Changes in the Lipid Metabolism of the Longissimus thoracis Muscle in Bulls When Using Different Feeding Strategies during the Growing and Finishing Phases
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Growing Phase (Growing Feed)
2.3. Finishing Phase (Second Experimental Phase)
2.4. Slaughter Procedure and Muscle Sampling
2.5. Chemical Composition of Beef
2.6. Fatty Acid Profile of Beef and Diet
2.7. Lipogenic Enzyme Activity
2.8. Gene Expression Analyses
2.9. Gene Set Enrichment Analysis
2.10. Statistical Analysis
3. Results
3.1. Meat Composition
3.2. Fatty Acid Profile and Enzyme
3.3. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Owens, F.N.; Dubeski, P.; Hanson, C.F. Factors that alter the growth and development of ruminants. J. Anim. Sci. 1993, 71, 3138–3150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roth, M.T.P.; Resende, F.D.; Oliveira, I.M.; Fernandes, R.M.; Custódio, L.; Siqueira, G.R. Does supplementation during previous phase influence performance during the growing and finishing phase in Nellore cattle? Livest. Sci. 2017, 204, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Sampaio, R.L.; de Resende, F.D.; Reis, R.A.; de Oliveira, I.M.; Custódio, L.; Fernandes, R.M.; Pazdiora, R.D.; Siqueira, G.R. The nutritional interrelationship between the growing and finishing phases in crossbred cattle raised in a tropical system. Trop. Anim. Health Prod. 2017, 49, 1015–1024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, L.H.P.; Paulino, P.V.R.; Assis, G.J.F.; Assis, D.E.F.; Estrada, M.M.; Silva, M.C.; Silva, J.C.; Martins, T.S.; Valadares Filho, S.C.; Paulino, M.F. Effect of post-weaning growth rate on carcass traits and meat quality of Nellore cattle. Meat Sci. 2017, 123, 192–197. [Google Scholar] [CrossRef] [Scilit]
- Dong, G.-F.; Zou, Q.; Wang, H.; Huang, F.; Liu, X.-C.; Chen, L.; Yang, C.-Y.; Yang, Y.-O. Conjugated linoleic acid differentially modulates growth, tissue lipid deposition, and gene expression involved in the lipid metabolism of grass carp. Aquaculture 2014, 432, 181–191. [Google Scholar] [CrossRef] [Scilit]
- Schoonmaker, J.P.; Cecava, M.J.; Faulkner, D.B.; Fluharty, F.L.; Zerby, H.N.; Loerch, S.C. Effect of source of energy and rate of growth on performance, carcass characteristics, ruminal fermentation, and serum glucose and insulin of early-weaned steers. J. Anim. Sci. 2003, 81, 843–855. [Google Scholar] [CrossRef] [Scilit]
- Smith, S.; Blackmon, T.; Sawyer, J.; Miller, R.; Baber, J.; Morrill, J.; Cabral, A.; Wickersham, T. Glucose and acetate metabolism in bovine intramuscular and subcutaneous adipose tissues from steers infused with glucose, propionate, or acetate. J. Anim. Sci. 2018, 96, 921–929. [Google Scholar] [CrossRef] [Scilit]
- Hoffmann, A.; Berça, A.S.; Cardoso, A.d.S.; Fonseca, N.V.B.; Silva, M.L.C.; Leite, R.G.; Ruggieri, A.C.; Reis, R.A. Does the effect of replacing cottonseed meal with dried distiller’s grains on Nellore bulls finishing phase vary between pasture and feedlot? Animals 2021, 11, 85. [Google Scholar] [CrossRef] [Scilit]
