Cannabidiol Modulates Neuroinflammatory Markers in a PTSD Model Conducted on Female Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Shock and Situational Reminders (SRs)
2.3. Drug Treatment
2.4. Estrous Cycle
2.5. Forced Swim Test (FST)
2.6. Real-Time (RT) PCR
2.7. Experimental Design
2.8. Statistical Analysis
3. Results
3.1. The Effect of CBD on Behavior in Female Rats Exposed to Shock and SRs
3.2. Effects of CBD on mRNA Expression of Inflammatory Genes in Rats Exposed to Shock and SRs in the mPFC and vSUB
3.2.1. Il1β
3.2.2. Il6
3.2.3. Tnfα
3.3. Correlations Between the Expression of Inflammatory Genes and Behavior
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hori, H.; Kim, Y. Inflammation and Post-traumatic Stress Disorder. Psychiatry Clin. Neurosci. 2019, 73, 143–153. [Google Scholar] [CrossRef] [PubMed]
- Quinones, M.M.; Gallegos, A.M.; Lin, F.V.; Heffner, K. Dysregulation of Inflammation, Neurobiology, and Cognitive Function in PTSD: An Integrative Review. Cogn. Affect. Behav. Neurosci. 2020, 20, 455–480. [Google Scholar] [CrossRef]
- Sumner, J.A.; Nishimi, K.M.; Koenen, K.C.; Roberts, A.L.; Kubzansky, L.D. Posttraumatic Stress Disorder and Inflammation: Untangling Issues of Bidirectionality. Biol. Psychiatry 2020, 87, 885–897. [Google Scholar] [CrossRef] [PubMed]
- Ng, Q.X.; Soh, A.Y.S.; Loke, W.; Venkatanarayanan, N.; Lim, D.Y.; Yeo, W. Systematic Review with Meta-analysis: The Association between Post-traumatic Stress Disorder and Irritable Bowel Syndrome. J. Gastroenterol. Hepatol. 2019, 34, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Ryder, A.L.; Azcarate, P.M.; Cohen, B.E. PTSD and Physical Health. Curr. Psychiatry Rep. 2018, 20, 116. [Google Scholar] [CrossRef]
- Prieto, S.; Nolan, K.E.; Moody, J.N.; Hayes, S.M.; Hayes, J.P.; for the Department of Defense Alzheimer’s Disease Neuroimaging Initiative. Posttraumatic Stress Symptom Severity Predicts Cognitive Decline beyond the Effect of Alzheimer’s Disease Biomarkers in Veterans. Transl. Psychiatry 2023, 13, 102. [Google Scholar] [CrossRef]
- Roberts, A.L.; Liu, J.; Lawn, R.B.; Jha, S.C.; Sumner, J.A.; Kang, J.H.; Rimm, E.B.; Grodstein, F.; Kubzansky, L.D.; Chibnik, L.B.; et al. Association of Posttraumatic Stress Disorder with Accelerated Cognitive Decline in Middle-Aged Women. JAMA Netw. Open 2022, 5, e2217698. [Google Scholar] [CrossRef]
- Spudic, S.D.; Perkovic, M.N.; Uzun, S.; Erjavec, G.N.; Kozumplik, O.; Strac, D.S.; Mimica, N.; Pivac, N. Reduced Plasma BDNF Concentration and Cognitive Decline in Veterans with PTSD. Psychiatry Res. 2022, 316, 114772. [Google Scholar] [CrossRef]
- Renner, V.; Schellong, J.; Bornstein, S.; Petrowski, K. Stress-Induced pro-and Anti-Inflammatory Cytokine Concentrations in Female PTSD and Depressive Patients. Transl. Psychiatry 2022, 12, 158. [Google Scholar] [CrossRef]
- Johnson, J.D.; Barnard, D.F.; Kulp, A.C.; Mehta, D.M. Neuroendocrine Regulation of Brain Cytokines after Psychological Stress. J. Endocr. Soc. 2019, 3, 1302–1320. [Google Scholar] [CrossRef]
