Next Article in Journal
How Emerging Digital Health Technologies Based on Dietary and Physical Activity Regulation Improve Metabolic Syndrome-Related Outcomes in Adolescents: A Systematic Review
Previous Article in Journal
Hepatitis C Virus Infection Induces Autoimmune Hypothyroidism with Potential Profound Metabolic Implications: A Cross-Sectional Study in a High-Prevalence Region
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Metabolites
Volume 16
Issue 2
10.3390/metabo16020105
metabolites-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Neurotoxic Effects of Acute Tributyltin Exposure in Adult Zebrafish: Behavioral Impairments and Mechanistic Insights

by
Qi Zheng
1,
Nan Hong
2,
Lin Liu
3,
Cong Wang
1,
Ruixi Gan
1,
Di Xu
1 and
Junsong Wang
1,*
1
Center of Molecular Metabolism, Nanjing University of Science and Technology, 200 Xiaolingwei Street, Nanjing 210094, China
2
Department of Dermatology, Jinling Hospital, School of Medicine, Nanjing University, Nanjing 210007, China
3
Department of Interventional Surgery, Zibo Central Hospital, No. 54 Gongqingtuan Road (W), Zibo 255000, China
*
Author to whom correspondence should be addressed.
Metabolites 2026, 16(2), 105; https://doi.org/10.3390/metabo16020105
Submission received: 23 December 2025 / Revised: 15 January 2026 / Accepted: 26 January 2026 / Published: 1 February 2026
(This article belongs to the Section Environmental Metabolomics)
Browse Figures
Versions Notes

Abstract

Background/Objectives: Tributyltin (TBT) remains a persistent aquatic contaminant with documented neurotoxic effects, yet the underlying mechanisms of its neurotoxicity remain poorly understood. Methods: We investigated the comprehensive molecular mechanisms of TBT-induced neurotoxicity in zebrafish (Danio rerio) through an integrated approach combining histopathological examination, metabolomics analysis, transcriptional profiling, and behavioral assays. Results: Histopathological analysis revealed significant TBT-induced damage to brain tissue architecture. Metabolomic profiling demonstrated that TBT exposure (500 ng/L) severely disrupted cellular energy metabolism, particularly the TCA cycle and purine/pyrimidine metabolism, while exhibiting hormetic responses at lower concentrations. Transcriptional analysis identified widespread downregulation of SNARE complex proteins and neurotransmitter transporters, indicating comprehensive deterioration of synaptic machinery. Conclusions: These molecular perturbations corresponded with systematic disruption of antioxidant defense mechanisms and neurotransmitter signaling pathways, establishing a direct mechanistic link to observed behavioral deficits. Our findings reveal a hierarchical cascade of molecular disruptions triggered by TBT exposure, bridging the critical gap between metabolic dysregulation and synaptic dysfunction. This mechanistic framework provides fundamental insights into the neurotoxicological impact of this widespread environmental contaminant, highlighting potential therapeutic targets for intervention.

1. Introduction

Tributyltin (TBT), a widely utilized organotin compound, has found extensive applications as a biocide, wood preservative, and antifouling agent in paint formulations [1]. Despite its industrial utility, growing concerns over its environmental toxicity have led to global restrictions [2]. The International Maritime Organization (IMO) implemented a comprehensive ban on TBT usage in 2008, following an initial prohibition in 2003 [3]. However, high tributyltin (TBT) concentrations ranging from 0.5 to 977 ng/L continue to persist in mainland China’s aquatic environments, posing significant threats to diverse aquatic organisms [4]. Previous studies have documented TBT’s adverse effects, including sexual behavior alterations in female mollusks and disruptions in sexual behavior, reproduction, hormone levels, and gonadal development in fish [5,6,7,8,9]. Furthermore, TBT exposure has been linked to neurotoxicity, developmental abnormalities, endocrine disruption, and compromised embryonic development in various aquatic species [10,11]. For instance, TBT exposure induced developmental anomalies in Hemicentrotus pulcherrimus embryos, caused skeletal and neuromuscular deformities in medaka embryos, and resulted in spinal curvature affecting swimming ability in trout embryos [12]. However, the precise mechanisms underlying TBT-induced neurotoxicity remain incompletely understood, warranting further investigation for improved risk assessment and management strategies.
Zebrafish (Danio rerio) has emerged as an invaluable model organism in neuroscience research, owing to its genetic homology with humans and practical advantages in laboratory settings [13]. Its well-characterized genome, rapid development, and transparent embryos make it particularly suitable for investigating the complex relationships between the nervous system and behavior [14]. The nervous system orchestrates essential functions including perception, information processing, motor control, and cognition through sophisticated neurotransmitter systems [15,16]. Zebrafish possess a comprehensive array of neurotransmitters, including dopamine, serotonin, acetylcholine, gamma-aminobutyric acid (GABA), glutamate, histamine, and glycine [17]. Neural transmission can be significantly impacted by various external factors, including drugs, food additives, medications, chemotherapy agents, radioactive substances, and environmental toxins [18,19]. Disruptions in neural transmission have been associated with numerous neurological disorders, including cognitive impairments, oxidative stress, schizophrenia, depression, epilepsy, and sleep disorders [20].
Metabolomics, a systematic analytical approach in systems biology, has demonstrated broad applicability across multiple disciplines, including medicine, drug development, bioengineering, food science, environmental science, and agricultural research [21]. This approach aims to comprehensively characterize the chemical reactions within organisms, revealing metabolic alterations associated with different physiological states, disease processes, and environmental exposures [22]. The methodology employs high-throughput analytical techniques such as liquid chromatography–mass spectrometry (LC–MS), gas chromatography–mass spectrometry (GC-MS), and nuclear magnetic resonance (NMR) for metabolite detection and quantification [23]. Subsequent statistical and pattern recognition analyses enable the identification of altered metabolic networks and pathways [24]. Metabolomics proves particularly valuable in assessing environmental pollutants’ impacts on metabolic pathways and elucidating toxic mechanisms [25]. Additionally, it facilitates the discovery and monitoring of environmental pollutant biomarkers, enabling real-time surveillance and early intervention in environmental contamination cases [26].
The present study investigates the effects of TBT exposure at varying concentrations (20, 100, 500 ng/L) on zebrafish locomotor behavior. Through LC-MS-based metabolomics analysis and qPCR validation of pathway-specific gene expression, this research aims to elucidate the neurotoxic mechanisms of TBT in zebrafish. The findings from this study hold significant implications for understanding, preventing, and treating neurotoxicity induced by organotin pollutants.

2. Materials and Methods

2.1. Chemicals and Reagents

Tributyltin chloride (TBT-Cl) and dimethyl sulfoxide (DMSO) were obtained from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). High-purity methanol and acetonitrile (LC/MS grade) were purchased from Sigma (St. Louis, MO, USA). Quantitative PCR reagents were sourced from yeaSen Biotechnology Co., Ltd. (Shanghai, China). All other chemicals used were of analytical grade.

2.2. Animal Husbandry and Experimental Design

120 3-month-old AB strain zebrafish (Danio rerio), obtained from EzeRinka Biotechnology Co., Ltd. (Nanjing, China), were acclimated for 14 days under laboratory conditions. The fish were maintained in filtered tap water at 28 ± 1 °C, pH 7.4 ± 0.2, with a 14:10 h light/dark cycle and fed paramecium twice daily. Following acclimation, the zebrafish were randomly assigned to four groups (n = 30 per group) and maintained in 20 L glass tanks containing 15 L of exposure solution: a control group exposed to 0.01% DMSO (vehicle only) and three treatment groups exposed to nominal TBT at concentrations of 20, 100, and 500 ng/L for 7 days. Test solutions were renewed twice daily by replacing 75% of the water volume. Water samples were collected before each renewal and analyzed using LC-MS, which confirmed actual TBT concentrations of 18.3 ± 0.6, 95.2 ± 2.3, and 479 ± 9.9 ng/L remained within ±20% of nominal values (Figure S1), in compliance with Organisation for Economic Co-operation and Development (OECD) guidelines (Test No. 203: Fish, Acute Toxicity Test and Test No. 210: Fish, Early-life Stage Toxicity Test).

2.3. Behavioral Analysis

Locomotor activity and light–dark transition responses were assessed in 6 randomly selected fish per group using a validated methodology [27]. Individual fish were placed in separate wells of a 6-well plate, and their behavior was recorded using a high-speed camera over five minutes. A high-intensity LED light board positioned beneath the plate generated two light–dark cycles to assess visual stimulus response. Videos were analyzed using ZebraZoom software to quantify kinematic parameters including swim speed, total distance traveled, freezing duration, and thigmotaxis [28].

2.4. Histological Examination

Following the 7-day exposure period, zebrafish were anesthetized with 0.1% MS-222 and euthanized in ice water. The specimens were rinsed with pre-cooled PBS, dried with filter paper, and fixed overnight in 4% paraformaldehyde (PFA). Fixed tissues were embedded in paraffin, sectioned at 5 μm thickness using a freezing microtome (−20 °C), and stained with hematoxylin–eosin (H&E) for microscopic examination. Histological sections were examined and imaged using a Nikon Eclipse Ni-U upright brightfield microscope (Nikon Corporation, Tokyo, Japan).

2.5. Sample Preparation for Metabolomics Analysis

Brain tissues were extracted using a methanol/water mixture (4:1, v/v) at a ratio of 150 μL per 10 mg tissue. Samples were homogenized at 4 °C (70 Hz, three 20 s cycles with 5 s intervals) and incubated at −20 °C for protein precipitation. Following centrifugation (16,000× g, 4 °C, 15 min), the supernatants were vacuum-concentrated to dryness and stored overnight at −80 °C. Dried residues were reconstituted in 150 μL methanol/water (1:1) and recentrifuged before UHPLC-MS analysis.

2.6. LC-MS Analysis

Metabolomic profiling was performed using an SCIEX Exion LC UHPLC system coupled with a Phenomenex Kinetex C18 column (100 × 2.1 mm, 2.6 μm) at 40 °C. Mobile phases consisted of 0.1% formic acid in water (A) and acetonitrile (B), delivered at 0.4 mL/min. The gradient program was: 1% B (0–1 min), 1–99% B (1–10 min), 99% B (10–13 min), 99–1% B (13–14 min), and 1% B (14–17 min). Sample injection volume was 10 μL.
Mass spectrometry was performed using ESI in both positive and negative modes. Source parameters included: ion source gases at 55 psi, curtain gas at 35 psi, and source temperature at 550 °C. TOF MS-IDA-MS/MS acquisition parameters included mass ranges of 100–1250 m/z (TOF MS) and 50–1250 m/z (product ions), with accumulation times of 0.10 and 0.05 s/scan, respectively. Information Dependent Acquisition (IDA) parameters included decluttering voltage ± 80 V, a collision energy of 35 eV with a spread of ±15 eV (i.e., 20–50 eV), and dynamic background subtraction. The UltraHPLC-MS chromatograms for metabolomic analysis are provided in Figure S2.