- Torrecilhas, J.A.; San Vito, E.; Fiorentini, G.; de Souza Castagnino, P.; Simioni, T.A.; Lage, J.F.; Baldi, F.; Duarte, J.M.; da Silva, L.G.; Reis, R.A. Effects of supplementation strategies during the growing phase on meat quality of beef cattle finished in different systems. Livest. Sci. 2021, 247, 104465. [Google Scholar] [CrossRef] [Scilit]
- Chail, A.; Legako, J.F.; Pitcher, L.R.; Griggs, T.C.; Ward, R.E.; Martini, S.; MacAdam, J.W. Legume finishing provides beef with positive human dietary fatty acid ratios and consumer preference comparable with grain-finished beef. J. Anim. Sci. 2016, 94, 2184–2197. [Google Scholar] [CrossRef] [Scilit]
- Morgan, S.A.; Huws, S.A.; Lister, S.J.; Sanderson, R.; Scollan, N.D. Phenotypic variation and relationships between fatty acid concentrations and feed value of perennial ryegrass genotypes from a breeding population. Agronomy 2020, 10, 343. [Google Scholar] [CrossRef] [Scilit]
- Detmann, E.; Paulino, M.F.; Valadares Filho, S.C.; Huhtanen, P. Nutritional aspects applied to grazing cattle in the tropics: A review based on Brazilian results. Semin. Ciênc. Agrár. 2014, 35, 2829–2854. [Google Scholar] [CrossRef] [Scilit]
- Valadares Filho, S.C.; Marcondes, M.I.; Chizzotti, M.; Paulino, P. Nutrient Requirements of Zebu and Crossbred Cattle BR-CORTE, 3rd ed.; UFV Suprema Gráfica Ltda: Viçosa, Brazil, 2016; pp. 1–327. [Google Scholar]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [Scilit]
- Christie, W. Extraction and hydrolysis of lipids and some reactions of their fatty acid components. Handb. Chromatogr. Lipids 1984, 1, 33–46. [Google Scholar]
- Martin, D.B.; Horning, M.G.; Vagelos, P.R. Fatty acid synthesis in adipose tissue: I. Purification and properties of a long chain fatty acid-synthesizing system. J. Biol. Chem. 1961, 236, 663–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bergmeyer, H.U.; Bernt, E. Malate dehydrogenase and isocitrate dehydrogenase. In Bergmeyer HU; Bergmeyer, H.U., Ed.; Methods of enzymatic analysis; Academic Press: New York, NY, USA, 1974; pp. 613–631. [Google Scholar]
- Bergmeyer, H.U.; Bernt, E. D-Glucose determination with hexokinase and glucose-6 phosphate dehydrogenase. In Bergmeyer HU; Bergmeyer, H.U., Ed.; Academic Press: New York, NY, USA, 1974; pp. 1196–1201+1974. [Google Scholar]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucl. Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.-H.; Pagès, F.; Trajanoski, Z.; Galon, J. ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef] [Scilit]
- Lancaster, P.A.; Krehbiel, C.R.; Horn, G.W. Ameta-analysis of effects of nutrition and management during the stocker and backgrounding phase on subsequent finishing performance and carcass characteristics. Prof. Anim. Sci. 2014, 30, 602–612. [Google Scholar] [CrossRef] [Scilit]
- Segabinazzi, L.R.; Menezes, L.F.G.d.; Silva, C.E.K.d.; Clederson Martinello, B.B.; Molinete, M.L. Diurnal ingestive behavior of Holstein calves reared in different systems: Feedlot or pasture. Acta Scientiarum. Anim. Sci. 2014, 36, 225–231. [Google Scholar] [CrossRef] [Scilit]
