.35 | 12.78 | ||
| PERMDISP P(perm) | 0.412 | 0.852 | |||
| All genes | Pseudo F | 4.27 | 10.49 | 3.41 | |
| P(perm) | 0.001 | 0.001 | 0.003 | ||
| Explained variance (%) | 17.3 | 25.2 | 25.6 | 31.9 | |
| PERMDISP P(perm) | 0.152 | 0.030 |
| Gene * | Reference Sequence Accession Number and Contig Number | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Amplicon Size (bp) | Efficiency (%) | R2 |
|---|---|---|---|---|---|---|
| MsZIP1 | AY339054 †/19855 ‡ | ATGATTAAAGCCTTCGCGGC | TCTGCTGGAACTTGTTTAGAAGG | 233 | 99.8 | 0.999 |
| MsZIP2 | AY007281/82450 | AGCCCAATTGGCGTAGGAAT | ACAGCAACACCAAAAAGCACA | 215 | 99.3 | 0.999 |
| MsZIP3 | AY339055/33860 | TGGTGTGATTTTGGCAACCG | TGACGGACCCGAAGAAACAG | 325 | 104.9 | 0.999 |
| MsZIP4 | XM_003603101/92651 | GGAGGGTGCATTTCTCAAGC | AGCAATGCCTGTTCCAATGC | 108 | 97.1 | 0.999 |
| MsZIP5 | XM_013605712/66451 | TGAAGGCATGGGACTTGGAA | CCAGCTGAAGCTGCATTGAA | 192 | 99.3 | 0.998 |
| MsZIP6 | AY339058/9668 | CTTGGCGACACGTTCAATCC | CCACAAGTCCCGAAAAGGGA | 188 | 106.0 | 0.998 |
| MsZIP7 | AY339059/62098 | GGCTTGTGCTGGTTATTTGAT | TTTCCATGCGTCTGCTTTTGT | 310 | 96.1 | 0.999 |
| MsZIF1 | XM_003601836/59165 | TGCCTGCATTTGGTTACCG | CTGCAGCTTCCACATTGTCAG | 77 | 105.9 | 0.999 |
| MsHMA4 | XM_003626900/19210 | TGCTCAACTTGCCAAAGCAC | GGAATGAACCATCCCAGCCA | 111 | 108.9 | 0.999 |
| MsYSL1 | XM_024781439/4892 | CAAGAAGCAAGTGCATGGGT | TCCACAGTCTTCTTTGCCTGAG | 94 | 111.0 | 0.999 |
| MsMTP1 | FJ389717/67347 | TGCAGCATTTGCCATCTCCT | TGCATAGAAACCAAAGCACCA | 114 | 104.5 | 0.999 |
| MsNAS1 | XM_003594705/61146 | GCTAGCTTGGCTGAAGATTGG | AGATACAAAGCACTCGGAGACA | 87 | 100.5 | 0.999 |
| MsACT-101 | XM_003593074/89028 | TCTCTGTATGCCAGTGGACG | TCTGTTAAATCACGCCCAGCA | 140 | 102.4 | 0.999 |
| MsEF1-α | XM_003618727/56897 | CCACAGACAAGCCCCTCAG | TCACAACCATACCGGGCTTC | 114 | 100.2 | 0.999 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cardini, A.; Pellegrino, E.; White, P.J.; Mazzolai, B.; Mascherpa, M.C.; Ercoli, L. Transcriptional Regulation of Genes Involved in Zinc Uptake, Sequestration and Redistribution Following Foliar Zinc Application to Medicago sativa. Plants 2021, 10, 476. https://doi.org/10.3390/plants10030476
Cardini A, Pellegrino E, White PJ, Mazzolai B, Mascherpa MC, Ercoli L. Transcriptional Regulation of Genes Involved in Zinc Uptake, Sequestration and Redistribution Following Foliar Zinc Application to Medicago sativa. Plants. 2021; 10(3):476. https://doi.org/10.3390/plants10030476
Chicago/Turabian StyleCardini, Alessio, Elisa Pellegrino, Philip J. White, Barbara Mazzolai, Marco C. Mascherpa, and Laura Ercoli. 2021. "Transcriptional Regulation of Genes Involved in Zinc Uptake, Sequestration and Redistribution Following Foliar Zinc Application to Medicago sativa" Plants 10, no. 3: 476. https://doi.org/10.3390/plants10030476
APA StyleCardini, A., Pellegrino, E., White, P. J., Mazzolai, B., Mascherpa, M. C., & Ercoli, L. (2021). Transcriptional Regulation of Genes Involved in Zinc Uptake, Sequestration and Redistribution Following Foliar Zinc Application to Medicago sativa. Plants, 10(3), 476. https://doi.org/10.3390/plants10030476

