Establishment and Characterization of OFT and OFO Cell Lines from Olive Flounder (Paralichthys olivaceus) for Use as Feeder Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish and Ethics Statement
2.2. Primary Culture and Subculture
2.3. Cell Culture Medium
2.4. Validation of Cell Type from OFT and OFO
2.5. Validation of Cell Origin from OFT and OFO
2.6. Karyotyping
2.7. Sex Analysis
2.8. Electroporation
2.9. Enrichment of Male P. olivaceus GSCs by Percoll Density Gradient Centrifugation
2.10. Coculture with Germ Cells
2.11. Statistics
3. Results
3.1. Primary Cell Culture and Gene Expression Analysis of OFT and OFO
3.2. Species Identification from OFT and OFO
3.3. Karyotype Analysis of OFT and OFO
3.4. Sex Identification Analysis in OFT and OFO Cells
3.5. Transfection of Green Fluorescent Protein Vector into OFT and OFO Cells
3.6. Short-Term Coculture with Enriched Male P. olivaceus GSCs and OFT or OFO
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lubzens, E.; Young, G.; Bobe, J.; Cerdà, J. Oogenesis in Teleosts: How Fish Eggs Are Formed. Gen. Comp. Endocrinol. 2010, 165, 367–389. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.H.; Ryu, J.H.; Gong, S.P. Establishment and Optimization of an Aggregate Culture System of Testicular Cells from Marine Medaka, Oryzias dancena. J. Mar. Sci. Eng. 2023, 11, 2077. [Google Scholar] [CrossRef]
- Yoshizaki, G.; Yazawa, R. Application of Surrogate Broodstock Technology in Aquaculture. Fish. Sci. 2019, 85, 429–437. [Google Scholar] [CrossRef]
- Iwasaki-Takahashi, Y.; Shikina, S.; Watanabe, M.; Banba, A.; Yagisawa, M.; Takahashi, K.; Fujihara, R.; Okabe, T.; Valdez, D.M., Jr.; Yamauchi, A. Production of Functional Eggs and Sperm from in Vitro-Expanded Type A Spermatogonia in Rainbow Trout. Commun. Biol. 2020, 3, 308. [Google Scholar] [CrossRef]
- Hong, Y.; Liu, T.; Zhao, H.; Xu, H.; Wang, W.; Liu, R.; Chen, T.; Deng, J.; Gui, J. Establishment of a Normal Medakafish Spermatogonial Cell Line Capable of Sperm Production in Vitro. Proc. Natl. Acad. Sci. USA 2004, 101, 8011–8016. [Google Scholar] [CrossRef]
- Sun, X.; Tao, B.; Wang, Y.; Hu, W.; Sun, Y. Isolation and Characterization of Germline Stem Cells in Protogynous Hermaphroditic Monopterus albus. Int. J. Mol. Sci. 2022, 23, 5861. [Google Scholar] [CrossRef]
- Chen, X.; Kan, Y.; Zhong, Y.; Jawad, M.; Wei, W.; Gu, K.; Gui, L.; Li, M. Generation of a Normal Long-Term-Cultured Chinese Hook Snout Carp Spermatogonial Stem Cell Line Capable of Sperm Production in Vitro. Biology 2022, 11, 1069. [Google Scholar] [CrossRef]
- Zhong, C.; Tao, Y.; Liu, M.; Wu, X.; Yang, Y.; Wang, T.; Meng, Z.; Xu, H.; Liu, X. Establishment of a Spermatogonial Stem Cell Line with Potential of Meiosis in a Hermaphroditic Fish, Epinephelus Coioides. Cells 2022, 11, 2868. [Google Scholar] [CrossRef]
- Tan, L.; Liu, Q.; He, Y.; Zhang, J.; Hou, J.; Ren, Y.; Ma, W.; Wang, Q.; Shao, C. Establishment and Characterization of a Spermatogonial Stem Cell Line from Tiger Puffer Fish (Takifugu Rubripes). Animals 2023, 13, 2959. [Google Scholar] [CrossRef]