- Marcondes, M.I.; da Silva, A.L.; Gionbelli, M.P.; Valadares Filho, S.C.; Costa e Silva, L.F.; Rotta, P.P.; Chizzotti, M.L.; Prados, L.F. Energy requirements for beef cattle. In Nutrient Requirements of Zebu and Crossbred Cattle, 3rd ed.; Valadares Filho, S.C., Costa e Silva, L.F., Gionbelli, M.P., Rotta, P.P., Marcondes, M.I., Chizzotti, M.L., Prados, L.F., Eds.; Grafica Suprema: Viçosa, Brazil, 2016; pp. 157–184. [Google Scholar]
- Laliotis, G.P.; Bizelis, I.; Rogdakis, E. Comparative approach of the de novo fatty acid synthesis (lipogenesis) between ruminant and non ruminant mammalian species: From biochemical level to the main regulatory lipogenic genes. Curr. Genom. 2010, 11, 168–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ingle, D.L.; Bauman, D.E.; Garrigus, U.S. Lipogenesis in the ruminant: In vitro study of tissue sites, carbon source and reducing equivalent generation for fatty acid synthesis. J. Nutr. 1972, 102, 609–616. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.-H.; Go, Y.; Kim, D.-Y.; Lee, S.H.; Kim, O.-H.; Jeon, Y.H.; Kwon, T.K.; Bae, J.-H.; Song, D.-K.; Rhyu, I.J. Isocitrate dehydrogenase 2 protects mice from high-fat diet-induced metabolic stress by limiting oxidative damage to the mitochondria from brown adipose tissue. Exp. Mol. Med. 2020, 52, 238–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wood, J.D.; Enser, M.; Fisher, A.V.; Nute, G.R.; Sheard, P.R.; Richardson, R.I.; Hughes, S.I.; Whittington, F.M. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci. 2008, 78, 343–358. [Google Scholar] [CrossRef] [Scilit]
- Smith, S.B.; Gill, C.A.; Lunt, D.K.; Brooks, M.A. Regulation of fat and fatty acid composition in beef cattle. Asian-Australas. J. Anim. Sci. 2009, 22, 1225–1233. [Google Scholar] [CrossRef] [Scilit]
- Frank, D.; Ball, A.; Hughes, J.; Krishnamurthy, R.; Piyasiri, U.; Stark, J.; Watkins, P.; Warner, R. Sensory and flavor chemistry characteristics of Australian beef: Influence of intramuscular fat, feed, and breed. J. Agric. Food Chem. 2016, 64, 4299–4311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, S.B.; Lunt, D.K.; Chung, K.Y.; Choi, C.B.; Tume, R.K.; Zembayashi, M. Adiposity, fatty acid composition, and delta-9 desaturase activity during growth in beef cattle. Anim. Sci. J. 2006, 77, 478–486. [Google Scholar] [CrossRef] [Scilit]
- Fruet, A.P.B.; Stefanello, F.S.; Júnior, A.G.R.; de Souza, A.N.M.; Tonetto, C.J.; Nörnberg, J.L. Whole grains in the finishing of culled ewes in pasture or feedlot: Performance, carcass characteristics and meat quality. Meat Sci. 2016, 113, 97–103. [Google Scholar] [CrossRef] [Scilit]
- Abdelhadi, L.O.; Santini, F.J.; Gagliostro, G.A. Corn silage or high moisture corn supplements for beef heifers grazing temperate pastures: Effects on performance, ruminal fermentation and in situ pasture digestion. Anim. Feed Sci. Technol. 2005, 118, 63–78. [Google Scholar] [CrossRef] [Scilit]