- Levesque, P.; Desmeules, C.; Béchard, L.; Huot-Lavoie, M.; Demers, M.-F.; Roy, M.-A.; Deslauriers, J. Sex-Specific Immune Mechanisms in PTSD Symptomatology and Risk: A Translational Overview and Perspectives. Brain Res. Bull. 2023, 195, 120–129. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; Mohammed, Z.; Singh, I. Bruton’s Tyrosine Kinase Drives Neuroinflammation and Anxiogenic Behavior in Mouse Models of Stress. J. Neuroinflamm. 2021, 18, 289. [Google Scholar]
- Fonken, L.K.; Frank, M.G.; Gaudet, A.D.; D’Angelo, H.M.; Daut, R.A.; Hampson, E.C.; Ayala, M.T.; Watkins, L.R.; Maier, S.F. Neuroinflammatory Priming to Stress Is Differentially Regulated in Male and Female Rats. Brain Behav. Immun. 2018, 70, 257–267. [Google Scholar] [PubMed]
- Deri, Y.; Clouston, S.A.P.; DeLorenzo, C.; Gardus III, J.D.; Bartlett, E.A.; Santiago-Michels, S.; Bangiyev, L.; Kreisl, W.C.; Kotov, R.; Huang, C. Neuroinflammation in World Trade Center Responders at Midlife: A Pilot Study Using [18F]-FEPPA PET Imaging. Brain Behav. Immun.-Health 2021, 16, 100287. [Google Scholar] [CrossRef] [PubMed]
- Passos, I.C.; Vasconcelos-Moreno, M.P.; Costa, L.G.; Kunz, M.; Brietzke, E.; Quevedo, J.; Salum, G.; Magalhães, P.V.; Kapczinski, F.; Kauer-Sant’Anna, M. Inflammatory Markers in Post-Traumatic Stress Disorder: A Systematic Review, Meta-Analysis, and Meta-Regression. Lancet Psychiatry 2015, 2, 1002–1012. [Google Scholar] [CrossRef]
- Peruzzolo, T.L.; Pinto, J.V.; Roza, T.H.; Shintani, A.O.; Anzolin, A.P.; Gnielka, V.; Kohmann, A.M.; Marin, A.S.; Lorenzon, V.R.; Brunoni, A.R.; et al. Inflammatory and Oxidative Stress Markers in Post-Traumatic Stress Disorder: A Systematic Review and Meta-Analysis. Mol. Psychiatry 2022, 27, 3150–3163. [Google Scholar]
- Atalay, S.; Jarocka-Karpowicz, I.; Skrzydlewska, E. Antioxidative and Anti-Inflammatory Properties of Cannabidiol. Antioxidants 2019, 9, 21. [Google Scholar] [CrossRef]
- Bitencourt, R.M.; Takahashi, R.N. Cannabidiol as a Therapeutic Alternative for Post-Traumatic Stress Disorder: From Bench Research to Confirmation in Human Trials. Front. Neurosci. 2018, 12, 346003. [Google Scholar] [CrossRef]
- Elms, L.; Shannon, S.; Hughes, S.; Lewis, N. Cannabidiol in the Treatment of Post-Traumatic Stress Disorder: A Case Series. J. Altern. Complement. Med. 2019, 25, 392–397. [Google Scholar]
- Gasparyan, A.; Navarrete, F.; Manzanares, J. Cannabidiol and Sertraline Regulate Behavioral and Brain Gene Expression Alterations in an Animal Model of PTSD. Front. Pharmacol. 2021, 12, 694510. [Google Scholar]
- Shallcross, J.; Hámor, P.; Bechard, A.R.; Romano, M.; Knackstedt, L.; Schwendt, M. The Divergent Effects of CDPPB and Cannabidiol on Fear Extinction and Anxiety in a Predator Scent Stress Model of PTSD in Rats. Front. Behav. Neurosci. 2019, 13, 91. [Google Scholar]
- Thomas, A.; Baillie, G.L.; Phillips, A.M.; Razdan, R.K.; Ross, R.A.; Pertwee, R. Cannabidiol Displays Unexpectedly High Potency as an Antagonist of CB1 and CB2 Receptor Agonists in Vitro. Br. J. Pharmacol. 2007, 150, 613–623. [Google Scholar] [PubMed]