- Kawasaki, T.; Saito, K.; Sakai, C.; Shinya, M.; Sakai, N. Production of Zebrafish Offspring from Cultured Spermatogonial Stem Cells. Genes Cells 2012, 17, 316–325. [Google Scholar] [CrossRef]
- Wong, T.-T.; Tesfamichael, A.; Collodi, P. Production of Zebrafish Offspring from Cultured Female Germline Stem Cells. PLoS ONE 2013, 8, e62660. [Google Scholar] [CrossRef] [PubMed]
- Cho, S.; Kim, K.; Choi, I.; Jeon, G.; Kim, D. Compensatory Growth of Grower Olive Flounder (Paralichthys olivaceus) with Different Feeding Regime at Suboptimal Temperature. Asian-Australas. J. Anim. Sci. 2012, 25, 272. [Google Scholar] [CrossRef]
- Park, J.-W.; Lee, D.-I.; Jung, H.S.; Kim, J.; Yang, H.-R.; Lee, J.-H. Estimation of Genetic Parameters and Improvements for Growth Traits of Selected Olive Flounder Paralichthys olivaceus. Korean J. Fish. Aquat. Sci. 2021, 54, 974–981. [Google Scholar]
- Hwa, J.C.; Sum, R. Triploidy Induction in Olive Flounder, Paralichthys olivaceus. J. Aquac. 1994, 7, 55–61. [Google Scholar]
- Ko, M.G.; Jung, H.S.; Lee, H.B.; Kim, D.S. Cytogenetic Analysis of All-Female Triploid Olive Flounder Paralichthys olivaceus for Ploidy Verification. Korean J. Fish. Aquat. Sci. 2016, 49, 671–674. [Google Scholar]
- Kim, J.; Cho, J.Y.; Kim, J.-W.; Kim, H.-C.; Noh, J.K.; Kim, Y.-O.; Hwang, H.-K.; Kim, W.-J.; Yeo, S.-Y.; An, C.M. CRISPR/Cas9-Mediated Myostatin Disruption Enhances Muscle Mass in the Olive Flounder Paralichthys olivaceus. Aquaculture 2019, 512, 734336. [Google Scholar] [CrossRef]
- Chen, S.; Ye, H.; Sha, Z.; Hong, Y. Derivation of a Pluripotent Embryonic Cell Line from Red Sea Bream Blastulas. J. Fish Biol. 2003, 63, 795–805. [Google Scholar] [CrossRef]
- Ryu, J.H.; Gong, S.P. Effects of the Developmental Stage of Extract Donor Embryos on the Culture of Marine Medaka Oryzias dancena Embryonic Stem Cell-like Cells. Korean J. Fish. Aquat. Sci. 2017, 50, 160–168. [Google Scholar]
- Choi, J.H.; Kim, E.J.; Park, C.-J.; Nam, Y.K.; Gong, S.P. Evaluation of Using Veliger Stage Larvae for the Preparation of Metaphase Spreads from the Pacific Abalone (Haliotis discus hannai). J. Anim. Reprod. Biotechnol. 2020, 35, 223–231. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar]
- Dettin, L.; Ravindranath, N.; Hofmann, M.-C.; Dym, M. Morphological Characterization of the Spermatogonial Subtypes in the Neonatal Mouse Testis. Biol. Reprod. 2003, 69, 1565–1571. [Google Scholar] [CrossRef]
- Peng, L.; Zheng, Y.; You, F.; Wu, Z.; Zou, Y.; Zhang, P. Establishment and Characterization of a Testicular Sertoli Cell Line from Olive Flounder Paralichthys olivaceus. Chin. J. Oceanol. Limnol. 2016, 34, 1054–1063. [Google Scholar] [CrossRef]
- Higaki, S.; Koyama, Y.; Shirai, E.; Yokota, T.; Fujioka, Y.; Sakai, N.; Takada, T. Establishment of Testicular and Ovarian Cell Lines from Honmoroko (Gnathopogon caerulescens). Fish Physiol. Biochem. 2013, 39, 701–711. [Google Scholar] [CrossRef] [PubMed]
