(20S)G-Rh2 Inhibits NF-κB Regulated Epithelial-Mesenchymal Transition by Targeting Annexin A2
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell lines and Culture
2.2. Chemicals, Antibodies and Plasmids
2.3. Transfection
2.4. Immuno-Precipitation
2.5. Cellular Thermal Shift Assay
2.6. Dual Luciferase Reporter Assay
2.7. Real-Time Polymerase Chain Reaction
2.8. Cell Migration Analysis
2.9. Cell Invasion Analysis
2.10. Statistical Analysis
3. Results
3.1. Anxa2 Bound to NF-κB p50 Subunit in MDA-MB-231 Cells and MCF-7 Cells
3.2. Anxa2 Promoted NF-κB Activation and Associated EMT in Invasive Breast Cancer Cells
3.3. (20S)G-Rh2 Inhibited NF-κB Activation Targeting Anxa2
3.4. (20S)G-Rh2 Inhibited the Migration and Invasion of MDA-MB-231 in a Dose-Dependent Manner
3.5. (20S)G-Rh2 Binding-Deficient Mutant of Anxa2 Protected MDA-MB-231 Cells from (20S)G-Rh2 Induced NF-κB Inhibition
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Thiery, J.P.; Acloque, H.; Huang, R.Y.J.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef] [PubMed]
- Nieto, M.A.; Huang, R.Y.J.; Jackson, R.A.; Thiery, J.P. EMT: 2016. Cell 2016, 166, 21–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef] [Green Version]
- Nieto, M.A. Epithelial plasticity: A common theme in embryonic and cancer cells. Science 2013, 342, 1234850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pastushenko, I.; Brisebarre, A.; Sifrim, A.; Fioramonti, M.; Revenco, T.; Boumahdi, S.; Van Keymeulen, A.; Brown, D.; Moers, V.; Lemaire, S.; et al. Identification of the tumour transition states occurring during EMT. Nature 2018, 556, 463–468. [Google Scholar] [CrossRef] [PubMed]
- Beck, B.; Lapouge, G.; Rorive, S.; Drogat, B.; Desaedelaere, K.; Delafaille, S.; Dubois, C.; Salmon, I.; Willekens, K.; Marine, J.C.; et al. Different levels of Twist1 regulate skin tumor initiation, stemness, and progression. Cell Stem Cell 2015, 16, 67–79. [Google Scholar] [CrossRef] [Green Version]
- Derynck, R.; Weinberg, R.A. EMT and cancer: More than meets the eye. Dev. Cell 2019, 49, 313–316. [Google Scholar] [CrossRef]
- Aiello, N.M.; Maddipati, R.; Norgard, R.J.; Balli, D.; Li, J.; Yuan, S.; Yamazoe, T.; Black, T.; Sahmoud, A.; Furth, E.E.; et al. EMT subtype influences epithelial plasticity and mode of cell migration. Dev. Cell 2018, 45, 681–695. [Google Scholar] [CrossRef] [Green Version]
- Meyer-Schaller, N.; Cardner, M.; Diepenbruck, M.; Saxena, M.; Tiede, S.; Lüönd, F.; Ivanek, R.; Beerenwinkel, N.; Christofori, G. A hierarchical regulatory landscape during the multiple stages of EMT. Dev. Cell 2019, 48, 539–553. [Google Scholar] [CrossRef] [Green Version]
- Yousefi, H.; Maheronnaghsh, M.; Molaer, F.; Mashouri, L.; Reza Aref, A.; Momeny, M.; Alashari, S.K. Long noncoding RNAs and exosomal lncRNAs: Classification, and mechanisms in breast cancer metastasis and drug resistance. Oncogene 2020, 39, 953–974. [Google Scholar] [CrossRef]