- Wood, J.; Enser, M. Manipulating the fatty acid composition of meat to improve nutritional value and meat quality. In New Aspects of Meat Quality, 8th ed.; Elsevier: Cambridge, UK, 2017; pp. 501–535. [Google Scholar]
- Noci, F.; O’kiely, P.; Monahan, F.J.; Stanton, C.; Moloney, A.P. Conjugated linoleic acid concentration in M. Longissimus dorsi from heifers offered sunflower oil-based concentrates and conserved forages. Meat Sci. 2005, 69, 509–518. [Google Scholar] [CrossRef] [Scilit]
- Krusinski, L.; Maciel, I.C.F.; Sergin, S.; Goeden, T.; Schweihofer, J.P.; Singh, S.; Rowntree, J.E.; Fenton, J.I. Fatty acid and micronutrient profile of longissimus lumborum from Red Angus and Red Angus x Akaushi cattle finished on grass or grain. Foods 2022, 11, 3451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, R.R.; do Prado, I.N.; da Silva, F.F.; Rotta, P.P.; Rodrigues, L.B.O.; do Prado, R.M.; de Carvalho Mesquita, B.M.A.; Alba, H.D.R.; de Carvalho, G.G.P. Fatty acid profile and chemical composition of meat from Nellore steers finished on pasture with different amounts of supplementation. Can. J. Anim. Sci. 2021, 101, 558–566. [Google Scholar] [CrossRef] [Scilit]
- Teixeira, P.D.; Oliveira, D.M.; Chizzotti, M.L.; Chalfun-Junior, A.; Coelho, T.C.; Gionbelli, M.; Paiva, L.V.; Carvalho, J.R.R.; Ladeira, M.M. Subspecies and diet affect the expression of genes involved in lipid metabolism and chemical composition of muscle in beef cattle. Meat Sci. 2017, 133, 110–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obsen, T.; Faergeman, N.J.; Chung, S.; Martinez, K.; Gobern, S.; Loreau, O.; Wabitsch, M.; Mandrup, S.; McIntosh, M. Trans-10, cis-12 conjugated linoleic acid decreases de novo lipid synthesis in human adipocytes. J. Nutr. Biochem. 2012, 23, 580–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez-Cruz, M.; Serna, D.S. Nutrigenomics of ω-3 fatty acids: Regulators of the master transcription factors. Nutrition 2017, 41, 90–96. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Ahmad, A.A.; Bao, P.J.; Guo, X.; Wu, X.Y.; Liu, J.B.; Chu, M.; Liang, C.N.; Pei, J.; Long, R.J. Increasing dietary energy level improves growth performance and lipid metabolism through up-regulating lipogenic gene expression in yak (Bos grunniens). Anim. Feed Sci. Technol. 2020, 263, 114455. [Google Scholar] [CrossRef] [Scilit]
- Botolin, D.; Wang, Y.; Christian, B.; Jump, D.B. Docosahexaneoic acid (22:6,n-3) regulates rat hepatocyte SREBP-1 nuclear abundance by Erk- and 26S proteasome-dependent pathways. J. Lipid Res. 2006, 47, 181–192. [Google Scholar] [CrossRef] [Scilit]
- Flowers, M.T.; Ntambi, J.M. Stearoyl-CoA desaturase and its relation to high-carbohydrate diets and obesity. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2009, 1791, 85–91. [Google Scholar] [CrossRef] [Scilit]
- Bionaz, M.; Chen, S.; Khan, M.J.; Loor, J.J. Functional Role of PPARs in Ruminants: Potential Targets for Fine-Tuning Metabolism during Growth and Lactation. PPAR Res. 2013, 2013, 684159. [Google Scholar] [CrossRef] [Scilit]