- Peng, J.; Fan, M.; An, C.; Ni, F.; Huang, W.; Luo, J. A Narrative Review of Molecular Mechanism and Therapeutic Effect of Cannabidiol (CBD). Basic Clin. Pharmacol. Toxicol. 2022, 130, 439–456. [Google Scholar]
- Steardo, L., Jr.; Carbone, E.A.; Menculini, G.; Moretti, P.; Steardo, L.; Tortorella, A. Endocannabinoid System as Therapeutic Target of PTSD: A Systematic Review. Life 2021, 11, 214. [Google Scholar] [CrossRef]
- García-Gutiérrez, M.S.; Navarrete, F.; Gasparyan, A.; Austrich-Olivares, A.; Sala, F.; Manzanares, J. Cannabidiol: A Potential New Alternative for the Treatment of Anxiety, Depression, and Psychotic Disorders. Biomolecules 2020, 10, 1575. [Google Scholar] [CrossRef]
- Matheson, J.; Bourgault, Z.; Le Foll, B. Sex Differences in the Neuropsychiatric Effects and Pharmacokinetics of Cannabidiol: A Scoping Review. Biomolecules 2022, 12, 1462. [Google Scholar] [CrossRef]
- Pisanti, S.; Malfitano, A.M.; Ciaglia, E.; Lamberti, A.; Ranieri, R.; Cuomo, G.; Abate, M.; Faggiana, G.; Proto, M.C.; Fiore, D.; et al. Cannabidiol: State of the Art and New Challenges for Therapeutic Applications. Pharmacol. Ther. 2017, 175, 133–150. [Google Scholar]
- Vitale, R.M.; Iannotti, F.A.; Amodeo, P. The (Poly) Pharmacology of Cannabidiol in Neurological and Neuropsychiatric Disorders: Molecular Mechanisms and Targets. Int. J. Mol. Sci. 2021, 22, 4876. [Google Scholar] [CrossRef]
- Korem, N.; Akirav, I. Cannabinoids Prevent the Effects of a Footshock Followed by Situational Reminders on Emotional Processing. Neuropsychopharmacology 2014, 39, 2709–2722. [Google Scholar]
- Burstein, O.; Shoshan, N.; Doron, R.; Akirav, I. Cannabinoids Prevent Depressive-like Symptoms and Alterations in BDNF Expression in a Rat Model of PTSD. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2018, 84, 129–139. [Google Scholar]
- Mizrachi Zer-Aviv, T.; Islami, L.; Hamilton, P.J.; Parise, E.M.; Nestler, E.J.; Sbarski, B.; Akirav, I. Enhancing Endocannabinoid Signaling via & beta;-Catenin in the Nucleus Accumbens Attenuates PTSD- and Depression-like Behavior of Male Rats. Biomedicines 2022, 10, 1789. [Google Scholar]
- Segev, A.; Korem, N.; Mizrachi Zer-Aviv, T.; Abush, H.; Lange, R.; Sauber, G.; Hillard, C.J.; Akirav, I. Role of Endocannabinoids in the Hippocampus and Amygdala in Emotional Memory and Plasticity. Neuropsychopharmacology 2018, 43, 2017–2027. [Google Scholar] [CrossRef]
- Shoshan, N.; Segev, A.; Abush, H.; Mizrachi Zer-Aviv, T.; Akirav, I. Cannabinoids Prevent the Differential Long-term Effects of Exposure to Severe Stress on Hippocampal-and Amygdala-dependent Memory and Plasticity. Hippocampus 2017, 27, 1093–1109. [Google Scholar]
- Rock, E.M.; Limebeer, C.L.; Petrie, G.N.; Williams, L.A.; Mechoulam, R.; Parker, L.A. Effect of Prior Foot Shock Stress and Δ 9-Tetrahydrocannabinol, Cannabidiolic Acid, and Cannabidiol on Anxiety-like Responding in the Light-Dark Emergence Test in Rats. Psychopharmacology 2017, 234, 2207–2217. [Google Scholar]