2.7. Data Processing and Analysis

Raw data files were converted to mzML format using ProteoWizard and processed with XCMS for peak alignment and quantification. Metabolite identification was based on accurate mass and MS/MS fragmentation patterns matched against an in-house spectral library. Differential metabolites were selected using VIP > 1.0 from OPLS-DA models and t-test p-values < 0.05. For pathway enrichment analysis, we employed the R package (version 4.5.0) CePa (Centrality-based Pathway Enrichment Analysis), which integrates four pathway databases: KEGG, Reactome, BioCarta, and the Pathway Interaction Database (PID). Specifically, pathway enrichment was performed on genes/proteins that interact with the identified metabolites, using the Reactome database as one of the reference resources within CePa.

2.8. Quantitative Real-Time PCR

Total RNA was extracted from brain tissues using TRIzol reagent and reverse-transcribed using 5 × All-in-One RT MasterMix. Gene expression was analyzed using SYBR Green PCR Master Mix with specific primers (Table 1). The amplification protocol consisted of initial denaturation (95 °C, 30 s) followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Relative gene expression was calculated using the 2−ΔΔCt method, with β-actin as the reference gene.

2.9. Determination of Dopamine Content and Antioxidant Enzyme Activities

The levels of dopamine (DA) and the activities of superoxide dismutase (SOD) and catalase (CAT) were measured using commercial assay kits (Beyotime Biotechnology, Shanghai, China). All measurements were performed according to the manufacturer’s instructions.

2.10. Statistical Analysis

The data are presented as mean ± standard deviation (SD) and were analyzed using GraphPad Prism software version 10.0 (GraphPad Software, Boston, MA, USA). Statistical significance was assessed using one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison test (p < 0.05).

3. Results

3.1. Histopathological Alterations in Zebrafish Brain Following Acute TBT Exposure

A consistent coronal section of the zebrafish brain was selected to assess TBT-induced histopathological alterations (Figure 1A). Quantitative histopathological examination of zebrafish brain tissues after 7-day exposure to tributyltin (TBT) revealed clear concentration-dependent structural alterations. In the control group (CK) and at the lowest exposure concentration (20 ng/L TBT), brain tissues exhibited well-preserved architecture with normal neuronal density and minimal vacuolation. At 100 ng/L TBT, distinct cellular changes became evident, including nuclear swelling and reduced cellular density, along with moderate tissue vacuolation, suggesting early disruption of neuronal integrity. The most severe histopathological effects were observed at 500 ng/L TBT, where extensive tissue damage was characterized by prominent vacuolation and marked reduction in neuronal density, indicating significant tissue atrophy. These quantitative findings demonstrate a progressive, dose-dependent neurotoxic effect of TBT on zebrafish brain morphology, with increasing structural degeneration at higher exposure concentrations.

3.2. TBT Exposure Impairs Motor Function and Photomotor Response in Zebrafish

Kinematic analysis revealed that TBT exposure exerted time- and concentration-dependent effects on zebrafish locomotor behavior. After 3 days of exposure (Figure 2A), only the 500 ng/L TBT group exhibited a significant reduction in bout speed compared to the control group (CK). However, after 7 days of exposure (Figure 2B), the effects became more pronounced, with the 500 ng/L TBT group showing significant decreases across all measured kinematic parameters: bout speed, angular velocity, mean tail beat frequency (TBF), and number of oscillations. In contrast, no significant alterations were observed in the 20 and 100 ng/L treatment groups at either time point.
The impact of TBT on behavioral responses to environmental stimuli was assessed using light–dark transition tests after 7 days of exposure (Figure 3). Control zebrafish demonstrated characteristic photoresponsive behaviors, with significant modulation of bout speed and mean TBF during light–dark transitions. In contrast, zebrafish exposed to TBT (at concentrations of 20, 100, and 500 ng/L) showed impaired responsiveness, exhibiting no significant changes in any kinematic parameters during light–dark transitions. This loss of normal photoresponsive behavior suggests that TBT exposure compromises both motor function and sensory processing capabilities in zebrafish.

3.3. Metabolomic Analysis Reveals Non-Monotonic, Dose-Dependent Metabolic Perturbations and Pathway Disruptions Induced by TBT Exposure

Orthogonal Partial Least Squares Discriminant Analysis (OPLS-DA) was employed to evaluate the global metabolic alterations induced by tributyltin (TBT) exposure (Figure 4). The score plots revealed consistent separation patterns across both positive ionization mode (Figure 4A) and negative ionization mode (Figure 4B). Notably, the metabolic perturbations exhibited a non-monotonic dose-dependent response. At low doses (20 ng/L), samples showed significant deviation from the control group along the secondary component (PC2), while high-dose exposure (500 ng/L) resulted in distinct separation along the primary component (PC1). In contrast, the medium-dose group (100 ng/L) remained closest to the control group. In positive ion mode, the first principal component (PC1) explained 36% of the total variance, representing major metabolic alterations associated with TBT exposure, while the second principal component (PC2) accounted for 10% of the variance, indicating more subtle metabolic changes. Similarly, in negative ion mode, PC1 explained 35% of the total variance, with PC2 accounting for 10% of the variance. At low doses (20 ng/L), samples showed significant deviation from the control group along PC2, indicating subtle but distinct metabolic changes. High-dose exposure (500 ng/L) resulted in distinct separation along PC1, suggesting major metabolic perturbations in pathways central to brain function. In contrast, the medium-dose group (100 ng/L) remained closest to the control group, indicating less pronounced metabolic alterations at this concentration. This nonlinear pattern of metabolic response aligns with the theoretical framework of hormesis, suggesting that TBT may induce adaptive metabolic adjustments at low doses but trigger systemic toxicity at high doses. However, whether these low-dose effects are physiologically beneficial requires further validation through functional phenotypic indicators.
Pathway impact analysis (Figure 4C) and Metabolite Set Enrichment Analysis (MSEA, Figure 4D) collectively highlighted significant disruptions in core metabolic networks. Key pathways, including the citrate cycle (TCA cycle), urea cycle, ammonia recycling, and arginine biosynthesis, demonstrated substantial impairment, indicating widespread disturbances in energy metabolism and nitrogen handling. The TCA cycle emerged as a particularly critical target, exhibiting both high impact scores and extreme statistical significance, underscoring its central role in TBT-induced metabolic toxicity.
Further analysis revealed enrichment in additional metabolic pathways, such as glycine and serine metabolism, glutamate metabolism, and purine metabolism (p < 0.05), indicating widespread disturbances in amino acid synthesis, neurotransmission, and nucleotide synthesis. The concurrent activation of the Warburg effect provided additional evidence for a shift toward glycolytic metabolism, a characteristic adaptation to cellular stress. These findings collectively underscore TBT’s multifaceted interference with fundamental metabolic processes, potentially contributing to oxidative stress, energy depletion, and cellular dysfunction. The convergence of impacted pathways across multiple analytical methods strengthens the validity of these conclusions, providing a robust mechanistic framework for understanding TBT’s toxicological effects.

3.4. Reactome Pathway Analysis Reveals Comprehensive Disruption of Neurotransmitter Systems and Associated Gene Networks Following TBT Exposure

Analysis of the Reactome database revealed significant alterations in multiple neurotransmitter-related pathways and their associated key genes following tributyltin (TBT) exposure. The affected systems encompassed critical neurological processes, including the synaptic vesicle cycle and neurotransmitter release cycles for norepinephrine, glutamate, dopamine, and serotonin (Figure 5). These findings highlight the broad impact of TBT on neurotransmitter signaling pathways.
To validate these pathway-level perturbations, we conducted quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of key pathway-associated genes (Figure 6). The results demonstrated a consistent dose-dependent reduction in mRNA expression levels across multiple targets, with the most pronounced effects observed at 500 ng/L TBT. Specifically, significant downregulation was observed in genes encoding proteins crucial for neurotransmitter synthesis and metabolism (e.g., GLS, GLS2, GAD1, GAD2, ABAT, ALDH5A1, CHAT), neurotransmitter transport and uptake (e.g., SLC1A2, SLC1A6, SLC1A7, SLC22A2, SLC18A2), synaptic organization and transmission (e.g., LIN7A, LIN7B, VAMP2, SNAP25), and vesicular trafficking and release (e.g., TSPOAP1, CLTA). The consistent downregulation of these diverse yet functionally related genes provides strong molecular evidence supporting the pathway-level perturbations identified through Reactome analysis, suggesting comprehensive disruption of neurotransmitter systems following TBT exposure.

3.5. Metabolomic Profiling Reveals TBT-Induced Disruption of Key Metabolic Pathways and Molecular Networks

Liquid chromatography–mass spectrometry (LC-MS) analysis identified 57 significantly altered metabolites in response to tributyltin (TBT) exposure. Pathway analysis based on the Small Molecule Pathway Database (SMPDB) classification revealed that these metabolites are primarily involved in multiple key metabolic processes. The affected pathways include energy metabolism (Glycolysis, TCA cycle, and Branched-Chain Amino Acid (BCAA) Metabolism), neurotransmitter metabolism (Tryptophan/Serotonin/Melatonin Metabolism), nucleotide metabolism (Pyrimidine and Purine Metabolism), and other essential pathways such as the Urea Cycle and Phospholipid Metabolism/Methylation (Figure 7). These findings highlight the broad impact of TBT on diverse metabolic networks.
Network analysis further illustrated the intricate relationships between these metabolites and their associated key genes/enzymes, providing insights into potential molecular targets of TBT (Figure 8). This visualization reveals the complex molecular interactions potentially disrupted by TBT exposure, emphasizing the interconnected nature of metabolic perturbations.

3.6. TBT Exposure Induces Region-Specific Dopamine Depletion and Oxidative Stress

TBT exposure resulted in region-specific reductions in dopamine levels across different brain regions (Figure 9A). The most severe impact was observed in the forebrain, where 500 ng/L TBT caused approximately 70% reduction in dopamine content compared to controls (p < 0.001). The midbrain and hindbrain regions showed moderate but significant decreases, with dopamine levels declining by approximately 50% and 30%, respectively, at the highest TBT concentration (p < 0.01). This differential sensitivity suggests region-specific vulnerability to TBT-induced neurotoxicity. To elucidate the molecular mechanism underlying dopamine depletion, we examined tyrosine hydroxylase (TH) expression, the rate-limiting enzyme in dopamine synthesis. TBT exposure significantly decreased TH mRNA levels in a dose-dependent manner, with the most pronounced reduction observed at 500 ng/L. These findings indicate that TBT-induced dopamine depletion is primarily mediated through the suppression of dopamine synthesis pathway.
The experimental results demonstrate that TBT exposure significantly affects oxidative stress parameters in a dose-dependent manner (Figure 9B). ROS levels showed progressive increases with rising TBT concentrations, reaching approximately 130%, 200%, and 350% of control levels at 20, 100, and 500 ng/L TBT, respectively (p < 0.001). Concurrently, antioxidant enzyme activities were significantly suppressed. SOD activity decreased from 16 U/mg protein in controls to approximately 7 U/mg protein at 500 ng/L TBT exposure (p < 0.001). Similarly, catalase activity showed a dose-dependent reduction from 30 U/mg protein to 15 U/mg protein. The mRNA expression levels of both SOD2 and CAT genes also exhibited significant downregulation, particularly at higher TBT concentrations (p < 0.01). These findings collectively indicate that TBT-induced oxidative stress results from both enhanced ROS production and impaired antioxidant defense mechanisms.