- Cronan, J.E., Jr.; Waldrop, G.L. Multi-subunit acetyl-CoA carboxylases. Prog. Lipid Res. 2002, 41, 407–435. [Google Scholar] [CrossRef] [Scilit]
- Hertzel, A.V.; Smith, L.A.; Berg, A.H.; Cline, G.W.; Shulman, G.I.; Scherer, P.E.; Bernlohr, D.A. Lipid metabolism and adipokine levels in fatty acid-binding protein null and transgenic mice. Am. J. Physiol.-Endocrinol. Metab. 2006, 290, E814–E823. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Liu, J.; Wu, X.; Bao, P.; Long, R.; Guo, X.; Ding, X.; Yan, P. The response of gene expression associated with lipid metabolism, fat deposition and fatty acid profile in the longissimus dorsi muscle of Gannan yaks to different energy levels of diets. PLoS ONE 2017, 12, e0187604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bunger, M.; van den Bosch, H.M.; van der Meijde, J.; Kersten, S.; Hooiveld, G.J.; Muller, M. Genome-wide analysis of PPARα activation in murine small intestine. Physiol. Genom. 2007, 30, 192–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ladeira, M.M.; Schoonmaker, J.P.; Swanson, K.C.; Duckett, S.K.; Gionbelli, M.P.; Rodrigues, L.M.; Teixeira, P.D. Nutrigenomics of marbling and fatty acid profile in ruminant meat. Animal 2018, 12, s282–s294. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Items | Growing | Finishing | |||
|---|---|---|---|---|---|
| PRE 4 | Pasture | Concentrate | Pasture | Corn Silage | |
| Ingredients, g/kg DM | |||||
| Corn | 735 | - | 7890 | - | - |
| Soybean meal | 106 | - | 1650 | - | - |
| Mineral premix 1 | 159 | - | 46.00 | - | - |
| Chemical composition | |||||
| Dry matter | 860 | 332 | 899 | 458 | 301 |
| Organic matter | 892 | 925 | 910 | 923 | 950 |
| Crude protein | 205 | 128 | 160 | 113 | 95.0 |
| Neutral detergent fibre | 265 | 575 | 251 | 582 | 331 |
| Ether extract | 63.0 | 24.1 | 66.0 | 23.0 | 71.0 |
| Fatty acid, g/100 g of total FA 3 | |||||
| Myristic (C14:0) | 0.08 | 1.30 | 0.08 | 3.09 | 0.27 |
| Palmitic (C16:0) | 11.2 | 36.5 | 11.2 | 35.3 | 17.6 |
| Margaric (C17:0) | 0.09 | 0.49 | 0.09 | 0.65 | 0.22 |
| Stearic (C18:0) | 3.94 | 3.60 | 3.76 | 4.16 | 3.46 |
| C20:0 | 0.38 | 0.99 | 0.38 | 1.71 | 0.84 |
| C22:0 | 0.45 | 1.28 | 0.44 | 2.03 | 0.44 |
| C24:0 | 0.18 | 2.12 | 0.20 | 3.02 | 0.78 |
| Palmitoleic (C16:1) | 0.12 | 0.46 | 0.09 | 0.42 | 0.23 |
| Oleic (C18:1n9c) | 28.4 | 4.35 | 29.9 | 6.17 | 34.2 |
| Linoleic (C18:2n6c) | 48.6 | 14.8 | 47.6 | 14.1 | 36.5 |
| α-Linolenic (C18:3n3) | 4.62 | 30.3 | 4.40 | 22.6 | 3.69 |
| SFA 2 | 16.3 | 46.3 | 16.1 | 49.9 | 23.7 |
| MUFA 2 | 28.5 | 4.81 | 29.9 | 6.59 | 34.4 |
| PUFA 2 | 53.2 | 45.1 | 52.1 | 36.6 | 40.2 |
| Gene Abbrevation | Gene | Primer | R2 | Efficiency |
|---|---|---|---|---|
| PPARG | Peroxisome proliferator-activated receptor gamma | F: CGATATCGACCAACTGAACC | 0.992 | 90.788 |
| R: AACGGTGATTTGTCTGTCGT | ||||
| SREBP-1c | Sterol regulatory element-binding protein-1c | F: GAGCCACCCTTCAACGAA | 0.999 | 100.593 |
| R: TGTCTTCTATGTCGGTCAGCA | ||||
| SCD1 | Stearoyl-CoA desaturase | F: TTATTCCGTTATGCCCTTGG | 0.997 | 94.776 |