- Mohapatra, S.; Liu, Z.; Zhou, L.; Zhang, Y.; Wang, D. Molecular Cloning of Wt1a and Wt1b and Their Possible Involvement in Fish Sex Determination and Differentiation. Indian J. Sci. Technol. 2011, 4, 85–86. [Google Scholar]
- Sun, A.; Wang, T.; Wang, N.; Liu, X.; Sha, Z.; Chen, S. Establishment and Characterization of an Ovarian Cell Line from Half-smooth Tongue Sole Cynoglossus semilaevis. J. Fish Biol. 2015, 86, 46–59. [Google Scholar] [CrossRef] [PubMed]
- Morimoto, H.; Kanatsu-Shinohara, M.; Shinohara, T. WIN18, 446 Enhances Spermatogonial Stem Cell Homing and Fertility after Germ Cell Transplantation by Increasing Blood-Testis Barrier Permeability. J. Reprod. Dev. 2023, 69, 347–355. [Google Scholar] [CrossRef]
- Gómez, M.; Manzano, A.; Figueras, A.; Viñals, F.; Ventura, F.; Rosa, J.L.; Bartrons, R.; Navarro-Sabaté, À. Sertoli-Secreted FGF-2 Induces PFKFB4 Isozyme Expression in Mouse Spermatogenic Cells by Activation of the MEK/ERK/CREB Pathway. Am. J. Physiol. Endocrinol. Metab. 2012, 303, E695–E707. [Google Scholar] [CrossRef]
- Kumar, S.; Singla, S.K.; Manik, R.; Palta, P.; Chauhan, M.S. Effect of Basic Fibroblast Growth Factor (FGF2) on Cumulus Cell Expansion, in Vitro Embryo Production and Gene Expression in Buffalo (Bubalus bubalis). Reprod. Biol. 2020, 20, 501–511. [Google Scholar] [CrossRef]
- Ahmed, I.; Huebner, H.; Mamoori, Y.; Buchholz, R. Identification of Newly Established Spodoptera Littoralis Cell Lines by Two DNA Barcoding Markers. Vitro Cell. Dev. Biol. Anim. 2017, 53, 288–292. [Google Scholar] [CrossRef]
- Xu, Y.; Zhong, Z.; Zhang, Z.; Feng, Y.; Zhao, L.; Jiang, Y.; Wang, Y. Establishment and Characterization of the Gonadal Cell Lines Derived from Large Yellow Croaker (Larimichthys crocea) for Gene Expression Studies. Aquaculture 2022, 546, 737300. [Google Scholar] [CrossRef]
- Zeng, W.; Dong, H.; Chen, X.; Bergmann, S.M.; Yang, Y.; Wei, X.; Tong, G.; Li, H.; Yu, H.; Chen, Y. Establishment and Characterization of a Permanent Heart Cell Line from Largemouth Bass Micropterus salmoides and Its Application to Fish Virology and Immunology. Aquaculture 2022, 547, 737427. [Google Scholar] [CrossRef]
- Zheng, Y.; Peng, L.; You, F.; Zou, Y.; Zhang, P.; Chen, S. Establishment and Characterization of a Fish-cell Line from the Brain of Japanese Flounder Paralichthys olivaceus. J. Fish Biol. 2015, 87, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-W.; Cho, J.Y.; Kim, D.-G.; Nam, B.-H.; Nho, E.-S.; Kim, B.-S.; Kim, Y.-O.; Kong, H.J. Establishment of Conditions for Long-Term Maintenance of Primary Embryonic Cell Cultures from Olive Flounder Paralichthys olivaceus. Dev. Reprod. 2020, 24, 207. [Google Scholar] [CrossRef] [PubMed]
- Swaminathan, T.R.; Lakra, W.S.; Gopalakrishnan, A.; Basheer, V.; Khushwaha, B.; Sajeela, K. Development and Characterization of a New Epithelial Cell Line PSF from Caudal Fin of Green Chromide, Etroplus suratensis (Bloch, 1790). Vitro Cell. Dev. Biol. Anim. 2010, 46, 647–656. [Google Scholar] [CrossRef]