- Xie, G.; Gao, X.; Guo, Q.; Liang, H.; Yao, L.; Li, W.; Ma, B.; Wu, N.; Han, X.; Li, J. Cannabidiol Ameliorates PTSD-like Symptoms by Inhibiting Neuroinflammation through Its Action on CB2 Receptors in the Brain of Male Mice. Brain Behav. Immun. 2024, 119, 945–964. [Google Scholar]
- Herman, J.P.; Mueller, N.K. Role of the Ventral Subiculum in Stress Integration. Behav. Brain Res. 2006, 174, 215–224. [Google Scholar]
- Herman, J.P.; Cullinan, W.E.; Morano, M.I.; Akil, H.; Watson, S.J. Contribution of the Ventral Subiculum to Inhibitory Regulation of the Hypothalamo-pituitary-adrenocortical Axis. J. Neuroendocrinol. 1995, 7, 475–482. [Google Scholar]
- Herman, J.P.; Dolgas, C.M.; Carlson, S.L. Ventral Subiculum Regulates Hypothalamo–Pituitary–Adrenocortical and Behavioural Responses to Cognitive Stressors. Neuroscience 1998, 86, 449–459. [Google Scholar]
- Mueller, N.K.; Dolgas, C.M.; Herman, J.P. Stressor-Selective Role of the Ventral Subiculum in Regulation of Neuroendocrine Stress Responses. Endocrinology 2004, 145, 3763–3768. [Google Scholar]
- Kilpatrick, D.G.; Resnick, H.S.; Milanak, M.E.; Miller, M.W.; Keyes, K.M.; Friedman, M.J. National Estimates of Exposure to Traumatic Events and PTSD Prevalence Using DSM-IV and DSM-5 Criteria. J. Trauma. Stress 2013, 26, 537–547. [Google Scholar] [CrossRef]
- Tolin, D.F.; Foa, E.B. Sex Differences in Trauma and Posttraumatic Stress Disorder: A Quantitative Review of 25 Years of Research. Psychol. Trauma Theory Res. Pract. Policy 2008, 1, 37–85. [Google Scholar] [CrossRef]
- Vegeto, E.; Benedusi, V.; Maggi, A. Estrogen Anti-Inflammatory Activity in Brain: A Therapeutic Opportunity for Menopause and Neurodegenerative Diseases. Front. Neuroendocrinol. 2008, 29, 507–519. [Google Scholar] [CrossRef] [PubMed]
- Vegeto, E.; Belcredito, S.; Etteri, S.; Ghisletti, S.; Brusadelli, A.; Meda, C.; Krust, A.; Dupont, S.; Ciana, P.; Chambon, P.; et al. Estrogen Receptor-α Mediates the Brain Antiinflammatory Activity of Estradiol. Proc. Natl. Acad. Sci. USA 2003, 100, 9614–9619. [Google Scholar] [CrossRef]
- Klusmann, H.; Schulze, L.; Engel, S.; Bücklein, E.; Daehn, D.; Lozza-Fiacco, S.; Geiling, A.; Meyer, C.; Andersen, E.; Knaevelsrud, C.; et al. HPA Axis Activity across the Menstrual Cycle-a Systematic Review and Meta-Analysis of Longitudinal Studies. Front. Neuroendocrinol. 2022, 66, 100998. [Google Scholar] [CrossRef]
- Bassani, T.B.; Bartolomeo, C.S.; Oliveira, R.B.; Ureshino, R.P. Progestogen-Mediated Neuroprotection in Central Nervous System Disorders. Neuroendocrinology 2023, 113, 14–35. [Google Scholar] [CrossRef]
- Heidari, S.; Babor, T.F.; De Castro, P.; Tort, S.; Curno, M. Sex and Gender Equity in Research: Rationale for the SAGER Guidelines and Recommended Use. Res. Integr. Peer Rev. 2016, 1, 2. [Google Scholar] [CrossRef]