- Brabletz, T. EMT and MET in metastasis: Where are the cancer stem cells? Cancer Cell 2012, 22, 699–701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pastushenko, I.; Blanpain, C. EMT transition states during tumor progression and metastasis. Trends Cell Biol. 2019, 29, 212–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puram, S.V.; Tirosh, I.; Parikh, A.S.; Patel, A.P.; Yizhak, K.; Gillespie, S.; Rodman, C.; Luo, C.L.; Mroz, E.A.; Emerick, K.S.; et al. Single-cell transcriptomic analysis of primary and metastatic tumor ecosystems in head and neck cancer. Cell 2017, 171, 1611–1624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schliekelman, M.J.; Taguchi, A.; Zhu, J.; Dai, X.; Rodriguez, J.; Celiktas, M.; Zhang, Q.; Chin, A.; Wong, C.H.; Wang, H.; et al. Molecular portraits of epithelial, mesenchymal, and hybrid states in lung adenocarcinoma and their relevance to survival. Cancer Res. 2015, 75, 1789–1800. [Google Scholar] [CrossRef] [Green Version]
- Marcucci, F.; Stassi, G.; De Maria, R. Epithelial-mesenchymal transition: A new target in anticancer drug discovery. Nat. Rev. Drug Discov. 2016, 15, 311–325. [Google Scholar] [CrossRef]
- Lo, H.C.; Zhang, X.H. EMT in metastasis: Finding the right balance. Dev. Cell 2018, 45, 663–665. [Google Scholar] [CrossRef] [Green Version]
- Acharyya, S.; Oskarsson, T.; Yanharanta, S.; Madlladi, S.; Kim, J.; Morris, P.G.; Manova-Todorova, K.; Leversha, M.; Hogg, N.; Seshan, V.E.L.; et al. A CXCL1 paracrine network links cancer chemoresistance and metastasis. Cell 2012, 150, 165–178. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.R.; Kim, D.H.; Seo, Y.K.; Park, D.; Jang, H.J.; Choi, S.Y.; Lee, Y.H.; Lee, G.H.; Nakajima, K.; Taniguchi, N.; et al. Elevated O-GlcNAcylation promotes colonic inflammation and tumorigenesis by modulating NF-κB signaling. Oncotarget 2015, 6, 12529–12542. [Google Scholar] [CrossRef] [Green Version]
- Hanahan, D.; Weinberg, R.A. The hallmarks of cancer. Cell 2000, 100, 57–70. [Google Scholar] [CrossRef] [Green Version]
- AlQathama, A.; Prieto, J.M. Natural products with therapeutic potential in melanoma metastasis. Nat. Prod. Rep. 2015, 32, 1170–1182. [Google Scholar] [CrossRef]
- Karin, M. Nuclear factor-kappaB in cancer development and progression. Nature 2006, 441, 431–436. [Google Scholar] [CrossRef] [PubMed]
- Chua, H.L.; Bhar-Nakshatri, P.; Clare, S.E.; Morumiya, A.; Badve, S.; Nakshatri, H. NF-κB represses E-cadherin expression and enhances epithelial to mesenchymal transition of mammary epithelial cells: Potential involvement of ZEB-1 and ZEB-2. Oncogene 2007, 26, 711–724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pires, B.R.; Mencalha, A.L.; Ferreira, G.M.; de Souza, W.F.; Morgado-Díaz, J.A.; Maia, A.M.; Corrêa, S.; Abdelhay, E.S. NF-KappaB is involved in the regulation of EMT genes in breast cancer cells. PLoS ONE 2017, 12, e0169622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.; Wu, Z.; Han, D.; Wei, C.; Liang, Y.; Jiang, T.; Chen, L.; Sha, M.; Cao, Y.; Huang, F.; et al. Mesencephalic astrocyte-derived neurotrophic factor inhibits liver cancer through small ubiquitin-related modifier (SUMO)ylation-related suppression of NF-κB/Snail signaling pathway and epithelial-mesenchymal transition. Hepatology 2020. [Google Scholar] [CrossRef] [Green Version]
