Impact of Difluoromethylornithine and AMXT 1501 on Gene Expression and Capsule Regulation in Streptococcus pneumoniae
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Growth and RNA Isolation
2.2. RNASeq and Data Analysis
2.3. Quantitative Real-Time PCR (qRT-PCR)
3. Results
3.1. Gene Expression Changes and Pathways Affected by DFMO in Pneumococcal D39
3.1.1. DFMO Negatively Impacts Polyamine Biosynthesis Pathways
3.1.2. DFMO Inhibits Expression of Genes Involved in Glucose Production
3.1.3. DFMO Suppression of Phosphate Operon and Iron Importer Gene Expression
3.2. Pneumococcal Genes and Pathways Affected by AMXT 1501
3.2.1. AMXT 1501 Enhances the Expression of Polyamine Biosynthesis
3.2.2. AMXT 1501 Enhances the Expression of Genes Involved in Glucose Production
3.2.3. AMXT 1501 Treatment Inhibits ATP Production
3.2.4. AMXT 1501 Treatment Impact on Fatty Acid Synthesis and Polyamine Regulation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Pneumonia in Children. Available online: https://www.who.int/news-room/fact-sheets/detail/pneumonia (accessed on 6 November 2023).
- Troeger, C.; Blacker, B.; Khalil, I.A.; Rao, P.C.; Cao, J.; Zimsen, S.R.; Albertson, S.B.; Deshpande, A.; Farag, T.; Abebe, Z. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of lower respiratory infections in 195 countries, 1990–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet Infect. Dis. 2018, 18, 1191–1210. [Google Scholar] [CrossRef]
- Hansen, C.B.; Fuursted, K.; Valentiner-Branth, P.; Dalby, T.; Jørgensen, C.S.; Slotved, H.C. Molecular characterization and epidemiology of Streptococcus pneumoniae serotype 8 in Denmark. BMC Infect. Dis. 2021, 21, 421. [Google Scholar] [CrossRef]
- Li, L.; Ma, J.; Yu, Z.; Li, M.; Zhang, W.; Sun, H. Epidemiological characteristics and antibiotic resistance mechanisms of Streptococcus pneumoniae: An updated review. Microbiol. Res. 2023, 266, 127221. [Google Scholar] [CrossRef] [PubMed]
- Franz, C.M.; Huch, M.; Seifert, S.; Kramlich, J.; Bub, A.; Cho, G.S.; Watzl, B. Influence of a probiotic Lactobacillus casei strain on the colonisation with potential pathogenic streptococci and Staphylococcus aureus in the nasopharyngeal space of healthy men with a low baseline NK cell activity. Med. Microbiol. Immunol. 2015, 204, 527–538. [Google Scholar] [CrossRef] [PubMed]
- van der Kamp, I.; Draper, L.A.; Smith, M.K.; Buttimer, C.; Ross, R.P.; Hill, C. A New Phage Lysin Isolated from the Oral Microbiome Targeting Streptococcus pneumoniae. Pharmaceuticals 2020, 13, 478. [Google Scholar] [CrossRef] [PubMed]
- Qadir, M.I.; Sajjad, S. Phage Therapy against Streptococcus pneumoniae: Modern Tool to Control Pneumonia. Crit. Rev. Eukaryot. Gene Expr. 2017, 27, 289–295. [Google Scholar] [CrossRef]
- Duke, J.A.; Avci, F.Y. Emerging vaccine strategies against the incessant pneumococcal disease. NPJ Vaccines 2023, 8, 122. [Google Scholar] [CrossRef] [PubMed]
- Nanduri, B.; Swiatlo, E. The expansive effects of polyamines on the metabolism and virulence of Streptococcus pneumoniae. Pneumonia 2021, 13, 4. [Google Scholar] [CrossRef] [PubMed]
- Pipkins, H.R.; Bradshaw, J.L.; Keller, L.E.; Swiatlo, E.; McDaniel, L.S. Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae. PLoS ONE 2017, 12, e0179159. [Google Scholar] [CrossRef]
- Rojas Converso, T.; Goulart, C.; Rodriguez, D.; Guerra, M.E.S.; Darrieux, M.; Leite, L.C.C. Immune response induced in mice by a hybrid rPotD-PdT pneumococcal protein. PLoS ONE 2022, 17, e0273017. [Google Scholar] [CrossRef]