- Bangasser, D.A.; Wiersielis, K.R. Sex Differences in Stress Responses: A Critical Role for Corticotropin-Releasing Factor. Hormones 2018, 17, 5–13. [Google Scholar] [CrossRef]
- Ter Horst, G.J.; Wichmann, R.; Gerrits, M.; Westenbroek, C.; Lin, Y. Sex Differences in Stress Responses: Focus on Ovarian Hormones. Physiol. Behav. 2009, 97, 239–249. [Google Scholar] [CrossRef]
- Gorzalka, B.B.; Dang, S.S. Minireview: Endocannabinoids and Gonadal Hormones: Bidirectional Interactions in Physiology and Behavior. Endocrinology 2012, 153, 1016–1024. [Google Scholar] [CrossRef]
- Santoro, A.; Mele, E.; Marino, M.; Viggiano, A.; Nori, S.L.; Meccariello, R. The Complex Interplay between Endocannabinoid System and the Estrogen System in Central Nervous System and Periphery. Int. J. Mol. Sci. 2021, 22, 972. [Google Scholar] [CrossRef]
- Louvart, H.; Maccari, S.; Ducrocq, F.; Thomas, P.; Darnaudéry, M. Long-Term Behavioural Alterations in Female Rats after a Single Intense Footshock Followed by Situational Reminders. Psychoneuroendocrinology 2005, 30, 316–324. [Google Scholar] [CrossRef] [PubMed]
- Zer-Aviv, T.M.; Akirav, I. Sex Differences in Hippocampal Response to Endocannabinoids after Exposure to Severe Stress. Hippocampus 2016, 26, 947–957. [Google Scholar] [CrossRef] [PubMed]
- Aisenberg, N.; Serova, L.; Sabban, E.L.; Akirav, I. The Effects of Enhancing Endocannabinoid Signaling and Blocking Corticotrophin Releasing Factor Receptor in the Amygdala and Hippocampus on the Consolidation of a Stressful Event. Eur. Neuropsychopharmacol. 2017, 27, 913–927. [Google Scholar] [CrossRef]
- Saad, N.; Raviv, D.; Mizrachi Zer-Aviv, T.; Akirav, I. Cannabidiol Modulates Emotional Function and Brain-Derived Neurotrophic Factor Expression in Middle-Aged Female Rats Exposed to Social Isolation. Int. J. Mol. Sci. 2023, 24, 15492. [Google Scholar] [CrossRef] [PubMed]
- Segev, A.; Rubin, A.S.; Abush, H.; Richter-Levin, G.; Akirav, I. Cannabinoid Receptor Activation Prevents the Effects of Chronic Mild Stress on Emotional Learning and LTP in a Rat Model of Depression. Neuropsychopharmacology 2014, 39, 919–933. [Google Scholar] [CrossRef]
- Bauminger, H.; Zaidan, H.; Akirav, I.; Gaisler-Salomon, I. Anandamide Hydrolysis Inhibition Reverses the Long-Term Behavioral and Gene Expression Alterations Induced by MK-801 in Male Rats: Differential CB1 and CB2 Receptor-Mediated Effects. Schizophr. Bull. 2022, 48, 795–803. [Google Scholar] [CrossRef]
- Portugalov, A.; Zaidan, H.; Gaisler-Salomon, I.; Hillard, C.J.; Akirav, I. FAAH Inhibition Restores Early Life Stress-Induced Alterations in PFC MicroRNAs Associated with Depressive-like Behavior in Male and Female Rats. Int. J. Mol. Sci. 2022, 23, 16101. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: BestKeeper–Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Guo, B.; Zhang, M.; Hao, W.; Wang, Y.; Zhang, T.; Liu, C. Neuroinflammation Mechanisms of Neuromodulation Therapies for Anxiety and Depression. Transl. Psychiatry 2023, 13, 5. [Google Scholar] [CrossRef]