4. Discussion

While the historical use of TBT as an antifouling agent and biocide in marine applications has been banned due to environmental toxicity concerns, its bioaccumulative properties and slow degradation rate continue to pose significant threats to marine ecosystems [29,30]. Previous research has primarily focused on developmental and reproductive toxicity, leaving gaps in our understanding of TBT’s behavioral effects on adult zebrafish and its underlying neurotoxic mechanisms [31,32]. The present study establishes a comprehensive mechanistic framework for tributyltin (TBT)-induced neurotoxicity in zebrafish, demonstrating that this environmental contaminant triggers a hierarchical cascade of molecular disruptions that converge to compromise neuronal integrity and cognitive function. Through the comprehensive integration of metabolomics analysis, transcriptional profiling, and behavioral assays, we demonstrate that TBT exposure triggers an initial mitochondrial crisis, which subsequently cascades through multiple cellular systems. This perturbation systematically affects antioxidant defense mechanisms, neurotransmitter signaling pathways, and nucleotide metabolism in a precise dose-dependent manner. Critically, these molecular alterations manifest in measurable functional consequences for neuronal physiology and behavior, providing a direct link between biochemical perturbations and organismal neurotoxicity.

4.1. TBT Exposure Disrupts Neural Function Through Concurrent Metabolic and Neurotransmitter System Perturbations

This investigation provides compelling evidence for the acute neurotoxic effects of TBT exposure in zebrafish, revealing a complex interplay between structural damage, behavioral alterations, and metabolic disruption. Our findings demonstrate a clear concentration-dependent progression of adverse effects, with particularly significant impacts observed at 100 and 500 ng/L TBT exposure levels.
The histopathological analysis revealed progressive structural deterioration in brain tissue, transitioning from normal architecture in control and low-dose (20 ng/L) groups to severe tissue damage characterized by nuclear swelling, reduced cell density, and prominent vacuolation at higher concentrations. These structural alterations correlate strongly with the observed behavioral deficits, particularly the impaired motor function and diminished photomotor response. The parallel decline in both tissue integrity and behavioral performance suggests that TBT crosses the blood–brain barrier, directly compromising neural circuit function critical for motor coordination and sensory processing [33].
Our metabolomic analysis revealed a compelling non-monotonic dose–response pattern through OPLS-DA results. The observed pattern demonstrated unique metabolic shifts at low doses that were distinct from both control and high-dose groups, consistent with hormetic response mechanisms. The comprehensive pathway analysis highlighted significant perturbations in core metabolic networks, with the TCA cycle emerging as a central target of TBT-induced toxicity. The observed alterations in citrate and fumarate levels, coupled with disruptions in amino acid metabolism, particularly in the alanine, aspartate, and glutamate pathways, suggest a fundamental disruption of cellular energy metabolism.
The Reactome pathway analysis and subsequent gene expression validation provides strong molecular evidence for TBT’s comprehensive impact on neurotransmitter systems. The consistent downregulation of genes involved in neurotransmitter synthesis, transport, and synaptic transmission (including GLS, GAD1, SLC1A2, VAMP2, and SNAP25) suggests a broad mechanism of neurotoxicity that extends beyond simple structural damage. This systematic disruption of neurotransmitter pathways likely contributes to the observed behavioral deficits, particularly the impaired response to light–dark transitions.
The integration of metabolomic profiling with pathway analysis identified 57 significantly altered metabolites involved in biochemical pathways, primarily affecting energy metabolism, neurotransmitter synthesis, and nucleotide metabolism. Among these pathway-associated changes, the alterations in tryptophan/serotonin/melatonin metabolism were particularly noteworthy, as they may explain the disrupted photomotor response, given these neurotransmitters’ essential roles in circadian regulation and light responsiveness [34].
These findings collectively suggest that TBT’s neurotoxic effects operate through multiple, interconnected mechanisms: direct structural damage to neural tissue, disruption of cellular energy metabolism, and comprehensive perturbation of neurotransmitter systems. The correlation between molecular, cellular, and behavioral alterations provides a robust framework for understanding TBT’s neurotoxic effects and highlights potential therapeutic targets for mitigating its impact on neural function.

4.2. TBT-Induced Disruption of Mitochondrial Energy Metabolism

Our metabolomic analysis demonstrates that TBT exposure fundamentally disrupts cellular energy metabolism, primarily through inhibition of the tricarboxylic acid (TCA) cycle. High-dose exposure led to severe depletion of key TCA intermediates, including succinic acid, 2-oxoglutarate, fumaric acid, and cis-aconitic acid, while simultaneously triggering accumulation of citric acid and pyruvate. This distinct metabolic signature indicates multiple blockades in aerobic respiration [35], directly attributed to the depletion of lipoic acid and dihydrolipoic acid—essential cofactors for both pyruvate dehydrogenase complex (PDHC) and α-ketoglutarate dehydrogenase complex (α-KGDHC) [36].
The dual enzymatic inhibition creates a cascade effect: PDHC dysfunction impairs the critical entry point of glycolytic products into the TCA cycle, while α-KGDHC inhibition establishes a secondary blockade within the cycle itself. The behavioral manifestations of this mitochondrial dysfunction were evident in reduced swimming velocity and anxiety-like behaviors, consistent with compromised neuronal function resulting from ATP depletion.
Evidence of global metabolic suppression includes significant decreases in glycolytic intermediates, such as glucose-1-phosphate and fructose-6-phosphate, severely constraining the brain’s ability to meet acute energy demands during neural activation [37]. Despite pyruvate accumulation, lactate levels showed marked reduction, likely due to insufficient NADH availability for lactate dehydrogenase activity [38]. The metabolic crisis is further exacerbated by reduced (R)-carnitine levels, indicating impaired fatty acid β-oxidation [39]. The unexpected decrease in creatine levels, despite its vital role in rapid ATP regeneration, suggests severe cellular damage leading to creatine pool depletion, aligning with observed pathological cell loss [40].
Notably, low-dose TBT exposure induced elevation of specific TCA intermediates (succinic acid, citric acid, and malate—the latter being essential for the malate–aspartate shuttle facilitating cytoplasmic NADH transport to mitochondria), indicating an initial hormetic response [40]. However, this adaptive mechanism becomes overwhelmed at environmentally relevant higher concentrations, establishing a clear threshold for metabolic decompensation that manifests behaviorally as a transition from subtle hyperactivity at low doses to profound lethargy at high doses.

4.3. TBT Exposure Induces Oxidative Stress

TBT exposure triggers severe oxidative stress through dual mechanisms: enhanced ROS production and compromised antioxidant defenses. Our results demonstrate dose-dependent ROS elevation accompanied by systematic suppression of key antioxidant enzymes (SOD and CAT), suggesting a comprehensive disruption of cellular redox homeostasis. This is further evidenced by significant elevation of 2-hydroxybutyric acid, a validated biomarker of glutathione depletion and redox imbalance [41]. Glutathione, serving as the primary cellular antioxidant, is essential for free radical scavenging and redox homeostasis maintenance, becoming rapidly depleted during oxidative stress as it neutralizes reactive oxygen species (ROS) [42].
This critical disruption is further corroborated by the depletion of glutathione synthesis precursors, including 5-oxo-L-proline and pyroglutamic acid, accompanied by dose-dependent reduction in endogenous antioxidants such as melatonin and hypotaurine [43]. Melatonin exhibits multifaceted antioxidant properties through several mechanisms: direct neutralization of hydroxyl radicals (·OH) and peroxynitrite (ONOO−), upregulation of antioxidant enzymes including superoxide dismutase (SOD) and glutathione peroxidase (GPx) via NRF2 pathway activation, and maintenance of mitochondrial electron transport chain stability to minimize electron leakage during oxidative phosphorylation [44].
Hypotaurine, as a precursor to taurine, functions as both an essential osmolyte and antioxidant. It effectively neutralizes hypochlorous acid (HOCl) generated by myeloperoxidase (MPO), thereby protecting proteins from halogenation damage and inhibiting lipid peroxidation cascades, particularly in cellular membranes [45]. The comprehensive disruption of these cellular antioxidant systems may contribute to TBT’s genotoxic potential.
These findings collectively demonstrate that TBT initiates a self-perpetuating cycle where mitochondrial damage generates reactive oxygen species, which in turn further compromise mitochondrial integrity while simultaneously depleting cellular antioxidant defense mechanisms.

4.4. TBT-Induced Disruption of Purine Metabolism

Expanding upon our findings of TBT-induced energy dysfunction and oxidative stress, our analysis of purine metabolism reveals critical mechanisms underlying TBT neurotoxicity. The observed metabolic alterations demonstrate high-dose TBT exposure (500 ng/L) triggered a systemic collapse of purine metabolism, characterized by significant reductions in hypoxanthine, adenine, adenosine, and guanine, accompanied by abnormal xanthine elevation. This pattern reveals a “dual blockade” mechanism, where both de novo purine synthesis and degradation pathways are simultaneously compromised, directly connecting to the previously observed energy crisis [46].
The mechanistic implications of these alterations are multifaceted and interlinked with earlier findings. The concurrent decrease in adenine, guanine, and adenosine directly compromises ATP/GTP synthesis precursor availability [47,48]. This depletion, combined with the previously documented energy dysfunction, precipitates a severe energy crisis that impairs Na+/K+-ATPase activity, ultimately leading to membrane potential collapse and neural signal disruption [49]. Moreover, cyclic AMP (cAMP) exhibits a biphasic response—increasing at low doses but decreasing at high doses—reflecting TBT’s staged impact on synaptic plasticity: low doses may initiate transient neuroprotection through stress-induced activation of the PKA-CREB pathway, while high doses impair long-term memory formation through adenylate cyclase inhibition [50].
Xanthine metabolism alterations particularly illuminate the connection between purine disruption and oxidative stress. Medium-dose TBT exposure elevated 9H-xanthine levels, while high-dose exposure significantly increased classical xanthine levels alongside decreased hypoxanthine. This pattern indicates abnormal xanthine oxidase (XO) activation, creating a “free radical self-destruction cycle” that amplifies the previously documented oxidative stress [51]. The decreased nicotinamide levels further link purine metabolism disruption to broader cellular dysfunction. Reduced NAD+ synthesis precursor availability results in NAD+ depletion, SIRT1 deacetylase inactivation, and suppressed mitochondrial unfolded protein response, establishing a mechanistic connection between energy metabolism disruption and cellular damage pathways [52].