- Shin, S.R.; Sanchez-Velar, N.; Sherr, D.H.; Sonenshein, G.E. 7,12-dimethylbenz(a)anthracene treatment of a c-rel mouse mammary tumor cell line induces epithelial to mesenchymal transition via activation of nuclear factor-κB. Cancer Res. 2006, 66, 2570–2575. [Google Scholar] [CrossRef] [Green Version]
- Liu, P.; Yang, P.; Zhang, Z.; Liu, M.; Hu, S. Ezrin/NF-κB pathway regulates EGF-induced epithelial-mesenchymal transition (EMT), metastasis, and progression of osteosarcoma. Med. Sci. Monit. 2018, 24, 2098–2108. [Google Scholar] [CrossRef]
- Fang, H.; Wu, Y.; Huang, X.; Wang, W.; Ang, B.; Cao, X.; Wan, T. Toll-like receptor 4 (TLR4) is essential for Hsp70-like protein 1 (HSP70L1) to activate dendritic cells and induce Th1 response. J. Biol. Chem. 2011, 286, 30393–30400. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.S.; Lin, Y.; Li, Y.; Song, Z.; Jin, Y.H. The identification of molecular target of (20S)Ginsenoside Rh2 for its anti-cancer activity. Sci. Rep. 2017, 7, 12408. [Google Scholar] [CrossRef]
- Jung, H.; Kim, J.S.; Kim, W.K.; Oh, K.J.; Lee, H.J.; Han, B.S.; Kim, D.S.; Seo, Y.S.; Lee, S.C.; Park, S.G.; et al. Intracellular annexin A2 regulates NF-κB signaling by binding to the p50 subunit implications for gemcitabbine resistance in pancreatic. Cell Death Dis. 2015, 6, e1606. [Google Scholar] [CrossRef] [Green Version]
- Chung, S.S.; Giehl, N.; Wu, Y.; Vadgama, J.V. STAT3 activation in HER2-overexpressing breast cancer promotes epithelial−mesenchymal transition and cancer stem cell traits. Int. J. Oncol. 2014, 44, 403–411. [Google Scholar] [CrossRef] [Green Version]
- Xiong, H.; Hong, J.; Du, W.; Lin, Y.W.; Ren, L.L.; Wang, Y.C.; Su, W.Y.; Wang, J.L.; Cui, Y.; Wang, Z.H.; et al. Roles of STAT3 and ZEB1 proteins in E-cadherin down-regulation and human colorectal cancer epithelial−mesenchymal transition. J. Biol. Chem. 2012, 287, 5819–5832. [Google Scholar] [CrossRef] [Green Version]
- Bydoun, M.; Waisman, D.M. On the contribution of S100A10 and annexin A2 to plasminogen activation and ongogenesis: An enduring ambiguity. Future Oncol. 2014, 10, 2469–2479. [Google Scholar] [CrossRef]
- Myrvang, H.K.; Guo, X.; Li, C.; Dekker, L.V. Protein interactions between surface annexin A2 and S100A10 mediate adhesion of breast cancer cells to microvascular endothelial cells. Febs Lett. 2013, 587, 3210–3215. [Google Scholar] [CrossRef] [Green Version]
- Semo, A.; Moreno, M.J.; Onichtchenko, A.; Abulrob, A.; Ball, M.; Ekiel, I.; Pietrzynski, G.; Stanimirovic, D.; Alakhov, V. Metastasis-associated protein S100A4 induces angiogenesis through interaction with Annexin II and accelerated plasmin formation. J. Biol. Chem. 2005, 280, 20833–20841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nedjadi, T.; Kitteringham, N.; Campbell, F.; Jenkins, R.E.; Park, B.K.; Navarro, P.; Ashcroft, F.; Tepikin, A.; Neoptolemos, J.P.; Costello, E. S100A6 