- Zheng, Z.-H.; Tu, J.-L.; Li, X.-H.; Hua, Q.; Liu, W.-Z.; Liu, Y.; Pan, B.-X.; Hu, P.; Zhang, W.-H. Neuroinflammation Induces Anxiety-and Depressive-like Behavior by Modulating Neuronal Plasticity in the Basolateral Amygdala. Brain Behav. Immun. 2021, 91, 505–518. [Google Scholar] [CrossRef]
- Mendoza, C.; Barreto, G.E.; Ávila-Rodriguez, M.; Echeverria, V. Role of Neuroinflammation and Sex Hormones in War-Related PTSD. Mol. Cell. Endocrinol. 2016, 434, 266–277. [Google Scholar] [CrossRef]
- Felmingham, K.L.; Fong, W.C.; Bryant, R.A. The Impact of Progesterone on Memory Consolidation of Threatening Images in Women. Psychoneuroendocrinology 2012, 37, 1896–1900. [Google Scholar] [CrossRef] [PubMed]
- Rohleder, N.; Schommer, N.C.; Hellhammer, D.H.; Engel, R.; Kirschbaum, C. Sex Differences in Glucocorticoid Sensitivity of Proinflammatory Cytokine Production after Psychosocial Stress. Psychosom. Med. 2001, 63, 966–972. [Google Scholar] [CrossRef] [PubMed]
- Maren, S.; Holmes, A. Stress and Fear Extinction. Neuropsychopharmacology 2016, 41, 58–79. [Google Scholar] [CrossRef] [PubMed]
- Wellman, C.L.; Moench, K.M. Preclinical Studies of Stress, Extinction, and Prefrontal Cortex: Intriguing Leads and Pressing Questions. Psychopharmacology 2019, 236, 59–72. [Google Scholar] [CrossRef]
- Song, C.; Stevenson, C.W.; Guimaraes, F.S.; Lee, J.L.C. Bidirectional Effects of Cannabidiol on Contextual Fear Memory Extinction. Front. Pharmacol. 2016, 7, 493. [Google Scholar] [CrossRef]
- Bitencourt, R.M.; Pamplona, F.A.; Takahashi, R.N. Facilitation of Contextual Fear Memory Extinction and Anti-Anxiogenic Effects of AM404 and Cannabidiol in Conditioned Rats. Eur. Neuropsychopharmacol. 2008, 18, 849–859. [Google Scholar] [CrossRef]
- Burns, S.B.; Szyszkowicz, J.K.; Luheshi, G.N.; Lutz, P.E.; Turecki, G. Plasticity of the Epigenome during Early-Life Stress. Semin. Cell Dev. Biol. 2018, 77, 115–132. [Google Scholar] [CrossRef]
- Do Monte, F.H.; Souza, R.R.; Bitencourt, R.M.; Kroon, J.A.; Takahashi, R.N. Infusion of Cannabidiol into Infralimbic Cortex Facilitates Fear Extinction via CB1 Receptors. Behav. Brain Res. 2013, 250, 23–27. [Google Scholar] [CrossRef]
- Shbiro, L.; Hen-Shoval, D.; Hazut, N.; Rapps, K.; Dar, S.; Zalsman, G.; Mechoulam, R.; Weller, A.; Shoval, G. Effects of Cannabidiol in Males and Females in Two Different Rat Models of Depression. Physiol. Behav. 2019, 201, 59–63. [Google Scholar] [CrossRef]
- Zanelati, T.V.; Biojone, C.; Moreira, F.A.; Guimarães, F.S.; Joca, S.R.L. Antidepressant-like Effects of Cannabidiol in Mice: Possible Involvement of 5-HT1A Receptors. Br. J. Pharmacol. 2010, 159, 122–128. [Google Scholar] [PubMed]
- Réus, G.Z.; Stringari, R.B.; Ribeiro, K.F.; Luft, T.; Abelaira, H.M.; Fries, G.R.; Aguiar, B.W.; Kapczinski, F.; Hallak, J.E.; Zuardi, A.W.; et al. Administration of Cannabidiol and Imipramine Induces Antidepressant-like Effects in the Forced Swimming Test and Increases Brain-Derived Neurotrophic Factor Levels in the Rat Amygdala. Acta Neuropsychiatr. 2011, 23, 241–248. [Google Scholar] [PubMed]