- Converso, T.R.; Goulart, C.; Rodriguez, D.; Darrieux, M.; Leite, L.C. Systemic immunization with rPotD reduces Streptococcus pneumoniae nasopharyngeal colonization in mice. Vaccine 2017, 35, 149–155. [Google Scholar] [CrossRef] [PubMed]
- Converso, T.R.; Goulart, C.; Darrieux, M.; Leite, L.C.C. A protein chimera including PspA in fusion with PotD is protective against invasive pneumococcal infection and reduces nasopharyngeal colonization in mice. Vaccine 2017, 35, 5140–5147. [Google Scholar] [CrossRef] [PubMed]
- Sagar, N.A.; Tarafdar, S.; Agarwal, S.; Tarafdar, A.; Sharma, S. Polyamines: Functions, Metabolism, and Role in Human Disease Management. Med. Sci. 2021, 9, 44. [Google Scholar] [CrossRef] [PubMed]
- Miller-Fleming, L.; Olin-Sandoval, V.; Campbell, K.; Ralser, M. Remaining Mysteries of Molecular Biology: The Role of Polyamines in the Cell. J. Mol. Biol. 2015, 427, 3389–3406. [Google Scholar] [CrossRef]
- Sakamoto, A.; Terui, Y.; Uemura, T.; Igarashi, K.; Kashiwagi, K. Polyamines regulate gene expression by stimulating translation of histone acetyltransferase mRNAs. J. Biol. Chem. 2020, 295, 8736–8745. [Google Scholar] [CrossRef]
- Nakamya, M.F.; Ayoola, M.B.; Park, S.; Shack, L.A.; Swiatlo, E.; Nanduri, B. The Role of Cadaverine Synthesis on Pneumococcal Capsule and Protein Expression. Med. Sci. 2018, 6, 8. [Google Scholar] [CrossRef]
- Ayoola, M.B.; Shack, L.A.; Nakamya, M.F.; Thornton, J.A.; Swiatlo, E.; Nanduri, B. Polyamine Synthesis Effects Capsule Expression by Reduction of Precursors in Streptococcus pneumoniae. Front. Microbiol. 2019, 10, 1996. [Google Scholar] [CrossRef]
- Ayoola, M.B.; Nakamya, M.F.; Shack, L.A.; Park, S.; Lim, J.; Lee, J.H.; Ross, M.K.; Eoh, H.; Nanduri, B. SP_0916 Is an Arginine Decarboxylase That Catalyzes the Synthesis of Agmatine, Which Is Critical for Capsule Biosynthesis in Streptococcus pneumoniae. Front. Microbiol. 2020, 11, 578533. [Google Scholar] [CrossRef]
- Nakamya, M.F.; Ayoola, M.B.; Shack, L.A.; Swiatlo, E.; Nanduri, B. The Effect of Impaired Polyamine Transport on Pneumococcal Transcriptome. Pathogens 2021, 10, 1322. [Google Scholar] [CrossRef] [PubMed]
- Ayoola, M.B.; Shack, L.A.; Lee, J.H.; Lim, J.; Eoh, H.; Swiatlo, E.; Phanstiel, O.; Nanduri, B. Difluoromethylornithine (DFMO) and AMXT 1501 inhibit capsule biosynthesis in pneumococci. Sci. Rep. 2022, 12, 11804. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S.; Sato, Y.; Furumichi, M.; Tanabe, M. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res. 2012, 40, D109–D114. [Google Scholar] [CrossRef] [PubMed]
- UniProt Consortium, T. UniProt: The universal protein knowledgebase. Nucleic Acids Res. 2018, 46, 2699. [Google Scholar] [CrossRef] [PubMed]
- Tassoni, A.; Awad, N.; Griffiths, G. Effect of ornithine decarboxylase and norspermidine in modulating cell division in the green alga Chlamydomonas reinhardtii. Plant Physiol. Biochem. 2018, 123, 125–131. [Google Scholar] [CrossRef] [PubMed]
- Iannelli, F.; Pearce, B.J.; Pozzi, G. The type 2 capsule locus of Streptococcus pneumoniae. J. Bacteriol. 1999, 181, 2652–2654. [Google Scholar] [CrossRef] [PubMed]
- Amaniampong, P.N.; Karam, A.; Trinh, Q.T.; Xu, K.; Hirao, H.; Jérôme, F.; Chatel, G. Selective and Catalyst-free Oxidation of D-Glucose to D-Glucuronic acid induced by High-Frequency Ultrasound. Sci. Rep. 2017, 7, 40650. [Google Scholar] [CrossRef]