binds to annexin 2 in pancreatic cancer cells and promotes pancreatic cancer cell motility. Br. J. Cancer 2009, 101, 1145–1154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jaiswal, J.K.; Nylandsted, J. S100 and annexin proteins identify cell membrane damage as the Achilles heel of metastatic cancer cells. Cell Cycle 2015, 14, 502–509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jaiswal, J.K.; Lauritzen, S.P.; Scheffer, L.; Sakaguchi, M.; Bunkenborg, J.; Simon, S.M.; Kallunki, T.; Jäättelä, M.; Nylandsted, J. S100A11 is required for efficient plasma membrane repair and survival of invasive cancer cells. Nat. Commun. 2014, 5, 3795. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, J.; Yang, Y.; Gao, Z.; Wang, Z.; Ji, W.; Song, W.; Zhang, F.; Niu, R. Tyr23 phosphorylation of Anxa2 enhances STAT3 activation and promotes proliferation and invasion of breast cancer cells. Breast Cancer Res. Treat. 2017, 164, 327–340. [Google Scholar] [CrossRef]
- Wang, T.; Yuan, J.; Zhang, J.; Tian, R.; Ji, W.; Zhou, Y.; Yang, Y.; Song, W.; Zhang, F.; Niu, R. Anxa2 binds to STAT3 and promotes epithelial to mesenchymal transition in breast cancer cells. Oncotarget 2015, 6, 30975–30992. [Google Scholar] [CrossRef] [Green Version]
- Yan, X.; Zhang, D.; Wu, W.; Wu, S.; Qian, J.; Hao, Y.; Yan, F.; Zhu, P.; Wu, J.; Huang, G.; et al. Mesenchymal Stem Cells Promote Hepatocarcinogenesis via lncRNA-MUF Interaction with ANXA2 and miR-34a. Cancer Res. 2017, 77, 6704–6716. [Google Scholar] [CrossRef] [Green Version]
- Wu, M.; Sun, Y.; Xu, F.; Liang, Y.; Liu, H.; Yi, Y. Annexin A2 Silencing Inhibits Proliferation and Epithelial-to-mesenchymal Transition through p53-Dependent Pathway in NSCLCs. J. Cancer 2019, 10, 1077–1085. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, H.; Ban, Z.; Nai, M.; Yang, L.; Chen, Y.; Xu, Y. Annexin A2 inhibition suppresses ovarian cancer progression via regulating β-catenin/EMT. Oncol. Rep. 2017, 37, 3643–3650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, L.; Song, J.; Wu, L.; Cheng, L.; Chen, A.; Wang, Y.; Huang, Y.; Huang, L. Role of Annexin A2 in the EGF-induced epithelial-mesenchymal transition in human CaSki cells. Oncol. Lett. 2017, 13, 377–383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, X.X.; Guo, Q.; Li, Y.; Lee, S.K.; Wei, X.N.; Jin, Y.H. Ginsenoside Rh2 induces human hepatoma cell apoptosis via bax/bak triggered cytochrome C release and caspase-9/ caspase-8 activation. Int. J. Mol. Sci. 2012, 13, 15523–15535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, H.; Lee, S.; Jeong, D.; Kim, S.J. Ginsenoside Rh2 epigenetically regulates cell-mediated immune pathway to inhibit proliferation of MCF-7 breast cancer cells. J. Ginseng Res. 2018, 42. [Google Scholar] [CrossRef] [PubMed]
- Mathiyalagan, R.; Wang, C.; Kim, Y.J.; Castro-Aceituno, V.; Ahn, S.; Subramaniyam, S.; Simu, S.Y.; Jiménez-Pérez, Z.E.; Yang, D.C.; Jung, S.K. Preparation of polyethylene glycol-ginsenoside Rh1 and Rh2 conjugates and their efficacy against lung cancer and inflammation. Molecules 2019, 24, 4367. [Google Scholar] [CrossRef] [Green Version]