4.5. TBT-Induced Disruption of Pyrimidine Metabolism

The disruption of pyrimidine metabolism not only mirrors the purine metabolic collapse but also reveals distinct mechanisms connecting our previous findings on energy metabolism, oxidative stress, and cellular damage. High-dose TBT exposure induced significant reductions in 3-aminoisobutyric acid, uracil, 5,6-dihydrouracil, and thymidine, indicating a “dual blockade” mechanism that affects both DNA/RNA synthesis and repair pathways.
The pyrimidine metabolism alterations present multiple interconnected implications for cellular function. The concurrent decrease in nucleic acid precursors directly compromises neuronal gene expression and protein synthesis, particularly affecting synaptic plasticity-related proteins, establishing a direct link between metabolic disruption and the previously observed behavioral changes [46]. The biphasic response in (R)-pantothenic acid metabolism reveals a crucial connection to cholinergic neurotransmission and energy metabolism, where initial elevation at low doses is followed by significant reduction at high doses, paralleling the hormetic responses observed in both TCA cycle intermediates and purine metabolism [53]. Furthermore, the disruption of the pantothenic acid-CoA-acetylcholine axis provides a molecular basis for the observed behavioral phenotypes while establishing a connection to broader cellular energy metabolism through acetyl-CoA availability [53].

4.6. Molecular Mechanisms Underlying TBT-Induced Neurotoxicity: Neurotransmitter Dysregulation and Synaptic Integrity Loss

The most significant advancement of this study is the direct molecular linkage between TBT-induced metabolite changes and transcriptional disruption of synaptic machinery, providing causal evidence for neurochemical imbalances that manifest in measurable functional consequences. Furthermore, alterations in metabolites associated with neurotransmitter transport systems are closely intertwined with disturbances in energy metabolism and oxidative stress, highlighting a TBT-triggered, metabolite-driven cascade of pathological events.
Glutamate, serving as the brain’s primary excitatory neurotransmitter, is present in 80–90% of synapses. It plays a crucial role in learning and memory mechanisms through its involvement in synaptic plasticity, particularly long-term potentiation (LTP). Its influence extends broadly across nearly all brain functions, from sensory processing and motor control to cognition and emotional regulation [54]. The observed biphasic response of L-glutamic acid can be mechanistically attributed to two concurrent processes. First, there is a downregulation of GLS and GLS2, genes that encode critical isoforms of glutaminase—the key enzyme catalyzing the conversion of glutamine to glutamate [55]. Their downregulation directly compromises the capacity to synthesize glutamate from its glutamine precursor. Second, there is suppression of astrocytic transporters SLC1A2, SLC1A6, and SLC1A7. These transporters encode Excitatory Amino Acid Transporters (EAATs), membrane proteins responsible for clearing extracellular glutamate, particularly in synaptic clefts, to prevent excitotoxicity [56]. SLC1A7 (EAAT5), predominantly found in retinal neurons, also contributes to glutamate clearance, with its disruption potentially explaining the observed alterations in zebrafish light–dark transition responses [57]. This complex transcriptional profile creates a dual pathological state. Initial low-dose exposure leads to glutamate elevation, increasing the risk of excitotoxicity, while high-dose exposure results in glutamate depletion, disrupting normal neurotransmission. The concurrent reduction in L-glutamine levels in high-dose groups confirms the breakdown of the glutamate–glutamine cycle. In this cycle, glutamine, synthesized in astrocytes and supplied to neurons as a glutamate precursor, fails to maintain proper neurotransmitter homeostasis [58]. This disruption of the glutamate–glutamine cycle represents a critical mechanism underlying TBT-induced neurotoxicity.
The profound suppression of GAD1 and GAD2 genes provides a direct mechanistic explanation for the disrupted GABA-glutamate balance observed in TBT exposure. These genes encode glutamate decarboxylase (GAD), the sole rate-limiting enzyme responsible for GABA (γ-aminobutyric acid) synthesis through the decarboxylation of glutamate [59]. The critical role of GAD in maintaining neurotransmitter homeostasis cannot be overstated, as it represents the primary pathway for GABA production in the central nervous system. GABA functions as the central inhibitory switch in the nervous system, operating through dual mechanisms: rapid signaling via GABAA receptors and slower modulation through GABAB receptors, collectively maintaining neural network stability. Its actions are crucial for inhibiting neuronal excitability, regulating motor function, emotional states, and sleep patterns, while providing essential protection against excessive neuronal excitation [60]. The suppression of GAD manifests functionally as a significant reduction in GABA-mediated inhibitory postsynaptic currents and a consequent increase in the excitation/inhibition ratio, a characteristic indicator of neural circuit hyperexcitability. The disruption of this crucial inhibitory mechanism represents a significant pathway through which TBT exposure may induce neurological dysfunction.
TBT exposure induced region-specific alterations in dopamine levels, with the most pronounced effects observed in the forebrain. At 500 ng/L TBT exposure, dopamine content decreased by approximately 70% in the forebrain (p < 0.001), while midbrain and hindbrain showed moderate reductions of 50% and 30% respectively (p < 0.01), indicating differential regional vulnerability to TBT-induced neurotoxicity [61]. Given dopamine’s crucial role in reward processing, motor control, and stress response, this region-specific pattern of dopamine depletion suggests potential behavioral and physiological implications. The mechanistic basis for dopamine depletion appears to involve multiple pathways. First, TBT exposure significantly suppressed TH expression, the rate-limiting enzyme in dopamine synthesis, with the most pronounced reduction in TH mRNA levels observed at 500 ng/L. Additionally, the observed reduction in dopamine levels under high-dose TBT exposure can be directly attributed to the suppression of two critical transport proteins: SLC18A2 (VMAT2) and SLC22A2 (OCT2). These affected transporters serve distinct but complementary functions in maintaining proper monoamine neurotransmitter homeostasis. SLC22A2 functions as an organic cation transporter, while SLC18A2 operates as a vesicular monoamine transporter, both being crucial for the proper reuptake and vesicular packaging of various neurotransmitters, including dopamine, serotonin, norepinephrine, and histamine in the brain [62,63]. The concurrent downregulation of these transport systems creates a compound effect that extends beyond disrupted dopamine signaling. Their impairment amplifies the impact of reduced neurotransmitter levels through compromised reuptake and vesicular storage mechanisms, potentially affecting multiple neurotransmitter systems simultaneously.
The elevation of 5-HIAA levels under high-dose TBT exposure indicates enhanced serotonin turnover, which aligns with the observed downregulation of SLC6A4. 5-HIAA, as the primary metabolic end-product of serotonin (5-HT), serves as a direct indicator of accelerated serotonin metabolism [64]. The SLC6A4 gene encodes the serotonin transporter (SERT), which is localized to the presynaptic neuronal membrane and is responsible for the reuptake of 5-HT from the synaptic cleft, thereby terminating serotonergic neurotransmission [65]. These findings suggest that under high-dose TBT stress, reduced SERT expression leads to synaptic 5-HT accumulation, triggering a compensatory acceleration of serotonin synthesis and metabolism (increased turnover), ultimately resulting in elevated excretion of the metabolite 5-HIAA. This dysregulation may have serious consequences, potentially leading to excessive activation of 5-HT receptors and subsequent neuronal excitotoxicity, mitochondrial dysfunction, and oxidative stress—conditions commonly associated with anxiety, mania, and epileptic disorders [66].
Our analysis revealed a critical transcriptional collapse of the core vesicle release machinery, characterized by significant downregulation of key synaptic components. Most notably affected were SNARE complex proteins (VAMP2, SNAP25), vesicle priming factors (TSPOAP1, CLTA), and postsynaptic scaffolding molecules (LIN7A, LIN7B). These components form an intricate molecular network essential for synaptic function and neuronal connectivity. At the presynaptic terminal, VAMP2 and SNAP25 serve as fundamental components of the SNARE complex, orchestrating precise neurotransmitter release. VAMP2, a vesicle-SNARE protein localized to synaptic vesicles, works in concert with SNAP25, a target-SNARE protein, to form the core complex required for calcium-dependent synaptic vesicle fusion [67]. This molecular machinery ensures rapid and efficient neurotransmitter release. Supporting these core components, TSPOAP1 facilitates vesicle priming through its interaction with the TSSK6 kinase pathway and regulation of presynaptic protein networks, while CLTA maintains vesicle pool homeostasis through clathrin-mediated endocytosis [68,69]. The postsynaptic compartment shows parallel disruption through downregulation of LIN7A and LIN7B scaffolding proteins [70]. Their diminished expression likely compromises synaptic stability and plasticity, directly impacting signal transduction efficiency. These synaptic defects directly explain the observed kinematic impairments, as coordinated swimming behavior and appropriate responses to light–dark transitions require precise temporal and spatial integration of multiple neural circuits that depend on intact synaptic transmission and plasticity.
Despite the observed collapse of neurotransmitter systems under high-dose TBT exposure, our study revealed an intriguing consistent upregulation of N-acetylneuraminic acid (Neu5Ac) across all treatment doses. As the most prevalent form of sialic acid, Neu5Ac plays crucial roles in cell surface recognition, immune modulation, and inflammatory responses through its incorporation into glycoproteins and glycolipids [71]. This upregulation suggests a conserved neuroprotective response involving sialic acid-mediated membrane stabilization, reminiscent of compensatory mechanisms observed in early-stage neurodegenerative conditions. However, this protective response ultimately proves insufficient against high-dose TBT exposure, underscoring the overwhelming nature of the oxidative stress burden. This inadequacy is particularly evidenced by the reduction in N-acetylaspartate (NAA) levels. NAA, which stands as the second most abundant amino acid derivative in the central nervous system after glutamate, serves as a critical marker of neuronal health [72]. Its diverse functions influence energy metabolism, myelin synthesis, osmotic regulation, and neuroprotection. The concurrent observation of elevated Neu5Ac and depleted NAA presents a compelling picture of the neural system’s attempt at self-preservation against TBT-induced toxicity. While the increase in Neu5Ac represents an active defensive response, the decline in NAA levels indicates that this protective mechanism ultimately fails to prevent neuronal compromise under severe toxic stress.