- Bright, U.; Akirav, I. Cannabidiol Modulates Alterations in PFC MicroRNAs in a Rat Model of Depression. Int. J. Mol. Sci. 2023, 24, 2052. [Google Scholar] [CrossRef] [PubMed]
- Turner, M.D.; Nedjai, B.; Hurst, T.; Pennington, D.J. Cytokines and Chemokines: At the Crossroads of Cell Signalling and Inflammatory Disease. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2014, 1843, 2563–2582. [Google Scholar]
- Kim, B.; Yun, J.; Park, B. Methamphetamine-Induced Neuronal Damage: Neurotoxicity and Neuroinflammation. Biomol. Ther. 2020, 28, 381–388. [Google Scholar]
- Yan, N.; Xu, Z.; Qu, C.; Zhang, J. Dimethyl Fumarate Improves Cognitive Deficits in Chronic Cerebral Hypoperfusion Rats by Alleviating Inflammation, Oxidative Stress, and Ferroptosis via NRF2/ARE/NF-ΚB Signal Pathway. Int. Immunopharmacol. 2021, 98, 107844. [Google Scholar]
- Wang, S.-C.; Lin, C.-C.; Chen, C.-C.; Tzeng, N.-S.; Liu, Y.-P. Effects of Oxytocin on Fear Memory and Neuroinflammation in a Rodent Model of Posttraumatic Stress Disorder. Int. J. Mol. Sci. 2018, 19, 3848. [Google Scholar] [CrossRef]
- Muhie, S.; Gautam, A.; Chakraborty, N.; Hoke, A.; Meyerhoff, J.; Hammamieh, R.; Jett, M. Molecular Indicators of Stress-Induced Neuroinflammation in a Mouse Model Simulating Features of Post-Traumatic Stress Disorder. Transl. Psychiatry 2017, 7, e1135. [Google Scholar]
- Avgana, H.; Toledano, R.S.; Akirav, I. Examining the Role of Oxytocinergic Signaling and Neuroinflammatory Markers in the Therapeutic Effects of MDMA in a Rat Model for PTSD. Pharmaceuticals 2024, 17, 846. [Google Scholar] [CrossRef]
- Steinman, M.Q.; Kirson, D.; Wolfe, S.A.; Khom, S.; D’Ambrosio, S.R.; Spierling Bagsic, S.R.; Bajo, M.; Vlkolinský, R.; Hoang, N.K.; Singhal, A.; et al. Importance of Sex and Trauma Context on Circulating Cytokines and Amygdalar GABAergic Signaling in a Comorbid Model of Posttraumatic Stress and Alcohol Use Disorders. Mol. Psychiatry 2021, 26, 3093–3107. [Google Scholar]
- Bollinger, J.L.; Burns, C.M.B.; Wellman, C.L. Differential Effects of Stress on Microglial Cell Activation in Male and Female Medial Prefrontal Cortex. Brain Behav. Immun. 2016, 52, 88–97. [Google Scholar] [CrossRef] [PubMed]
- Enomoto, S.; Kato, T.A. Involvement of Microglia in Disturbed Fear Memory Regulation: Possible Microglial Contribution to the Pathophysiology of Posttraumatic Stress Disorder. Neurochem. Int. 2021, 142, 104921. [Google Scholar] [PubMed]
- Nahum, K.; Todder, D.; Zohar, J.; Cohen, H. The Role of Microglia in the (Mal) Adaptive Response to Traumatic Experience in an Animal Model of PTSD. Int. J. Mol. Sci. 2022, 23, 7185. [Google Scholar] [CrossRef]
- Cornell, J.; Salinas, S.; Huang, H.-Y.; Zhou, M. Microglia Regulation of Synaptic Plasticity and Learning and Memory. Neural Regen. Res. 2022, 17, 705–716. [Google Scholar]
- O’Mara, S. Controlling Hippocampal Output: The Central Role of Subiculum in Hippocampal Information Processing. Behav. Brain Res. 2006, 174, 304–312. [Google Scholar]