- Rahim, R.; Burrows, L.L.; Monteiro, M.A.; Perry, M.B.; Lam, J.S. Involvement of the rml locus in core oligosaccharide and O polysaccharide assembly in Pseudomonas aeruginosa. Microbiology 2000, 146 Pt 11, 2803–2814. [Google Scholar] [CrossRef]
- Engel, H.; Mika, M.; Denapaite, D.; Hakenbeck, R.; Mühlemann, K.; Heller, M.; Hathaway, L.J.; Hilty, M. A low-affinity penicillin-binding protein 2× variant is required for heteroresistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 2014, 58, 3934–3941. [Google Scholar] [CrossRef]
- El Khoury, J.Y.; Boucher, N.; Bergeron, M.G.; Leprohon, P.; Ouellette, M. Penicillin induces alterations in glutamine metabolism in Streptococcus pneumoniae. Sci. Rep. 2017, 7, 14587. [Google Scholar] [CrossRef]
- Hoyer, J.; Bartel, J.; Gomez-Mejia, A.; Rohde, M.; Hirschfeld, C.; Hess, N.; Sura, T.; Maass, S.; Hammerschmidt, S.; Becher, D. Proteomic response of Streptococcus pneumoniae to iron limitation. Int. J. Med. Microbiol. 2018, 308, 713–721. [Google Scholar] [CrossRef] [PubMed]
- Nanduri, B.; Shah, P.; Ramkumar, M.; Allen, E.B.; Swiatlo, E.; Burgess, S.C.; Lawrence, M.L. Quantitative analysis of Streptococcus pneumoniae TIGR4 response to in vitro iron restriction by 2-D LC ESI MS/MS. Proteomics 2008, 8, 2104–2114. [Google Scholar] [CrossRef] [PubMed]
- Ferrándiz, M.J.; de la Campa, A.G. The membrane-associated F0F1 ATPase is essential for the viability of Streptococcus pneumoniae. FEMS Microbiol. Lett. 2002, 212, 133–138. [Google Scholar] [CrossRef]
- Feldman, C.; Anderson, R. Pneumococcal virulence factors in community-acquired pneumonia. Curr. Opin. Pulm. Med. 2020, 26, 222–231. [Google Scholar] [CrossRef]
- Paton, J.C.; Trappetti, C. Streptococcus pneumoniae Capsular Polysaccharide. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef]
- Su, T.; Nakamoto, R.; Chun, Y.Y.; Chua, W.Z.; Chen, J.H.; Zik, J.J.; Sham, L.T. Decoding capsule synthesis in Streptococcus pneumoniae. FEMS Microbiol. Rev. 2021, 45, fuaa067. [Google Scholar] [CrossRef]
- Zhang, Y.; Gonzalez-Gutierrez, G.; Legg, K.A.; Walsh, B.J.C.; Pis Diez, C.M.; Edmonds, K.A.; Giedroc, D.P. Discovery and structure of a widespread bacterial ABC transporter specific for ergothioneine. Nat. Commun. 2022, 13, 7586. [Google Scholar] [CrossRef]
- Wang, X.; Zeng, Y.; Sheng, L.; Larson, P.; Liu, X.; Zou, X.; Wang, S.; Guo, K.; Ma, C.; Zhang, G.; et al. A Cinchona Alkaloid Antibiotic That Appears to Target ATP Synthase in Streptococcus pneumoniae. J. Med. Chem. 2019, 62, 2305–2332. [Google Scholar] [CrossRef]
- Vestergaard, M.; Bald, D.; Ingmer, H. Targeting the ATP synthase in bacterial and fungal pathogens: Beyond Mycobacterium tuberculosis. J. Glob. Antimicrob. Resist. 2022, 29, 29–41. [Google Scholar] [CrossRef]
- Hamaguchi, S.; Zafar, M.A.; Cammer, M.; Weiser, J.N. Capsule Prolongs Survival of Streptococcus pneumoniae during Starvation. Infect. Immun. 2018, 86, e00802-17. [Google Scholar] [CrossRef] [PubMed]
- Hathaway, L.J.; Brugger, S.D.; Morand, B.; Bangert, M.; Rotzetter, J.U.; Hauser, C.; Graber, W.A.; Gore, S.; Kadioglu, A.; Mühlemann, K. Capsule Type of Streptococcus pneumoniae Determines Growth Phenotype. PLOS Pathog. 2012, 8, e1002574. [Google Scholar] [CrossRef] [PubMed]
- He, L.Y.; Le, Y.J.; Guo, Z.; Li, S.; Yang, X.Y. The Role and Regulatory Network of the CiaRH Two-Component System in Streptococcal Species. Front. Microbiol. 2021, 12, 693858. [Google Scholar] [CrossRef] [PubMed]