5. Conclusions

Our comprehensive investigation reveals that TBT-induced neurotoxicity operates through a complex, interconnected cascade of cellular disruptions. The primary mechanism involves energy metabolism disruption, which triggers widespread oxidative stress and antioxidant depletion. This initial perturbation cascades into comprehensive disruption of purine and pyrimidine metabolism, ultimately compromising cellular repair mechanisms and energy availability. The subsequent impact on neurotransmitter systems and synaptic machinery creates a self-amplifying cycle of neural dysfunction, manifesting in observable behavioral deficits. While low-dose exposure triggers certain adaptive responses, including Neu5Ac upregulation, these protective mechanisms prove insufficient against environmentally relevant higher concentrations. These findings not only advance our understanding of TBT’s neurotoxic mechanisms but also highlight potential therapeutic targets for mitigating its impact on neural function. Furthermore, this study underscores the persistent threat of legacy environmental contaminants and the need for continued vigilance in environmental monitoring and protection.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/metabo16020105/s1, Figure S1. Representative extracted ion chromatograms (XIC) analysis of TBT concentrations in exposure water; Figure S2. Representative UltraHPLC-MS total ion chromatograms (TIC) from zebrafish brain metabolomic analysis. (A) Negative ionization mode; (B) Positive ionization mode.

Author Contributions

Conceptualization, Q.Z. and J.W.; methodology, Q.Z. and J.W.; software, N.H.; investigation, Q.Z., L.L., C.W., R.G. and D.X.; data curation, C.W. and R.G.; writing—original draft preparation, Q.Z.; writing—review and editing, J.W.; visualization, Q.Z., N.H., L.L. and D.X.; supervision, J.W.; funding acquisition, J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

All procedures were approved by the Animal Ethics Committee of Nanjing University of Science & Technology (Ethics Approval ID number: ACUC-NUST-20240071, 1 July 2024), and carried out in accordance with the National Institutes of Health Guidelines for Animal Research.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript: TBT: tributyltin; LC-MS: liquid chromatography-mass spectrometry; GC-MS: gas chromatography-mass spectrometry; NMR: nuclear magnetic resonance; OECD: Organisation for Economic Co-operation and Development; TCA: tricarboxylic acid; GABA: gamma-aminobutyric acid; H&E: hematoxylin-eosin; OPLS-DA: Orthogonal Partial Least Squares Discriminant Analysis; SMPDB: Small Molecule Pathway Database; MSEA: Metabolite Set Enrichment Analysis; IDA: Information Dependent Acquisition; BCAA: Branched-Chain Amino Acid; qRT-PCR: quantitative reverse transcription polymerase chain reaction; EAATs: Excitatory Amino Acid Transporters; LTP: long-term potentiation; PKA: protein kinase A; CREB: cAMP response element-binding protein; XO: xanthine oxidase; SERT: serotonin transporter; Neu5Ac: N-acetylneuraminic acid; NAA: N-acetylaspartate; SNARE: Soluble N-ethylmaleimide-sensitive factor attachment protein receptor; VAMP2: Vesicle-associated membrane protein 2; SNAP25: Synaptosomal-associated protein 25; TSPOAP1: Transmembrane and coiled-coil domains family protein 1; CLTA: Clathrin light chain A; LIN7A: LIn-7 homolog A; LIN7B: LIn-7 homolog B; GLS: glutaminase; GLS2: glutaminase 2; GAD1: glutamate decarboxylase 1; GAD2: glutamate decarboxylase 2; ABAT: 4-aminobutyrate aminotransferase; ALDH5A1: aldehyde dehydrogenase 5 family member A1; CHAT: choline acetyltransferase; SLC1A2: solute carrier family 1 member 2; SLC1A6: solute carrier family 1 member 6; SLC1A7: solute carrier family 1 member 7; SLC22A2: solute carrier family 22 member 2; SLC18A2: solute carrier family 18 member 2; 5-HIAA: 5-hydroxyindoleacetic acid; ROS: reactive oxygen species; PDHC: pyruvate dehydrogenase complex; α-KGDHC: α-ketoglutarate dehydrogenase complex; cAMP: cyclic adenosine monophosphate; ATP: adenosine triphosphate; GTP: guanosine triphosphate; NAD+: nicotinamide adenine dinucleotide; SIRT1: sirtuin 1; 5-HT: 5-hydroxytryptamine; 2-OG: 2-oxoglutarate; MPO: myeloperoxidase; HOCl: hypochlorous acid;·OH: hydroxyl radicals; ONOO−: peroxynitrite; SOD: superoxide dismutase; GPx: glutathione peroxidase; NRF2: nuclear factor erythroid 2-related factor 2; VMAT2: vesicular monoamine transporter 2; OCT2: organic cation transporter 2; EAAT5: excitatory amino acid transporter 5; TBF: tail beat frequency; CK: control group; QC: quality control; PC1: Principal Component 1; PC2: Principal Component 2; UHPLC-MS: ultra-high performance liquid chromatography-mass spectrometry; MS-222: tricaine methanesulfonate; PFA: paraformaldehyde; DMSO: dimethyl sulfoxide; AB: a zebrafish strain; IMO: International Maritime Organization; TBT-Cl: tributyltin chloride; TOF MS: time-of-flight mass spectrometry; LC-MS/MS: liquid chromatography-tandem mass spectrometry; UPLC: ultra performance liquid chromatography; UHPLC: ultra-high performance liquid chromatography.