- Wang, X.; Liu, Q.; Xiao, Y.; Yang, Y.; Wang, Y.; Song, Z.; You, F.; An, H.; Li, J. High Temperature Causes Masculinization of Genetically Female Olive Flounder (Paralichthys olivaceus) Accompanied by Primordial Germ Cell Proliferation Detention. Aquaculture 2017, 479, 808–816. [Google Scholar] [CrossRef]
- Kim, W.-J.; Nam, B.-H.; An, C.M.; Kim, H.-C.; Kong, H.J.; Kim, Y.-O.; Kim, K.K. Genetic Marker and Method for Identifying the Sex in the Olive Flounder. KR101770966B1, 31 December 2017. [Google Scholar]
- Lee, J.H.; Lee, S.T.; Nam, Y.K.; Gong, S.P. Gene Delivery into Siberian Sturgeon Cell Lines by Commercial Transfection Reagents. Vitro Cell. Dev. Biol. Anim. 2019, 55, 76–81. [Google Scholar] [CrossRef]
- Parameswaran, V.; Ishaq Ahmed, V.; Shukla, R.; Bhonde, R.; Sahul Hameed, A. Development and Characterization of Two New Cell Lines from Milkfish (Chanos chanos) and Grouper (Epinephelus coioides) for Virus Isolation. Mar. Biotechnol. 2007, 9, 281–291. [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, W.-W.; Mo, C.-Y.; Dong, M.-D.; Jia, K.-T.; Liu, W.; Yi, M.-S. Production of Functional Sperm from in Vitro-Cultured Premeiotic Spermatogonia in a Marine Fish. Zool. Res. 2022, 43, 537. [Google Scholar] [CrossRef]
- Shang, M.; Su, B.; Perera, D.A.; Alsaqufi, A.; Lipke, E.A.; Cek, S.; Dunn, D.A.; Qin, Z.; Peatman, E.; Dunham, R.A. Testicular Germ Line Cell Identification, Isolation, and Transplantation in Two North American Catfish Species. Fish Physiol. Biochem. 2018, 44, 717–733. [Google Scholar] [CrossRef]
- Dias, G.C.; Batlouni, S.R.; Cassel, M.; Chehade, C.; De Jesus, L.W.; Branco, G.S.; Camargo, M.P.; Borella, M.I. Isolation, in Vitro Study, and Stem Cell Markers for Type A Spermatogonia in a Characiformes Species. Mol. Reprod. Dev. 2020, 87, 783–799. [Google Scholar] [CrossRef]
- Lacerda, S.; Martinez, E.R.M.; Mura, I.; Doretto, L.B.; Costa, G.M.; Silva, M.; Digmayer, M.; Nóbrega, R.; França, L. Duration of Spermatogenesis and Identification of Spermatogonial Stem Cell Markers in a Neotropical Catfish, Jundiá (Rhamdia quelen). Gen. Comp. Endocrinol. 2019, 273, 249–259. [Google Scholar] [CrossRef]
- Ren, Y.; Tao, Y.; Sun, Z.; Wang, Y.; Li, W.; He, Z.; Wang, G.; Yang, Y.; Hou, J. Evaluation of Female Recipient Infertility and Donor Spermatogonial Purification for Germ Cell Transplantation in Paralichthys olivaceus. Animals 2024, 14, 2887. [Google Scholar] [CrossRef] [PubMed]
- Costoya, J.A.; Hobbs, R.M.; Barna, M.; Cattoretti, G.; Manova, K.; Sukhwani, M.; Orwig, K.E.; Wolgemuth, D.J.; Pandolfi, P.P. Essential Role of Plzf in Maintenance of Spermatogonial Stem Cells. Nat. Genet. 2004, 36, 653–659. [Google Scholar] [CrossRef]
- Jemc, J.C. Somatic Gonadal Cells: The Supporting Cast for the Germline. Genesis 2011, 49, 753–775. [Google Scholar] [CrossRef] [PubMed]