- Gazioglu, O.; Habtom, M.; Andrew, P.W.; Yesilkaya, H. The involvement of CiaR and the CiaR-regulated serine protease HtrA in thermal adaptation of Streptococcus pneumoniae. Microbiology 2023, 169, 001304. [Google Scholar] [CrossRef]
- Büyükuslu, N.; Öztürk, R.İ. Polyamine metabolism and obesity: Polyamine metabolic enzymes involved in obesity. ACTA Pharm. Sci. 2018, 56, 85–91. [Google Scholar] [CrossRef]
- Gliniak, C.M.; Scherer, P.E. A new signal that shrinks fat. Nat. Metab. 2022, 4, 305–307. [Google Scholar] [CrossRef] [PubMed]
- Lozier, A.M.; Rich, M.E.; Grawe, A.P.; Peck, A.S.; Zhao, P.; Chang, A.T.; Bond, J.P.; Sholler, G.S. Targeting ornithine decarboxylase reverses the LIN28/Let-7 axis and inhibits glycolytic metabolism in neuroblastoma. Oncotarget 2015, 6, 196–206. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Liu, X.; Xiong, Y.; Meng, Q.; Li, P.; Zhang, F.; Liu, X.; Lin, Z.; Deng, Q.; Wen, Z. AMXT-1501 Targets Membrane Phospholipids Against Gram-Positive and-Negative Multidrug-Resistant Bacteria. SSRN 2023. [Google Scholar] [CrossRef]
- Eijkelkamp, B.A.; Morey, J.R.; Ween, M.P.; Ong, C.L.; McEwan, A.G.; Paton, J.C.; McDevitt, C.A. Extracellular zinc competitively inhibits manganese uptake and compromises oxidative stress management in Streptococcus pneumoniae. PLoS ONE 2014, 9, e89427. [Google Scholar] [CrossRef] [PubMed]
- Jacobsen, F.E.; Kazmierczak, K.M.; Lisher, J.P.; Winkler, M.E.; Giedroc, D.P. Interplay between manganese and zinc homeostasis in the human pathogen Streptococcus pneumoniae. Metallomics 2011, 3, 38–41. [Google Scholar] [CrossRef]
Sequence (5′-3′) | Primer Name |
---|---|
CAACTGATGAAGAACTCAAAGAACAC | gapdh F |
TGGCTCGCTACGATAAGAGATG | gapdh R |
GGTGTCAGTGTTGGTTTGCG | SPD0813 F |
TGCACAAGGGTCATAGAGCG | SPD0813 R |
TGCGGATGATTTCGTCTACAATG | SPD0811 F |
TCCAGTTCAGGATAGAGTGTTAATAC | SPD0811 R |
TAAAGACGGTTGGAGTGCCC | SPD1663 F |
CCCGATTTCCTCACCCATGT | SPD1663 R |
TTCATCGCAGCCGTAGAACC | SPD0561 F |
TGGCACAAGCCCAGATTTCA | SPD0561 R |
CTTGTATAACTCTATTGCCGTCATTG | SPD0815 F |
GTCATCTGGTATATGGGTCTTTCG | SPD0815 R |
TTGGAGGTTCACGCTTCGTT | SPD1496 F |
AATTGGACCCGCCTGAGAAA | SPD1496 R |
GTTCTCGGAATCTGTTTGGTATCG | SPD1664 F |
GCTGGGATAACTTGGGCTTGG | SPD1664 R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ayoola, M.B.; Shack, L.A.; Phanstiel, O., IV; Nanduri, B. Impact of Difluoromethylornithine and AMXT 1501 on Gene Expression and Capsule Regulation in Streptococcus pneumoniae. Biomolecules 2024, 14, 178. https://doi.org/10.3390/biom14020178
Ayoola MB, Shack LA, Phanstiel O IV, Nanduri B. Impact of Difluoromethylornithine and AMXT 1501 on Gene Expression and Capsule Regulation in Streptococcus pneumoniae. Biomolecules. 2024; 14(2):178. https://doi.org/10.3390/biom14020178
Chicago/Turabian StyleAyoola, Moses B., Leslie A. Shack, Otto Phanstiel, IV, and Bindu Nanduri. 2024. "Impact of Difluoromethylornithine and AMXT 1501 on Gene Expression and Capsule Regulation in Streptococcus pneumoniae" Biomolecules 14, no. 2: 178. https://doi.org/10.3390/biom14020178
APA StyleAyoola, M. B., Shack, L. A., Phanstiel, O., IV, & Nanduri, B. (2024). Impact of Difluoromethylornithine and AMXT 1501 on Gene Expression and Capsule Regulation in Streptococcus pneumoniae. Biomolecules, 14(2), 178. https://doi.org/10.3390/biom14020178