References

  1. Antizar-Ladislao, B. Environmental levels, toxicity and human exposure to tributyltin (TBT)-contaminated marine environment. A review. Environ. Int. 2008, 34, 292–308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Beyer, J.; Song, Y.; Tollefsen, K.E.; Berge, J.A.; Tveiten, L.; Helland, A.; Øxnevad, S.; Schøyen, M. The ecotoxicology of marine tributyltin (TBT) hotspots: A review. Mar. Environ. Res. 2022, 179, 105689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Champ, M.A. Economic and environmental impacts on ports and harbors from the convention to ban harmful marine anti-fouling systems. Mar. Pollut. Bull. 2003, 46, 935–940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Liu, Z.-H.; Li, Y.-W.; Hu, W.; Chen, Q.-L.; Shen, Y.-J. Mechanisms involved in tributyltin-enhanced aggressive behaviors and fear responses in male zebrafish. Aquat. Toxicol. 2020, 220, 105408. [Google Scholar] [CrossRef] [Scilit]
  5. Tang, L.; Liu, Y.-L.; Qin, G.; Lin, Q.; Zhang, Y.-H. Effects of tributyltin on gonad and brood pouch development of male pregnant lined seahorse (Hippocampus erectus) at environmentally relevant concentrations. J. Hazard. Mater. 2021, 408, 124854. [Google Scholar] [CrossRef] [Scilit]
  6. Mortensen, A.S.; Arukwe, A. Modulation of xenobiotic biotransformation system and hormonal responses in Atlantic salmon (Salmo salar) after exposure to tributyltin (TBT). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2007, 145, 431–441. [Google Scholar] [CrossRef] [Scilit]
  7. Thain, J.E.; Waldock, M.J. The Impact of Tributyl Tin (TBT) Antifouling Paints on Molluscan Fisheries. Water Sci. Technol. 1986, 18, 193–202. [Google Scholar] [CrossRef] [Scilit]
  8. Nakayama, K.; Oshima, Y.; Yamaguchi, T.; Tsuruda, Y.; Kang, I.J.; Kobayashi, M.; Imada, N.; Honjo, T. Fertilization success and sexual behavior in male medaka, Oryzias latipes, exposed to tributyltin. Chemosphere 2004, 55, 1331–1337. [Google Scholar] [CrossRef] [Scilit]
  9. Zhang, J.; Zuo, Z.; He, C.; Wu, D.; Chen, Y.; Wang, C. Inhibition of thyroidal status related to depression of testicular development in Sebastiscus marmoratus exposed to tributyltin. Aquat. Toxicol. 2009, 94, 62–67. [Google Scholar] [CrossRef] [Scilit]
  10. Li, P.; Li, Z.-H. Environmental co-exposure to TBT and Cd caused neurotoxicity and thyroid endocrine disruption in zebrafish, a three-generation study in a simulated environment. Environ. Pollut. 2020, 259, 113868. [Google Scholar] [CrossRef] [Scilit]
  11. Liang, X.; Souders, C.L.; Zhang, J.; Martyniuk, C.J. Tributyltin induces premature hatching and reduces locomotor activity in zebrafish (Danio rerio) embryos/larvae at environmentally relevant levels. Chemosphere 2017, 189, 498–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Choi, H.C.; Lee, J.W.; Hwang, U.K.; Jeon, H.J.; Oh, S.Y.; Kim, C.W.; Kang, H.S. Effects of Tributyltin-Contaminated Aquatic Environments and Remediated Water on Early Development of Sea Urchin (Hemisentrotus pulcherrimus). Animals 2023, 13, 3078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Shams, S.; Rihel, J.; Ortiz, J.G.; Gerlai, R. The zebrafish as a promising tool for modeling human brain disorders: A review based upon an IBNS Symposium. Neurosci. Biobehav. Rev. 2018, 85, 176–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Fontana, B.D.; Mezzomo, N.J.; Kalueff, A.V.; Rosemberg, D.B. The developing utility of zebrafish models of neurological and neuropsychiatric disorders: A critical review. Exp. Neurol. 2018, 299, 157–171. [Google Scholar] [CrossRef] [Scilit]
  15. Teleanu, R.I.; Niculescu, A.G.; Roza, E.; Vladacenco, O.; Grumezescu, A.M.; Teleanu, D.M. Neurotransmitters-Key Factors in Neurological and Neurodegenerative Disorders of the Central Nervous System. Int. J. Mol. Sci. 2022, 23, 5954. [Google Scholar] [CrossRef] [Scilit]
  16. Dulcis, D.; Jamshidi, P.; Leutgeb, S.; Spitzer, N.C. Neurotransmitter Switching in the Adult Brain Regulates Behavior. Science 2013, 340, 449–453. [Google Scholar] [CrossRef] [Scilit]
  17. Verma, R.; Raj Choudhary, P.; Kumar Nirmal, N.; Syed, F.; Verma, R. Neurotransmitter systems in zebrafish model as a target for neurobehavioural studies. Mater. Today Proc. 2022, 69, 1565–1580. [Google Scholar] [CrossRef] [Scilit]
  18. Kotova, M.M.; Galstyan, D.S.; Kolesnikova, T.O.; de Abreu, M.S.; Amstislavskaya, T.G.; Strekalova, T.; Petersen, E.V.; Yenkoyan, K.B.; Demin, K.A.; Kalueff, A.V. Understanding CNS Effects of Antimicrobial Drugs Using Zebrafish Models. Vet. Sci. 2023, 10, 96. [Google Scholar] [CrossRef] [Scilit]
  19. Brun, N.R.; Panlilio, J.M.; Zhang, K.; Zhao, Y.; Ivashkin, E.; Stegeman, J.J.; Goldstone, J.V. Developmental exposure to non-dioxin-like polychlorinated biphenyls promotes sensory deficits and disrupts dopaminergic and GABAergic signaling in zebrafish. Commun. Biol. 2021, 4, 1129. [Google Scholar] [CrossRef] [Scilit]
  20. Paduraru, E.; Iacob, D.; Rarinca, V.; Plavan, G.; Ureche, D.; Jijie, R.; Nicoara, M. Zebrafish as a Potential Model for Neurodegenerative Diseases: A Focus on Toxic Metals Implications. Int. J. Mol. Sci. 2023, 24, 3428. [Google Scholar] [CrossRef] [Scilit]
  21. Fraga-Corral, M.; Carpena, M.; Garcia-Oliveira, P.; Pereira, A.G.; Prieto, M.A.; Simal-Gandara, J. Analytical Metabolomics and Applications in Health, Environmental and Food Science. Crit. Rev. Anal. Chem. 2020, 52, 712–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Quinones, M.P.; Kaddurah-Daouk, R. Metabolomics tools for identifying biomarkers for neuropsychiatric diseases. Neurobiol. Dis. 2009, 35, 165–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Letertre, M.P.M.; Dervilly, G.; Giraudeau, P. Combined Nuclear Magnetic Resonance Spectroscopy and Mass Spectrometry Approaches for Metabolomics. Anal. Chem. 2021, 93, 500–518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Souza, L.P.D.; Alseekh, S.; Brotman, Y.; Fernie, A.R. Network-based strategies in metabolomics data analysis and interpretation: From molecular networking to biological interpretation. Expert Rev. Proteom. 2020, 17, 243–255. [Google Scholar] [CrossRef] [Scilit]
  25. Kim, H.M.; Kang, J.S. Metabolomic Studies for the Evaluation of Toxicity Induced by Environmental Toxicants on Model Organisms. Metabolites 2021, 11, 485. [Google Scholar] [CrossRef] [Scilit]
  26. Park, M.; Lee, Y.; Khan, A.; Aleta, P.; Cho, Y.; Park, H.; Park, Y.H.; Kim, S. Metabolite tracking to elucidate the effects of environmental pollutants. J. Hazard. Mater. 2019, 376, 112–124. [Google Scholar] [CrossRef] [Scilit]
  27. Li, Y.; Wu, F.; Wu, Q.; Liu, W.; Li, G.; Yao, B.; Xiao, R.; Hu, Y.; Wang, J. A novel open-source raspberry Pi-based behavioral testing in zebrafish. PLoS ONE 2022, 17, e0279550. [Google Scholar] [CrossRef] [Scilit]
  28. Mirat, O.; Sternberg, J.R.; Severi, K.E.; Wyart, C. ZebraZoom: An automated program for high-throughput behavioral analysis and categorization. Front. Neural Circuits 2013, 7, 107. [Google Scholar] [CrossRef] [Scilit]
  29. Omae, I. Organotin antifouling paints and their alternatives. Appl. Organomet. Chem. 2003, 17, 81–105. [Google Scholar] [CrossRef] [Scilit]
  30. Furdek Turk, M.; Ivanić, M.; Dautović, J.; Bačić, N.; Mikac, N. Simultaneous analysis of butyltins and total tin in sediments as a tool for the assessment of tributyltin behaviour, long-term persistence and historical contamination in the coastal environment. Chemosphere 2020, 258, 127307. [Google Scholar] [CrossRef] [Scilit]
  31. Bernardo, R.C.; Connaughton, V.P. Transient developmental exposure to tributyltin reduces optomotor responses in larval zebrafish (Danio rerio). Neurotoxicol. Teratol. 2022, 89, 107055. [Google Scholar] [CrossRef] [Scilit]
  32. Delvadiya, R.S.; Patel, U.D.; Tank, M.R.; Patel, H.B.; Patel, S.S.; Trangadia, B.J. Long-term tributyltin exposure alters behavior, oocyte maturation, and histomorphology of the ovary due to oxidative stress in adult zebrafish. Reprod. Toxicol. 2024, 126, 108600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Mitra, S.; Gera, R.; Siddiqui, W.A.; Khandelwal, S. Tributyltin induces oxidative damage, inflammation and apoptosis via disturbance in blood–brain barrier and metal homeostasis in cerebral cortex of rat brain: An in vivo and in vitro study. Toxicology 2013, 310, 39–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Jiang, P.; Shi, M.; Qin, Y.; Lu, W. The role of tryptophan metabolism in flatfish stress response: Assessments based on physiology of the caudal neurosecretory system (CNSS). Aquaculture 2024, 588, 740939. [Google Scholar] [CrossRef] [Scilit]
  35. Martínez-Reyes, I.; Chandel, N.S. Mitochondrial TCA cycle metabolites control physiology and disease. Nat. Commun. 2020, 11, 102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Ambrus, A.; Tretter, L.; Adam-Vizi, V. Inhibition of the alpha-ketoglutarate dehydrogenase-mediated reactive oxygen species generation by lipoic acid. J. Neurochem. 2009, 109, 222–229. [Google Scholar] [CrossRef] [Scilit]
  37. Morita, T.; El-Kazzaz, W.; Tanaka, Y.; Inada, T.; Aiba, H. Accumulation of Glucose 6-Phosphate or Fructose 6-Phosphate Is Responsible for Destabilization of Glucose Transporter mRNA in Escherichia coli. J. Biol. Chem. 2003, 278, 15608–15614. [Google Scholar] [CrossRef] [Scilit]
  38. Rabinowitz, J.D.; Enerbäck, S. Lactate: The ugly duckling of energy metabolism. Nat. Metab. 2020, 2, 566–571. [Google Scholar] [CrossRef] [Scilit]
  39. Yu, H.K.; Ok, S.-H.; Kim, S.; Sohn, J.-T. Anesthetic management of patients with carnitine deficiency or a defect of the fatty acid β-oxidation pathway: A narrative review. Medicine 2022, 101, e28853. [Google Scholar] [CrossRef] [Scilit]
  40. Chen, H.; Zhang, Y.-H.P.J. Enzymatic regeneration and conservation of ATP: Challenges and opportunities. Crit. Rev. Biotechnol. 2021, 41, 16–33. [Google Scholar] [CrossRef] [Scilit]
  41. Irino, Y.; Toh, R.; Nagao, M.; Mori, T.; Honjo, T.; Shinohara, M.; Tsuda, S.; Nakajima, H.; Satomi-Kobayashi, S.; Shinke, T.; et al. 2-Aminobutyric acid modulates glutathione homeostasis in the myocardium. Sci. Rep. 2016, 6, 36749. [Google Scholar] [CrossRef] [Scilit]
  42. Mailloux, R.J.; McBride, S.L.; Harper, M.-E. Unearthing the secrets of mitochondrial ROS and glutathione in bioenergetics. Trends Biochem. Sci. 2013, 38, 592–602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Kumar, A.; Bachhawat, A.K. Pyroglutamic acid: Throwing light on a lightly studied metabolite. Curr. Sci. 2012, 102, 288–297. [Google Scholar]
  44. Reiter, R.J.; Mayo, J.C.; Tan, D.-X.; Sainz, R.M.; Alatorre-Jimenez, M.; Qin, L. Melatonin as an antioxidant: Under promises but over delivers. J. Pineal Res. 2016, 61, 253–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Schaffer, S.W.; Azuma, J.; Mozaffari, M. Role of antioxidant activity of taurine in diabetesThis article is one of a selection of papers from the NATO Advanced Research Workshop on Translational Knowledge for Heart Health (published in part 1 of a 2-part Special Issue). Can. J. Physiol. Pharmacol. 2009, 87, 91–99. [Google Scholar] [CrossRef] [Scilit]