- Hou, J.G.; Jeon, B.M.; Yun, Y.J.; Cui, C.H.; Kim, S.C. Ginsenoside Rh2 ameliorates doxorubicin-induced senescence bystander effect in breast carcinoma cell MDA-MB-231 and nomal epithelial cell MCF-10A. Int. J. Mol. Sci. 2019, 20, 1244. [Google Scholar] [CrossRef] [Green Version]
- Qi, Z.; Chen, L.; Li, Z.; Shao, Z.; Qi, Y.; Gao, K.; Liu, S.; Sun, Y.; Li, P.; Liu, J. Immunomodulatory Effects of (24R)-Pseudo-Ginsenoside HQ and (24S)-Pseudo-Ginsenoside HQ on Cyclophosphamide-Induced Immunosuppression and Their Anti-Tumor Effects Study. Int. J. Mol. Sci. 2019, 20, 836. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Yan, S.J.; Zhang, H.T.; Li, N.; Liu, T.; Zhang, Y.L.; Li, X.X.; Ma, Q.; Qiu, X.C.; Fan, Q.Y.; et al. Ginsenoside Rh2 enhances the antitumor immunological response of a melanoma mice model. Onco. Lett. 2017, 13, 681–685. [Google Scholar] [CrossRef]
- Huang, Y.; Huang, H.; Han, Z.; Li, W.; Mai, Z.; Yuan, R. Ginsenoside Rh2 Inhibits Angiogenesis in Prostate Cancer by Targeting CNNM1. J. Nanosci. Nanotechnol. 2019, 19, 1942–1950. [Google Scholar] [CrossRef]
Primer Description | Sequence |
---|---|
pcs4-Anxa2-dN-F | 5’- TTGGATCCATGGATGCTGAGCGGGATGCTTTG -3’ |
pcs4-Anxa2-dN-R | 5’- CCGCTCGAGTCATCTCCACCACACAGGTACAG -3’ |
pLVX-Anxa2-dN-F | 5’- GCGTATACATGGATGCTGAGCGGGATGCTTTG -3’ |
pLVX-Anxa2-F | 5’- GCGTATACATGTCTACTGTTCACGAAATCCT -3’ |
pLVX-Anxa2-R | 5’- GCGGATCCTAGCTATCTAGAGGCTCGAGAGG -3’ |
Gene Name | Sequence |
---|---|
SNAIL-F | 5’- TGCCCTCAAGATGCACATCCGA -3’ |
SNAIL-R | 5’- GGGACAGGAGAAGGGCTTCTC -3’ |
SLUG-F | 5’- ATCTGCGGCAAGGCGTTTTCCA -3’ |
SLUG-R | 5’- GAGCCCTCAGATTTGACCTGTC -3’ |
SIP1-F | 5’- GAGTTGATGCCTCGGCTATTGC -3’ |
SIP1-R | 5’- CTGGACATTGAGCTGCTTCGATC -3’ |
TWIST1-F | 5’- GCCAGGTACATCGACTTCCTCT -3’ |
TWIST1-R | 5’- TCCATCCTCCAGACCGAGAAGG -3’ |
MMP2-F | 5’- AGCGAGTGGATGCCGCCTTTAA -3’ |
MMP2-R | 5’- CATTCCAGGCATCTGCGATGAG -3’ |
MMP9-F | 5’- GCCACTACTGTGCCTTTGAGTC -3’ |
MMP9-R | 5’- CCCTCAGAGAATCGCCAGTACT -3’ |
CDH1-F | 5’- GCCTCCTGAAAAGAGAGTGGAAG -3’ |
CDH1-R | 5’- TGGCAGTGTCTCTCCAAATCCG -3’ |
CDH2-F | 5’- CCTCCAGAGTTTACTGCCATGAC -3’ |
CDH2-R | 5’- GTAGGATCTCCGCCACTGATTC -3’ |
GAPDH-F | 5’- GTCTCCTCTGACTTCAACAGCG -3’ |
GAPDH-R | 5’- ACCACCCTGTTGCTGTAGCCAA -3’ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.-S.; Li, H.; Li, Y.; Zhang, S.; Jin, Y.-H. (20S)G-Rh2 Inhibits NF-κB Regulated Epithelial-Mesenchymal Transition by Targeting Annexin A2. Biomolecules 2020, 10, 528. https://doi.org/10.3390/biom10040528
Wang Y-S, Li H, Li Y, Zhang S, Jin Y-H. (20S)G-Rh2 Inhibits NF-κB Regulated Epithelial-Mesenchymal Transition by Targeting Annexin A2. Biomolecules. 2020; 10(4):528. https://doi.org/10.3390/biom10040528
Chicago/Turabian StyleWang, Yu-Shi, He Li, Yang Li, Shiyin Zhang, and Ying-Hua Jin. 2020. "(20S)G-Rh2 Inhibits NF-κB Regulated Epithelial-Mesenchymal Transition by Targeting Annexin A2" Biomolecules 10, no. 4: 528. https://doi.org/10.3390/biom10040528