| R: TTGTCATAAGGGCGGTATCC | ||||
| ACACA | Acetyl CoA carboxylase alfa | F: TGAAGAAGCAATGGATGAACC | 0.998 | 101.32 |
| R: TTCAGACACGGAGCCAATAA | ||||
| LPL | Lipoprotein lipase | F: CTCAGGACTCCCGAAGACAC | 0.993 | 94.257 |
| R: GTTTTGCTGCTGTGGTTGAA | ||||
| FABP4 | Fatty acid binding protein 4 | F: GGATGATAAGATGGTGCTGGA | 0.997 | 90.259 |
| R: ATCCCTTGGCTTATGCTCTCT | ||||
| ACOX | Acyl-CoA oxidase 1 | F: GCTGTCCTAAGGCGTTTGTG | 0.991 | 90.993 |
| R: ATGATGCTCCCCTGAAGAAA | ||||
| CPT2 | Carnitine Palmitoyltransferase 2 | F: CATGACTGTCTCTGCCATCC | 0.991 | 94.577 |
| R: ATCACTTTTGGCAGGGTTCA | ||||
| PPARA | Peroxisome proliferator-activated receptor alfa | F: CAATGGAGATGGTGGACACA | 0.994 | 91.665 |
| R: TTGTAGGAAGTCTGCCGAGAG | ||||
| β-Actin | β-actin | F: GTCCACCTTCCAGCAGATGT | 0.998 | 93.059 |
| R: CAGTCCGCCTAGAAGCATTT | ||||
| GAPDH | Glyceraldehyde 3 phosphate | F: CGACTTCAACAGCGACACTC | 0.994 | 92.896 |
| R: TTGTCGTACCAGGAAATGAGC |
| Finishing System | Feedlot 1 | Pasture 2 | SEM 5 | GF 6 | FS 7 | GF × FS | ||
|---|---|---|---|---|---|---|---|---|
| Growing Feed | MIN 3 | PRE 4 | MIN 3 | PRE 4 | ||||
| Hot carcass weight, kg | 297 | 297 | 272 | 285 | 13.10 | 0.124 | <0.001 | 0.096 |
| Lipid | 2.66 | 2.84 | 1.41 | 1.54 | 0.180 | 0.466 | <0.001 | 0.868 |
| Ash | 2.22 | 2.48 | 2.64 | 2.53 | 0.128 | 0.623 | 0.071 | 0.150 |
| Protein | 22.3 | 22.4 | 22.0 | 22.4 | 0.199 | 0.255 | 0.370 | 0.424 |
| Moisture | 72.8 | 72.3 | 73.9 | 73.6 | 0.296 | 0.129 | <0.001 | 0.826 |
| Finishing System | Feedlot 1 | Pasture 2 | SEM 5 | GF 6 | FS 7 | GF × FS | ||
|---|---|---|---|---|---|---|---|---|
| Growing Feed | MIN 3 | PRE 4 | MIN 3 | PRE 4 | ||||
| C12:0 | 0.92 | 0.64 | 0.62 | 0.67 | 0.108 | 0.339 | 0.241 | 0.064 |
| C14:0 | 62.90 | 45.04 | 32.14 | 34.80 | 6.824 | 0.300 | 0.001 | 0.060 |
| C15:0 | 4.94 | 4.21 | 4.04 | 4.26 | 0.563 | 0.854 | 0.440 | 0.211 |
| C16:0 | 614.60 | 495.97 | 352.85 | 354.25 | 61.644 | 0.453 | 0.000 | 0.249 |
| C17:0 | 19.69 | 15.69 | 12.33 | 12.46 | 2.202 | 0.432 | 0.003 | 0.222 |
| C18:0 | 424.43 | 364.77 | 306.54 | 324.67 | 49.170 | 0.948 | 0.068 | 0.338 |
| C14:1 | 14.27 | 9.30 | 8.87 | 8.51 | 1.840 | 0.136 | 0.056 | 0.110 |
| C15:1 | 2.20 | 1.84 | 1.88 | 1.99 | 0.265 | 0.995 | 0.959 | 0.275 |
| C16:1 | 65.54 | 53.00 | 44.79 | 41.72 | 7.339 | 0.347 | 0.010 | 0.373 |
| C17:1 | 10.38 | 9.07 | 7.81 | 7.17 | 1.026 | 0.307 | 0.005 | 0.533 |
| C18:1n9c | 857.23 | 798.07 | 584.83 | 582.47 | 85.856 | 0.873 | 0.000 | 0.491 |
| C18:2c9–t11 | 62.24 | 32.73 | 25.67 | 47.44 | 15.630 | 0.678 | 0.366 | 0.021 |
| C18:2t10–c12 | 14.93 | 13.26 | 15.55 | 14.37 | 1.247 | 0.231 | 0.267 | 0.694 |
| C18:2n6c | 107.57 | 107.58 | 131.22 | 124.87 | 10.954 | 0.838 | 0.006 | 0.555 |
| C18:3n6 | 1.05 | 0.95 | 1.09 | 1.00 | 0.079 | 0.192 | 0.334 | 0.972 |
| C18:3n3 | 6.11 | 6.53 | 7.90 | 7.22 | 0.606 | 0.675 | 0.001 | 0.261 |
| C20:2n6 | 1.67 | 1.70 | 1.46 | 1.38 | 0.124 | 0.957 | 0.005 | 0.727 |
| C20:3n6 | 4.11 | 4.30 | 5.75 | 5.01 | 0.545 | 0.504 | 0.003 | 0.182 |