- Lenhart, K.F.; DiNardo, S. Somatic Cell Encystment Promotes Abscission in Germline Stem Cells Following a Regulated Block in Cytokinesis. Dev. Cell 2015, 34, 192–205. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′>3′) | Product Size (bp) | Accession Number | |
---|---|---|---|---|
vasa | Forward | CAGGACAGCACAGCGAAGAG | 141 | JQ070418.1 |
Reverse | GCAACAAGCTAAACAGCAAATAAGAG | |||
nanos2 | Forward | CGGACCACTGTCGCTTCTG | 159 | XM_020087405.1 |
Reverse | ACCGGCGTGTGTGTGCTT | |||
scp3 | Forward | TGGCTACCGTCCGCAAGT | 154 | XM_020090502.1 |
Reverse | CGATATGAACACGAACCAAATTAAGT | |||
wt1 | Forward | TGTTTGGTTGCCACAATCCTT | 101 | XM_020098636.1 |
Reverse | CAGCTGAGATGCCATTTGGTATAC | |||
gsdf | Forward | CCTGAGATGAACACTGTGCAATG | 151 | KY123266.1 |
Reverse | GCACGGAGGAAATGATGACTGT | |||
fgf2 | Forward | AAGACAAAGAAGAAGATGTGAAGACAGA | 200 | XM_020105694.1 |
Reverse | AAGGCACCTGGCTGCAGTT | |||
18s rRNA | Forward | ATGGCCGTTCTTAGTTGGTG | 218 | EF126037.1 |
Reverse | CACACGCTGATCCAGTCAGT | |||
plzf | Forward | TCCTCTTCCACCGCAACAG | 79 | XM_020097052.1 |
Reverse | GCATACTCCAAAATCTGCTGAAAA | |||
COI | Forward | TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC | 650 | NC_082846.1 |
Reverse | CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA | |||
16s rRNA | Forward | CCGGTCTGAACTCAGATCACGT | 542 | NC_082846.1 |
Reverse | CGCCTGTTTATCAAAAACAT |
Primer Name | Primer Sequence (5′>3′) | Product Size (bp) |
---|---|---|
5227A | TCAAATGGCATAGATGGACA | 116 |
5227T | TCAAATGGCATAGATGGACT | |
5227 | TCATGCGGTAATTGCTTTGTA | |
5227-FAM | FAM-ATGCGGACGAGTAGTTCATTCGAA-EBQ | 170 |
8483C | AGTCCACATTTACGAGAGTTC | |
8483T | AGTCCACATTTACGAGAGTTT | |
8483 | GATGAACGAGAAATTAGATTTCCCCG | |
8483-JOE | JOE-GCTTACGGAGGGCAGCTAGCAACGA-EBQ | |
5512 | ATGGCCTGGATTGCATCAAC | 154 |
5512T | ATGGCCTGGATTGCATCAAT | |
5512 | CTTAGCATAAGGAACCCACGTC | |
5512-CY5 | CY5-TTCCGACGCGTTGTACACGGGCAA-EBQ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jo, J.Y.; Kim, J.-W.; Noh, E.S.; Kim, Y.-O.; Gong, S.P.; Kong, H.J.; Choi, J.H. Establishment and Characterization of OFT and OFO Cell Lines from Olive Flounder (Paralichthys olivaceus) for Use as Feeder Cells. Biology 2025, 14, 229. https://doi.org/10.3390/biology14030229
Jo JY, Kim J-W, Noh ES, Kim Y-O, Gong SP, Kong HJ, Choi JH. Establishment and Characterization of OFT and OFO Cell Lines from Olive Flounder (Paralichthys olivaceus) for Use as Feeder Cells. Biology. 2025; 14(3):229. https://doi.org/10.3390/biology14030229
Chicago/Turabian StyleJo, Ja Young, Ju-Won Kim, Eun Soo Noh, Yong-Ok Kim, Seung Pyo Gong, Hee Jeong Kong, and Jae Hoon Choi. 2025. "Establishment and Characterization of OFT and OFO Cell Lines from Olive Flounder (Paralichthys olivaceus) for Use as Feeder Cells" Biology 14, no. 3: 229. https://doi.org/10.3390/biology14030229
APA StyleJo, J. Y., Kim, J.-W., Noh, E. S., Kim, Y.-O., Gong, S. P., Kong, H. J., & Choi, J. H. (2025). Establishment and Characterization of OFT and OFO Cell Lines from Olive Flounder (Paralichthys olivaceus) for Use as Feeder Cells. Biology, 14(3), 229. https://doi.org/10.3390/biology14030229