- Matsumoto, N.; Kitanishi, T.; Mizuseki, K. The Subiculum: Unique Hippocampal Hub and More. Neurosci. Res. 2019, 143, 1–12. [Google Scholar]
- Luján, M.Á.; Valverde, O. The Pro-Neurogenic Effects of Cannabidiol and Its Potential Therapeutic Implications in Psychiatric Disorders. Front. Behav. Neurosci. 2020, 14, 109. [Google Scholar]
- Machado Bergamaschi, M.; Helena Costa Queiroz, R.; Waldo Zuardi, A.; Crippa, A.S. Safety and Side Effects of Cannabidiol, a Cannabis Sativa Constituent. Curr. Drug Saf. 2011, 6, 237–249. [Google Scholar]
- Shannon, S.; Opila-Lehman, J. Effectiveness of Cannabidiol Oil for Pediatric Anxiety and Insomnia as Part of Posttraumatic Stress Disorder: A Case Report. Perm. J. 2016, 20, 16-005. [Google Scholar] [CrossRef]
- Baker, D.G.; Nievergelt, C.M.; O’Connor, D.T. Biomarkers of PTSD: Neuropeptides and Immune Signaling. Neuropharmacology 2012, 62, 663–673. [Google Scholar]
Name | Description | Gene Bank ID (NM) | Protein Name | Primer Sequence |
---|---|---|---|---|
hprt | Housekeeping gene; used as a reference gene | NM_012583.2 | HPRT | F: 5′GAGCACTTCAGGGATTTGAATCA3′ R: 5′GTAGATTCAACTTGCCGCTGCTGTCT3′ |
Il1β | Interleukin 1 beta | NM_031512.2 | IL-1beta | F: 5′GCTGTGGCAGCTACCTATGTCTT3′ R: 5′GTCACAGAGGACGGGCTCTTC3′ |
Il6 | Interleukin 6 | NM_012589.2 | IL-6 | F: 5′CTTCCAAACTGGATATAACCAGG3′ R: 5′CTTCACAAACTCCAGGTAGAAAC3′ |
tnfα | Tumor necrosis factor alpha | NM_012675.3 | TNF-alpha | F: 5′CCAGACCCTCACACTCAGATC3′ R: 5′CTCCGCTTGGTGGTTTGCTA3′ |
Ext. Average | FST-Climbing | FST-Immobility | |
---|---|---|---|
mPFC-il1β | r = 0.113 p = 0.625 | r = −0.152 p = 0.51 | r = 0.238 p = 0.3 |
mPFC-il6 | r = −0.728 p < 0.001 | r = 0.281 p = 0.231 | r = −0.61 p = 0.004 |
mPFC-tnfα | r = −0.045 p = 0.845 | r = −0.113 p = 0.617 | r = −0.018 p = 0.938 |
vSUB-il1β | r = −0.237 p = 0.344 | r = −0.313 p = 0.179 | r = −0.273 p = 0.244 |
vSUB-il6 | r = 0.497 p = 0.042 | r = −0.414 p = 0.069 | r = 0.462 p = 0.04 |
vSUB-tnfα | r = 0.483 p = 0.031 | r = −0.666 p = 0.001 | r = 0.391 p = 0.072 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Portugalov, A.; Peled, G.; Zorin, S.; Akirav, I. Cannabidiol Modulates Neuroinflammatory Markers in a PTSD Model Conducted on Female Rats. Biomolecules 2024, 14, 1384. https://doi.org/10.3390/biom14111384
Portugalov A, Peled G, Zorin S, Akirav I. Cannabidiol Modulates Neuroinflammatory Markers in a PTSD Model Conducted on Female Rats. Biomolecules. 2024; 14(11):1384. https://doi.org/10.3390/biom14111384
Chicago/Turabian StylePortugalov, Anna, Gaia Peled, Sharon Zorin, and Irit Akirav. 2024. "Cannabidiol Modulates Neuroinflammatory Markers in a PTSD Model Conducted on Female Rats" Biomolecules 14, no. 11: 1384. https://doi.org/10.3390/biom14111384
APA StylePortugalov, A., Peled, G., Zorin, S., & Akirav, I. (2024). Cannabidiol Modulates Neuroinflammatory Markers in a PTSD Model Conducted on Female Rats. Biomolecules, 14(11), 1384. https://doi.org/10.3390/biom14111384