| C20:3n3 | 0.32 | 0.25 | 0.24 | 0.27 | 0.040 | 0.486 | 0.481 | 0.102 |
| C20:4n6 | 19.00 | 21.33 | 27.77 | 25.75 | 2.560 | 0.922 | 0.000 | 0.122 |
| C20:5n3 | 2.45 | 2.52 | 2.70 | 2.74 | 0.229 | 0.777 | 0.164 | 0.778 |
| C22:6n3 | 1.35 | 0.60 | 0.42 | 0.62 | 0.346 | 0.509 | 0.133 | 0.119 |
| ∑SFA 8 | 1129.55 | 926.32 | 708.52 | 740.42 | 117.232 | 0.648 | 0.003 | 0.228 |
| ∑MUFA 9 | 936.63 | 871.28 | 648.18 | 641.85 | 93.766 | 0.849 | 0.001 | 0.502 |
| ∑PUFA 10 | 239.88 | 194.06 | 220.18 | 230.67 | 18.862 | 0.245 | 0.382 | 0.060 |
| ∑n6–PUFA 11 | 133.65 | 135.86 | 167.30 | 158.02 | 13.799 | 0.866 | 0.003 | 0.425 |
| ∑n3–PUFA 12 | 9.86 | 10.09 | 11.08 | 10.85 | 0.783 | 0.993 | 0.090 | 0.673 |
| n6:n3 | 12.02 | 13.42 | 14.55 | 14.70 | 0.929 | 0.286 | 0.009 | 0.312 |
| PUFA:SFA | 0.24 | 0.23 | 0.33 | 0.32 | 0.034 | 0.403 | 0.001 | 0.997 |
| Finishing System | Feedlot 3 | Pasture 4 | SEM 7 | GF 8 | FS 9 | GF × FS | ||
|---|---|---|---|---|---|---|---|---|
| Growing Feed | MIN 5 | PRE 6 | MIN 5 | PRE 6 | ||||
| Isocitrate 1 | 2645.6 | 2930.5 | 3520.4 | 3038.7 | 245.0 | 0.820 | 0.020 | 0.066 |
| NADP-Malate 2 | 47.2 | 46.5 | 48.6 | 43.6 | 3.8 | 0.472 | 0.888 | 0.554 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Torrecilhas, J.A.; Pereira, G.L.; Vito, E.S.; Fiorentini, G.; Ramirez-Zamudio, G.D.; Fonseca, L.S.; Torres, R.d.N.S.; Simioni, T.A.; Duarte, J.M.; Machado Neto, O.R.; et al. Changes in the Lipid Metabolism of the Longissimus thoracis Muscle in Bulls When Using Different Feeding Strategies during the Growing and Finishing Phases. Metabolites 2023, 13, 1042. https://doi.org/10.3390/metabo13101042
Torrecilhas JA, Pereira GL, Vito ES, Fiorentini G, Ramirez-Zamudio GD, Fonseca LS, Torres RdNS, Simioni TA, Duarte JM, Machado Neto OR, et al. Changes in the Lipid Metabolism of the Longissimus thoracis Muscle in Bulls When Using Different Feeding Strategies during the Growing and Finishing Phases. Metabolites. 2023; 13(10):1042. https://doi.org/10.3390/metabo13101042
Chicago/Turabian StyleTorrecilhas, Juliana Akamine, Guilherme Luis Pereira, Elias San Vito, Giovani Fiorentini, Germán Darío Ramirez-Zamudio, Larissa Simielli Fonseca, Rodrigo de Nazaré Santos Torres, Tiago Adriano Simioni, Juliana Messana Duarte, Otavio Rodrigues Machado Neto, and et al. 2023. "Changes in the Lipid Metabolism of the Longissimus thoracis Muscle in Bulls When Using Different Feeding Strategies during the Growing and Finishing Phases" Metabolites 13, no. 10: 1042. https://doi.org/10.3390/metabo13101042
APA StyleTorrecilhas, J. A., Pereira, G. L., Vito, E. S., Fiorentini, G., Ramirez-Zamudio, G. D., Fonseca, L. S., Torres, R. d. N. S., Simioni, T. A., Duarte, J. M., Machado Neto, O. R., Curi, R. A., Chardulo, L. A. L., Baldassini, W. A., & Berchielli, T. T. (2023). Changes in the Lipid Metabolism of the Longissimus thoracis Muscle in Bulls When Using Different Feeding Strategies during the Growing and Finishing Phases. Metabolites, 13(10), 1042. https://doi.org/10.3390/metabo13101042