  46. Moffatt, B.A.; Ashihara, H. Purine and pyrimidine nucleotide synthesis and metabolism. Arab. Book 2002, 1, e0018. [Google Scholar] [CrossRef] [Scilit]
  47. Dunn, J.; Grider, M.H. Physiology, Adenosine Triphosphate; StatPearls Publishing: Treasure Island, FL, USA, 2025. [Google Scholar]
  48. Chworos, A.; Coppel, Y.; Dubey, I.; Pratviel, G.; Meunier, B. Guanine Oxidation: NMR Characterization of a Dehydro-guanidinohydantoin Residue Generated by a 2e-oxidation of d(GpT). J. Am. Chem. Soc. 2001, 123, 5867–5877. [Google Scholar] [CrossRef] [Scilit]
  49. Jorgensen, P.L.; Hakansson, K.O.; Karlish, S.J.D. Structure and Mechanism of Na,K-ATPase: Functional Sites and Their Interactions. Annu. Rev. Physiol. 2003, 65, 817–849. [Google Scholar] [CrossRef] [Scilit]
  50. Zhang, H.; Kong, Q.; Wang, J.; Jiang, Y.; Hua, H. Complex roles of cAMP–PKA–CREB signaling in cancer. Exp. Hematol. Oncol. 2020, 9, 32. [Google Scholar] [CrossRef] [Scilit]
  51. Schmidt, H.M.; Kelley, E.E.; Straub, A.C. The impact of xanthine oxidase (XO) on hemolytic diseases. Redox Biol. 2019, 21, 101072. [Google Scholar] [CrossRef] [Scilit]
  52. Fricker, R.A.; Green, E.L.; Jenkins, S.I.; Griffin, S.M. The Influence of Nicotinamide on Health and Disease in the Central Nervous System. Int. J. Tryptophan Res. 2018, 11, 1178646918776658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Patassini, S.; Begley, P.; Xu, J.; Church, S.J.; Kureishy, N.; Reid, S.J.; Waldvogel, H.J.; Faull, R.L.M.; Snell, R.G.; Unwin, R.D.; et al. Cerebral Vitamin B5 (D-Pantothenic Acid) Deficiency as a Potential Cause of Metabolic Perturbation and Neurodegeneration in Huntington’s Disease. Metabolites 2019, 9, 113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Horzmann, K.A.; Freeman, J.L. Zebrafish Get Connected: Investigating Neurotransmission Targets and Alterations in Chemical Toxicity. Toxics 2016, 4, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Saha, S.K.; Islam, S.M.R.; Abdullah-Al-Wadud, M.; Islam, S.; Ali, F.; Park, K.S. Multiomics Analysis Reveals that GLS and GLS2 Differentially Modulate the Clinical Outcomes of Cancer. J. Clin. Med. 2019, 8, 355. [Google Scholar] [CrossRef] [Scilit]
  56. Fahlke, C.; Kortzak, D.; Machtens, J.-P. Molecular physiology of EAAT anion channels. Pflüg. Arch.-Eur. J. Physiol. 2016, 468, 491–502. [Google Scholar] [CrossRef] [Scilit]
  57. Ayka, A.; Sehirli, A.O. The Role of the SLC Transporters Protein in the Neurodegenerative Disorders. Clin. Psychopharmacol. Neurosci. 2020, 18, 174–187. [Google Scholar] [CrossRef] [Scilit]
  58. Tani, H.; Dulla, C.G.; Farzampour, Z.; Taylor-Weiner, A.; Huguenard, J.R.; Reimer, R.J. A Local Glutamate-Glutamine Cycle Sustains Synaptic Excitatory Transmitter Release. Neuron 2014, 81, 888–900. [Google Scholar] [CrossRef] [Scilit]
  59. Filippi, A.; Mueller, T.; Driever, W. vglut2 and gad expression reveal distinct patterns of dual GABAergic versus glutamatergic cotransmitter phenotypes of dopaminergic and noradrenergic neurons in the zebrafish brain. J. Comp. Neurol. 2014, 522, 2019–2037. [Google Scholar] [CrossRef] [Scilit]
  60. Gottesmann, C. GABA mechanisms and sleep. Neuroscience 2002, 111, 231–239. [Google Scholar] [CrossRef] [Scilit]
  61. Wise, R.A. Dopamine, learning and motivation. Nat. Rev. Neurosci. 2004, 5, 483–494. [Google Scholar] [CrossRef] [Scilit]
  62. Nakata, T.; Matsui, T.; Kobayashi, K.; Kobayashi, Y.; Anzai, N. Organic cation transporter 2 (SLC22A2), a low-affinity and high-capacity choline transporter, is preferentially enriched on synaptic vesicles in cholinergic neurons. Neuroscience 2013, 252, 212–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Lohr, K.M.; Stout, K.A.; Dunn, A.R.; Wang, M.; Salahpour, A.; Guillot, T.S.; Miller, G.W. Increased Vesicular Monoamine Transporter 2 (VMAT2; Slc18a2) Protects against Methamphetamine Toxicity. ACS Chem. Neurosci. 2015, 6, 790–799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Jayamohananan, H.; Manoj Kumar, M.K.; T, P.A. 5-HIAA as a Potential Biological Marker for Neurological and Psychiatric Disorders. Adv. Pharm. Bull. 2019, 9, 374–381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Huang, C.; van Wijnen, A.J.; Im, H.J. Serotonin Transporter (5-Hydroxytryptamine Transporter, SERT, SLC6A4) and Sodium-dependent Reuptake Inhibitors as Modulators of Pain Behaviors and Analgesic Responses. J. Pain 2024, 25, 618–631. [Google Scholar] [CrossRef] [Scilit]
  66. Sourbron, J.; Lagae, L. Serotonin receptors in epilepsy: Novel treatment targets? Epilepsia Open 2022, 7, 231–246. [Google Scholar] [CrossRef] [Scilit]
  67. Malsam, J.; Bärfuss, S.; Trimbuch, T.; Zarebidaki, F.; Sonnen, A.F.P.; Wild, K.; Scheutzow, A.; Rohland, L.; Mayer, M.P.; Sinning, I.; et al. Complexin Suppresses Spontaneous Exocytosis by Capturing the Membrane-Proximal Regions of VAMP2 and SNAP25. Cell Rep. 2020, 32, 107926. [Google Scholar] [CrossRef] [Scilit]
  68. Suthar, S.K.; Alam, M.M.; Lee, J.; Monga, J.; Joseph, A.; Lee, S.Y. Bioinformatic Analyses of Canonical Pathways of TSPOAP1 and its Roles in Human Diseases. Front. Mol. Biosci. 2021, 8, 667947. [Google Scholar] [CrossRef] [Scilit]
  69. Xu, Y.; Yao, Y.; Yu, L.; Fung, H.L.; Tang, A.H.N.; Ng, I.O.-L.; Wong, M.Y.M.; Che, C.-M.; Yun, J.P.; Cui, Y.; et al. Clathrin light chain A facilitates small extracellular vesicle uptake to promote hepatocellular carcinoma progression. Hepatol. Int. 2023, 17, 1490–1499. [Google Scholar] [CrossRef] [Scilit]
  70. Wei, X.; Luo, Y.; Hyde, D.R. Molecular cloning of three zebrafish lin7 genes and their expression patterns in the retina. Exp. Eye Res. 2006, 82, 122–131. [Google Scholar] [CrossRef] [Scilit]
  71. Schauer, R. Sialic acids as regulators of molecular and cellular interactions. Curr. Opin. Struct. Biol. 2009, 19, 507–514. [Google Scholar] [CrossRef] [Scilit]
  72. Moffett, J.R.; Ross, B.; Arun, P.; Madhavarao, C.N.; Namboodiri, A.M.A. N-Acetylaspartate in the CNS: From neurodiagnostics to neurobiology. Prog. Neurobiol. 2007, 81, 89–131. [Google Scholar] [CrossRef] [Scilit]
Metabolites 16 00105 g001
Figure 1. Histopathological analysis of zebrafish brain tissues after 7-day TBT exposure. (A) Schematic illustration of the zebrafish brain. The dashed line indicates the coronal sectioning plane through the forebrain, encompassing the telencephalon and diencephalon, used for histological evaluation. (B) Control group showing intact brain tissue architecture. The 20 ng/L TBT group exhibited largely preserved morphology with only minor alterations. In the 100 ng/L TBT group, nuclear swelling and reduced cell density were observed (green arrows). The 500 ng/L TBT group displayed severe histopathological damage, characterized by extensive vacuolation (red arrows) and tissue atrophy (H&E staining; scale bar = 50 μm; n = 3). (C) Quantitative analysis of TBT-induced histopathological changes in zebrafish brain tissue. Neuronal density (cells/0.1 mm2) and tissue vacuolation index (%) across different TBT exposure concentrations (CK, 20, 100, and 500 ng/L). Data represent mean ± SD (n = 3). ns (not significant), * p < 0.05, *** p < 0.001 compared to control group.
Figure 1. Histopathological analysis of zebrafish brain tissues after 7-day TBT exposure. (A) Schematic illustration of the zebrafish brain. The dashed line indicates the coronal sectioning plane through the forebrain, encompassing the telencephalon and diencephalon, used for histological evaluation. (B) Control group showing intact brain tissue architecture. The 20 ng/L TBT group exhibited largely preserved morphology with only minor alterations. In the 100 ng/L TBT group, nuclear swelling and reduced cell density were observed (green arrows). The 500 ng/L TBT group displayed severe histopathological damage, characterized by extensive vacuolation (red arrows) and tissue atrophy (H&E staining; scale bar = 50 μm; n = 3). (C) Quantitative analysis of TBT-induced histopathological changes in zebrafish brain tissue. Neuronal density (cells/0.1 mm2) and tissue vacuolation index (%) across different TBT exposure concentrations (CK, 20, 100, and 500 ng/L). Data represent mean ± SD (n = 3). ns (not significant), * p < 0.05, *** p < 0.001 compared to control group.
Metabolites 16 00105 g001
Metabolites 16 00105 g002
Figure 2. Impact of TBT exposure on zebrafish kinematic parameters. (A) Measurements after 3 days of exposure. (B) Measurements after 7 days of exposure. Parameters analyzed include bout speed (mm/s), angular velocity (deg/s), mean tail beat frequency (TBF, Hz), and number of oscillations. Values represent mean ± SD (n = 6). Statistical significance: ns (not significant), * p < 0.05 vs. control group (CK).
Figure 2. Impact of TBT exposure on zebrafish kinematic parameters. (A) Measurements after 3 days of exposure. (B) Measurements after 7 days of exposure. Parameters analyzed include bout speed (mm/s), angular velocity (deg/s), mean tail beat frequency (TBF, Hz), and number of oscillations. Values represent mean ± SD (n = 6). Statistical significance: ns (not significant), * p < 0.05 vs. control group (CK).
Metabolites 16 00105 g002
Metabolites 16 00105 g003
Figure 3. Light–dark transition effects on zebrafish kinematic parameters following 7-day TBT exposure. (A) Bout speed (mm/s), (B) Angular velocity (deg/s), (C) Mean TBF (Hz), and (D) Number of oscillations across different TBT concentrations (CK, 20, 100, and 500 ng/L). Values represent mean ± SD (n = 6). The green, red, yellow, and blue data points represent the CK, 20, 100, and 500 ng/L TBT groups, respectively. Statistical significance: ns (not significant), * p < 0.05, ** p < 0.01, *** p < 0.001 comparing light and dark periods within each treatment group.
Figure 3. Light–dark transition effects on zebrafish kinematic parameters following 7-day TBT exposure. (A) Bout speed (mm/s), (B) Angular velocity (deg/s), (C) Mean TBF (Hz), and (D) Number of oscillations across different TBT concentrations (CK, 20, 100, and 500 ng/L). Values represent mean ± SD (n = 6). The green, red, yellow, and blue data points represent the CK, 20, 100, and 500 ng/L TBT groups, respectively. Statistical significance: ns (not significant), * p < 0.05, ** p < 0.01, *** p < 0.001 comparing light and dark periods within each treatment group.
Metabolites 16 00105 g003
Metabolites 16 00105 g004
Figure 4. Metabolic profile differences across treatment groups analyzed using OPLS-DA and pathway enrichment analyses. (A) Score plot illustrating metabolic differences in positive ionization mode (n = 6). Each point represents an individual sample, with ellipses indicating 95% confidence regions for each group (CK: control; 20, 100, and 500: ng/L TBT exposure groups; QC: quality control). The X-axis represents the primary component of variation (explaining 36% of variance), while the Y-axis shows the secondary component (explaining 10% of variance). (B) Score plot illustrating metabolic differences in negative ionization mode. Similarly to panel A, the X-axis explains 35% of variance, and the Y-axis explains 10% of variance. (C) Pathway impact analysis plot displaying pathway significance (−log(p)) versus pathway impact. Circle diameter represents the pathway impact score, while the color gradient indicates statistical significance (red indicating highest significance, transitioning to yellow for lower significance). Key pathways showing notable perturbation including alanine, aspartate, and glutamate metabolism; arginine biosynthesis; and the citrate cycle (TCA cycle). (D) Metabolite Set Enrichment Analysis (MSEA) illustrating the top 25 enriched metabolic pathways. Enrichment ratios are represented by horizontal bars, with color coding indicating statistical significance (p-value ranging from 2 × 10−1 to 4 × 10−5).
Figure 4. Metabolic profile differences across treatment groups analyzed using OPLS-DA and pathway enrichment analyses. (A) Score plot illustrating metabolic differences in positive ionization mode (n = 6). Each point represents an individual sample, with ellipses indicating 95% confidence regions for each group (CK: control; 20, 100, and 500: ng/L TBT exposure groups; QC: quality control). The X-axis represents the primary component of variation (explaining 36% of variance), while the Y-axis shows the secondary component (explaining 10% of variance). (B) Score plot illustrating metabolic differences in negative ionization mode. Similarly to panel A, the X-axis explains 35% of variance, and the Y-axis explains 10% of variance. (C) Pathway impact analysis plot displaying pathway significance (−log(p)) versus pathway impact. Circle diameter represents the pathway impact score, while the color gradient indicates statistical significance (red indicating highest significance, transitioning to yellow for lower significance). Key pathways showing notable perturbation including alanine, aspartate, and glutamate metabolism; arginine biosynthesis; and the citrate cycle (TCA cycle). (D) Metabolite Set Enrichment Analysis (MSEA) illustrating the top 25 enriched metabolic pathways. Enrichment ratios are represented by horizontal bars, with color coding indicating statistical significance (p-value ranging from 2 × 10−1 to 4 × 10−5).
Metabolites 16 00105 g004
Metabolites 16 00105 g005
Figure 5. Reactome pathway analysis of TBT-induced alterations in neurotransmitter systems. (A) Pathway enrichment analysis based on Reactome database, with neurotransmitter-related pathways highlighted in red text showing significant enrichment. The x-axis represents the count of genes involved in each pathway, while the color gradient indicates the statistical significance (−log10 (p-value)). (B) Hierarchical network analysis of TBT-affected neurotransmitter pathways. Upper panel: Network visualization showing significantly affected neurotransmitter pathways (green nodes) and their associated key genes and metabolites (red nodes). Lower panel: Detailed protein–protein interaction network displaying differentially expressed genes (red nodes with asterisks) and their interaction partners (blue nodes) within the neurotransmitter pathways. Different types of molecular interactions are indicated by distinct line styles as shown in the legend. The asterisk (*) denotes differentially expressed genes with p < 0.05. The gray notes represent non-significant genes.
Figure 5. Reactome pathway analysis of TBT-induced alterations in neurotransmitter systems. (A) Pathway enrichment analysis based on Reactome database, with neurotransmitter-related pathways highlighted in red text showing significant enrichment. The x-axis represents the count of genes involved in each pathway, while the color gradient indicates the statistical significance (−log10 (p-value)). (B) Hierarchical network analysis of TBT-affected neurotransmitter pathways. Upper panel: Network visualization showing significantly affected neurotransmitter pathways (green nodes) and their associated key genes and metabolites (red nodes). Lower panel: Detailed protein–protein interaction network displaying differentially expressed genes (red nodes with asterisks) and their interaction partners (blue nodes) within the neurotransmitter pathways. Different types of molecular interactions are indicated by distinct line styles as shown in the legend. The asterisk (*) denotes differentially expressed genes with p < 0.05. The gray notes represent non-significant genes.
Metabolites 16 00105 g005
Metabolites 16 00105 g006
Figure 6. Transcription levels of neurotransmitter pathway-related genes following TBT exposure. The expression levels of 18 pivotal genes were assessed across varying concentrations of TBT (20, 100, and 500 ng/L) and compared to the control group (CK). The genes included are (A) GLS, (B) GLS2, (C) SLC1A2, (D) SLC1A6, (E) SLC1A7, (F) LIN7A, (G) LIN7B, (H) GAD1, (I) SLC22A2, (J) SLC18A2, (K) GAD2, (L) ABAT, (M) ALDH5A1, (N) CHAT, (O) VAMP2, (P) SNAP25a, (Q) TSPOAP1, and (R) CLTA. Data represent mean ± SD (n = 4). Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001 compared to CK; ns: not significant.
Figure 6. Transcription levels of neurotransmitter pathway-related genes following TBT exposure. The expression levels of 18 pivotal genes were assessed across varying concentrations of TBT (20, 100, and 500 ng/L) and compared to the control group (CK). The genes included are (A) GLS, (B) GLS2, (C) SLC1A2, (D) SLC1A6, (E) SLC1A7, (F) LIN7A, (G) LIN7B, (H) GAD1, (I) SLC22A2, (J) SLC18A2, (K) GAD2, (L) ABAT, (M) ALDH5A1, (N) CHAT, (O) VAMP2, (P) SNAP25a, (Q) TSPOAP1, and (R) CLTA. Data represent mean ± SD (n = 4). Statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001 compared to CK; ns: not significant.
Metabolites 16 00105 g006
Metabolites 16 00105 g007
Figure 7. Heatmap showing differential metabolite abundances across various metabolic pathways in response to TBT treatment. The color scale represents metabolite levels (red: increased, blue: decreased) at different TBT concentrations (CK, 20, 100, and 500). Asterisks indicate statistical significance levels (* p < 0.05, ** p < 0.01, *** p < 0.001, n = 6).
Figure 7. Heatmap showing differential metabolite abundances across various metabolic pathways in response to TBT treatment. The color scale represents metabolite levels (red: increased, blue: decreased) at different TBT concentrations (CK, 20, 100, and 500). Asterisks indicate statistical significance levels (* p < 0.05, ** p < 0.01, *** p < 0.001, n = 6).
Metabolites 16 00105 g007
Metabolites 16 00105 g008
Figure 8. Metabolite–gene interaction network depicting the relationships between significantly altered metabolites (shown in red) and their associated genes/enzymes (shown in blue). This network visualization reveals the complex molecular interactions potentially affected by TBT exposure.
Figure 8. Metabolite–gene interaction network depicting the relationships between significantly altered metabolites (shown in red) and their associated genes/enzymes (shown in blue). This network visualization reveals the complex molecular interactions potentially affected by TBT exposure.
Metabolites 16 00105 g008
Metabolites 16 00105 g009
Figure 9. Effects of TBT exposure on dopamine content and oxidative stress parameters in different brain regions. (A) Relative dopamine levels in forebrain, midbrain, hindbrain, and TH mRNA expression after exposure to different concentrations of TBT (0, 20, 100, and 500 ng/L). (B) Impact of TBT exposure on oxidative stress markers including SOD activity (U/mg protein), catalase activity (U/mg protein), relative SOD2 mRNA levels, relative CAT mRNA levels, and relative ROS levels. Data are presented as mean ± SD (n = 3 for dopamine levels, enzyme activities and ROS levels; n = 4 for mRNA expression analyses). Statistical significance: ns (not significant), * p < 0.05, ** p < 0.01, *** p < 0.001 compared to control (CK) group.
Figure 9. Effects of TBT exposure on dopamine content and oxidative stress parameters in different brain regions. (A) Relative dopamine levels in forebrain, midbrain, hindbrain, and TH mRNA expression after exposure to different concentrations of TBT (0, 20, 100, and 500 ng/L). (B) Impact of TBT exposure on oxidative stress markers including SOD activity (U/mg protein), catalase activity (U/mg protein), relative SOD2 mRNA levels, relative CAT mRNA levels, and relative ROS levels. Data are presented as mean ± SD (n = 3 for dopamine levels, enzyme activities and ROS levels; n = 4 for mRNA expression analyses). Statistical significance: ns (not significant), * p < 0.05, ** p < 0.01, *** p < 0.001 compared to control (CK) group.
Metabolites 16 00105 g009
Table 1. The Primers used in this study.
Table 1. The Primers used in this study.
GeneForward (5′-3′)Reverse (5′-3′)
VAMP2GCAATCGTCGCTTACAGCAGGTCTCGAACTGTGAGGCTCC
TSPOAP1CAGTATAAGCGGGCGTTTGCGGAGACGCTCGAACTCACTC
SNAP25aACGCATCGAGGAGGGAATGGTTCACGCTCATCCACAACGC
SLC18A2TTGGCCAGATCTCTGCAAGGCGTTTCCTCGTTCCTCGTCA
LIN7AAGCTCCAGAGAACAGGGGAACACCGTCTCGTACACATGCT
LIN7BATGCACACCCGAGAGTTGTTCCCCTGGAATGACCCTAGA
GLS2CACAGACTCAGCAAGGAGGGAGAGGCTTCACACACGACTG
GLSACTGCTTCAGCGCTGCTAATCAGCCTTCTTATCTGCCGCC
GAD2GTTTCGGGGGCTGAAAACGCAGCTCTCGGCTGTAGACTC
GAD1GCTACCAACCACAGGGAGACGCGACCACTGAGCCTCTATT
CHATGAGTTGCTCTGGACTGCCATAAGTGGATGCTGGTTGCGTA
ALDH5A1TCAAGAGGTCGGTGTGTCCTCAGTCCGAGACTTTGGCGAT
ABATTCTCCTCCATTCCCATCGGTTCTCAGGTGGCAGGATACCA
CLTATAACCATCCTTGCTACCGCCCGAGCGGAGCCTGTTTAAGA
SLC1A2CACGGGAAGACTGACGACATTTTGAGCAGCAAAGACGCAC
SLC1A6ACGTGCTGGGAGATTCGTTTCAGCTGGTACGGCTTCTCAT
SLC1A7CCTGGATCGCTTCAGGACAAGGTCTCACAGATGAGAGGAATCT
SLC22A2AGGACGGTTGGAGTGACCTAATCGTGGTGATTCGGGGATG
CATCCAGAAACGCATGGTGCAAAAGTCAAGGCAGAAAGGACGG
SOD2TGTTGGAGGCCATAAAGCGTTTCTCTCCCAAGTGTGGTGC
THTGAGCGAGCAGATCGTGTTTGAGGAAGCGTGCCGTATGTA
β-actinCATCTACGAGGGTTACGCCCAACCACACGTCGGCTTGTTA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zheng, Q.; Hong, N.; Liu, L.; Wang, C.; Gan, R.; Xu, D.; Wang, J. Neurotoxic Effects of Acute Tributyltin Exposure in Adult Zebrafish: Behavioral Impairments and Mechanistic Insights. Metabolites 2026, 16, 105. https://doi.org/10.3390/metabo16020105

AMA Style

Zheng Q, Hong N, Liu L, Wang C, Gan R, Xu D, Wang J. Neurotoxic Effects of Acute Tributyltin Exposure in Adult Zebrafish: Behavioral Impairments and Mechanistic Insights. Metabolites. 2026; 16(2):105. https://doi.org/10.3390/metabo16020105

Chicago/Turabian Style

Zheng, Qi, Nan Hong, Lin Liu, Cong Wang, Ruixi Gan, Di Xu, and Junsong Wang. 2026. "Neurotoxic Effects of Acute Tributyltin Exposure in Adult Zebrafish: Behavioral Impairments and Mechanistic Insights" Metabolites 16, no. 2: 105. https://doi.org/10.3390/metabo16020105

APA Style

Zheng, Q., Hong, N., Liu, L., Wang, C., Gan, R., Xu, D., & Wang, J. (2026). Neurotoxic Effects of Acute Tributyltin Exposure in Adult Zebrafish: Behavioral Impairments and Mechanistic Insights. Metabolites, 16(2), 105. https://doi.org/10.3390/metabo16020105

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop