Transcriptional Responses of Lacticaseibacillus rhamnosus to TNFα, IL-6, IL-8, and IL-10 Cytokines
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strain and Growth Condition
2.2. The Effect of Pro-Inflammatory and Anti-Inflammatory Cytokines on the L. rhamnosus Strain
2.3. RNA Extraction
2.4. Preparation of Transcriptomic Libraries and RNA Sequencing
2.5. Data Processing and Analysis
2.6. Phylogenetic Profiling
2.7. Quantitative Real-Time PCR
3. Results
3.1. Investigating the Impact of Pro-Inflammatory and Anti-Inflammatory Cytokines on L. rhamnosus K32 Growth
3.2. Advancing Understanding of Lactobacillus Response to Cytokines Through Transcriptome Sequencing
3.3. Differences in Gene Transcription Profiles
3.4. Functional Annotation of DEGs
3.5. Evolutionarily Stable Gene Groups and Transcriptional Organization of DEGs
3.6. The Impact of IL-8 and IL-10 on L. rhamnosus R19-3
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hou, K.; Wu, Z.X.; Chen, X.Y.; Wang, J.Q.; Zhang, D.; Xiao, C.; Zhu, D.; Koya, J.B.; Wei, L.; Li, J.; et al. Microbiota in health and diseases. Signal Transduct. Target. Ther. 2022, 7, 1–28. [Google Scholar] [CrossRef] [PubMed]
- Belkaid, Y.; Hand, T.W. Role of the Microbiota in Immunity and Inflammation. Cell 2014, 157, 121–141. [Google Scholar] [CrossRef] [PubMed]
- Zheng, D.; Liwinski, T.; Elinav, E. Interaction between microbiota and immunity in health and disease. Cell Res. 2020, 30, 492–506. [Google Scholar] [CrossRef]
- Ansaldo, E.; Farley, T.K.; Belkaid, Y. Control of Immunity by the Microbiota. Annu. Rev. Immunol. 2021, 39, 449–479. [Google Scholar] [CrossRef]
- Lesouhaitier, O.; Veron, W.; Chapalain, A.; Madi, A.; Blier, A.S.; Dagorn, A.; Connil, N.; Chevalier, S.; Orange, N.; Feuilloley, M. Gram-Negative Bacterial Sensors for Eukaryotic Signal Molecules. Sensors 2009, 9, 6967–6990. [Google Scholar] [CrossRef]
- Wolfson, B.; Hetrick, W.D.; Lake, C.L.; Siker, E.S.; Porat, R.; Clark, B.D.; Wolff, S.M.; Dinarello, C.A. Enhancement of Growth of Virulent Strains of Escherichia coli by Interleukin-1. Science 1991, 254, 430–432. [Google Scholar] [CrossRef]
- Denis, M.; Campbell, D.; Gregg, E.O. Interleukin-2 and granulocyte-macrophage colony-stimulating factor stimulate growth of a virulent strain of Escherichia coli. Infect. Immun. 1991, 59, 1853. [Google Scholar] [CrossRef]
- Umberto Meduri, G.; Kanangat, S.; Stefan, J.; Tolley, E.; Schaberg, D. Cytokines IL-1β, IL-6, and TNF-α enhance in vitro growth of bacteria. Am. J. Respir. Crit. Care Med. 1999, 160, 961–967. [Google Scholar] [CrossRef]
- Luo, G.; Niesel, D.W.; Shaban, R.A.; Grimm, E.A.; Klimpel, G.R. Tumor necrosis factor alpha binding to bacteria: Evidence for a high- affinity receptor and alteration of bacterial virulence properties. Infect. Immun. 1993, 61, 830–835. [Google Scholar] [CrossRef]
- Kanangat, S.; Postlethwaite, A.; Cholera, S.; Williams, L.; Schaberg, D. Modulation of virulence gene expression in Staphylococcus aureus by interleukin-1β: Novel implications in bacterial pathogenesis. Microbes Infect. 2007, 9, 408–415. [Google Scholar] [CrossRef]
- Paino, A.; Lohermaa, E.; Sormunen, R.; Tuominen, H.; Korhonen, J.; Pöllänen, M.T.; Ihalin, R. Interleukin-1β is internalised by viable Aggregatibacter actinomycetemcomitans biofilm and locates to the outer edges of nucleoids. Cytokine 2012, 60, 565–574. [Google Scholar] [CrossRef] [PubMed]
- Mahdavi, J.; Royer, P.J.; Sjölinder, H.S.; Azimi, S.; Self, T.; Stoof, J.; Wheldon, L.M.; Brännström, K.; Wilson, R.; Moreton, J.; et al. Pro-inflammatory cytokines can act as intracellular modulators of commensal bacterial virulence. Open Biol. 2013, 3, 130048. [Google Scholar] [CrossRef]
- Belkaid, Y.; Harrison, O.J. Homeostatic Immunity and the Microbiota. Immunity 2017, 46, 562–576. [Google Scholar] [CrossRef]
- Duar, R.M.; Lin, X.B.; Zheng, J.; Martino, M.E.; Grenier, T.; Pérez-Muñoz, M.E.; Leulier, F.; Gänzle, M.; Walter, J. Lifestyles in transition: Evolution and natural history of the genus Lactobacillus. FEMS Microbiol. Rev. 2017, 41, S27–S48. [Google Scholar] [CrossRef]
- Han, K.J.; Lee, J.E.; Lee, N.K.; Paik, H.D. Antioxidant and Anti-Inflammatory Effect of Probiotic Lactobacillus plantarum KU15149 Derived from Korean Homemade Diced-Radish Kimchi. J. Microbiol. Biotechnol. 2020, 30, 591–598. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Wang, H.; Liu, Z.; Liu, Y.; DeJi; Li, B.; Huang, X. Recent Perspective of Lactobacillus in Reducing Oxidative Stress to Prevent Disease. Antioxidants 2023, 12, 769. [Google Scholar] [CrossRef]
- Salvetti, E.; O’Toole, P.W. When regulation challenges innovation: The case of the genus Lactobacillus. Trends Food Sci. Technol. 2017, 66, 187–194. [Google Scholar] [CrossRef]
- Yang, J.; Tang, Q.; Xu, L.; Li, Z.; Ma, Y.; Yao, D. Combining of transcriptome and metabolome analyses for understanding the utilization and metabolic pathways of Xylo-oligosaccharide in Bifidobacterium adolescentis ATCC 15703. Food Sci. Nutr. 2019, 7, 3480–3493. [Google Scholar] [CrossRef]
- Gou, W.; Fu, Y.; Yue, L.; Chen, G.; Cai, X.; Shuai, M.; Xu, F.; Yi, X.; Chen, H.; Zhu, Y.; et al. Gut microbiota may underlie the predisposition of healthy individuals to COVID-19. medRxiv, 2020. [Google Scholar] [CrossRef]
- Zheng, H.; Liu, E.; Shi, T.; Ye, L.; Konno, T.; Oda, M.; Ji, Z.S. Strand-specific RNA-seq analysis of the Lactobacillus delbrueckii subsp. bulgaricus transcriptome. Mol. Biosyst. 2016, 12, 508–519. [Google Scholar] [CrossRef]
- Liu, Z.S.; Lin, C.F.; Chen, P.W. Transcriptome analysis of Lactobacillus rhamnosus GG strain treated with prebiotic—Bovine lactoferrin under a cold environment. J. Food Drug Anal. 2021, 29, 402–418. [Google Scholar] [CrossRef]
- Peng, L.; Zhao, K.; Chen, S.; Ren, Z.; Wei, H.; Wan, C. Whole genome and acid stress comparative transcriptome analysis of Lactiplantibacillus plantarum ZDY2013. Arch. Microbiol. 2021, 203, 2795–2807. [Google Scholar] [CrossRef] [PubMed]
- Bang, M.; Yong, C.C.; Ko, H.J.; Choi, I.G.; Oh, S. Transcriptional Response and Enhanced Intestinal Adhesion Ability of Lactobacillus rhamnosus GG after Acid Stress. J. Microbiol. Biotechnol. 2018, 28, 1604–1613. [Google Scholar] [CrossRef] [PubMed]
- Babraham Bioinformatics—FastQC A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 10 April 2024).
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-Based Genome Alignment and Genotyping with HISAT2 andHISAT-genotype. Nat. Biotechnol. 2019, 37, 907. [Google Scholar] [CrossRef]
- García-Alcalde, F.; Okonechnikov, K.; Carbonell, J.; Cruz, L.M.; Götz, S.; Tarazona, S.; Dopazo, J.; Meyer, T.F.; Conesa, A. Qualimap: Evaluating next-generation sequencing alignment data. Bioinformatics 2012, 28, 2678–2679. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M. Twelve years of SAMtools and BCFtools. Gigascience 2021, 10, 1–4. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Wickham, H. ggplot2; Springer: Cham, Switzerland, 2016. [Google Scholar] [CrossRef]
- Mangiola, S.; Papenfuss, A.T. tidyHeatmap: An R package for modular heatmap production based on tidy principles. J. Open Source Softw. 2020, 5, 2472. [Google Scholar] [CrossRef]
- Galperin, M.Y.; Wolf, Y.I.; Makarova, K.S.; Alvarez, R.V.; Landsman, D.; Koonin, E.V. COG database update: Focus on microbial diversity, model organisms, and widespread pathogens. Nucleic Acids Res. 2021, 49, D274. [Google Scholar] [CrossRef]
- Sequeira, J.C.; Rocha, M.; Alves, M.M.; Salvador, A.F. UPIMAPI, reCOGnizer and KEGGCharter: Bioinformatics tools for functional annotation and visualization of (meta)-omics datasets. Comput. Struct. Biotechnol. J. 2022, 20, 1798. [Google Scholar] [CrossRef]
- Emms, D.M.; Kelly, S. OrthoFinder: Phylogenetic orthology inference for comparative genomics. Genome Biol. 2019, 20, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Krasnov, G.S.; Oparina, N.Y.; Dmitriev, A.A.; Kudryavtseva, A.V.; Anedchenko, E.A.; Kondrat’eva, T.T.; Zabarovsky, E.R.; Senchenko, V.N. RPN1, a new reference gene for quantitative data normalization in lung and kidney cancer. Mol. Biol. 2011, 45, 211–220. [Google Scholar] [CrossRef]
- Senchenko, V.N.; Krasnov, G.S.; Dmitriev, A.A.; Kudryavtseva, A.V.; Anedchenko, E.A.; Braga, E.A.; Pronina, I.V.; Kondratieva, T.T.; Ivanov, S.V.; Zabarovsky, E.R.; et al. Differential Expression of CHL1 Gene during Development of Major Human Cancers. PLoS ONE 2011, 6, e15612. [Google Scholar] [CrossRef] [PubMed]
- Averina, O.V.; Ermolenko, E.I.; Ratushniy, A.Y.; Tarasova, E.A.; Borschev, Y.Y.; Leontieva, G.F.; Kramskaya, T.A.; Kotyleva, M.P.; Danilenko, V.N.; Suvorov, A.N. Influence of probiotics on cytokine production in the in Vitro and in Vivo Systems. Med. Immunol. 2015, 17, 443–454. [Google Scholar] [CrossRef]
- Coenye, T. Do results obtained with RNA-sequencing require independent verification? Biofilm 2021, 3, 100043. [Google Scholar] [CrossRef]
- Chaiwut, R.; Kasinrerk, W. Very low concentration of lipopolysaccharide can induce the production of various cytokines and chemokines in human primary monocytes. BMC Res. Notes 2022, 15, 1–8. [Google Scholar] [CrossRef]
- Veselovsky, V.A.; Dyachkova, M.S.; Menyaylo, E.A.; Polyaeva, P.S.; Olekhnovich, E.I.; Shitikov, E.A.; Bespiatykh, D.A.; Semashko, T.A.; Kasianov, A.S.; Ilina, E.N.; et al. Gene Networks Underlying the Resistance of Bifidobacterium longum to Inflammatory Factors. Front. Immunol. 2020, 11, 595877. [Google Scholar] [CrossRef]
- Thaweboon, B.; Thaweboon, S.; Choonharuangdej, S.; Suppakpatana, P. Effects of sonicated Prevotella intermedia, Fusobacterium nucleatum and Lactobacillus casei extracts on interleukin-8 production by human dental pulp cells. Southeast Asian J. Trop. Med. Public Health 2006, 37, 523–527. [Google Scholar]
- Balejko, E.; Kucharska, E.; Balejko, J. Experimental immunologyEffect of Lactobacillus rhamnosus GG encapsulation on interleukin 10 release in vitro. Cent. Eur. J. Immunol. 2013, 38, 37–41. [Google Scholar] [CrossRef]
- Prioult, G.; Pecquet, S.; Fliss, I. Stimulation of Interleukin-10 Production by Acidic β-Lactoglobulin-Derived Peptides Hydrolyzed with Lactobacillus paracasei NCC2461 Peptidases. Clin. Diagn. Lab. Immunol. 2004, 11, 266. [Google Scholar] [CrossRef]
- Lopez, M.; Li, N.; Kataria, J.; Russell, M.; Neu, J. Live and ultraviolet-inactivated Lactobacillus rhamnosus GG decrease flagellin-induced interleukin-8 production in Caco-2 cells. J. Nutr. 2008, 138, 2264–2268. [Google Scholar] [CrossRef]
- Kopp, M.V.; Goldstein, M.; Dietschek, A.; Sofke, J.; Heinzmann, A.; Urbanek, R. Lactobacillus GG has in vitro effects on enhanced interleukin-10 and interferon-gamma release of mononuclear cells but no in vivo effects in supplemented mothers and their neonates. Clin. Exp. Allergy 2008, 38, 602–610. [Google Scholar] [CrossRef]
- Peral, M.C.; Rachid, M.M.; Gobbato, N.M.; Huaman Martinez, M.A.; Valdez, J.C. Interleukin-8 production by polymorphonuclear leukocytes from patients with chronic infected leg ulcers treated with Lactobacillus plantarum. Clin. Microbiol. Infect. 2010, 16, 281–286. [Google Scholar] [CrossRef]
- Kim, H.G.; Gim, M.G.; Kim, J.Y.; Jin Hwang, H.; Ham, M.S.; Lee, J.M.; Hartung, T.; Park, J.W.; Han, S.H.; Chung, D.K. Lipoteichoic acid from Lactobacillus plantarum elicits both the production of interleukin-23p19 and suppression of pathogen-mediated interleukin-10 in THP-1 cells. FEMS Immunol. Med. Microbiol. 2007, 49, 205–214. [Google Scholar] [CrossRef]
- Mirpuri, J.; Sotnikov, I.; Myers, L.; Denning, T.L.; Yarovinsky, F.; Parkos, C.A.; Denning, P.W.; Louis, N.A. Lactobacillus rhamnosus (LGG) Regulates IL-10 Signaling in the Developing Murine Colon through Upregulation of the IL-10R2 Receptor Subunit. PLoS ONE 2012, 7, e51955. [Google Scholar] [CrossRef]
- Ma, X.; Shin, Y.J.; Jang, H.M.; Joo, M.K.; Yoo, J.W.; Kim, D.H. Lactobacillus rhamnosus and Bifidobacterium longum alleviate colitis and cognitive impairment in mice by regulating IFN-γ to IL-10 and TNF-α to IL-10 expression ratios. Sci. Rep. 2021, 11, 1–16. [Google Scholar] [CrossRef]
- Tuo, Y.; Song, X.; Song, Y.; Liu, W.; Tang, Y.; Gao, Y.; Jiang, S.; Qian, F.; Mu, G. Screening probiotics from Lactobacillus strains according to their abilities to inhibit pathogen adhesion and induction of pro-inflammatory cytokine IL-8. J. Dairy Sci. 2018, 101, 4822–4829. [Google Scholar] [CrossRef]
- Boonma, P.; Spinler, J.K.; Venable, S.F.; Versalovic, J.; Tumwasorn, S. Lactobacillus rhamnosus L34 and Lactobacillus casei L39 suppress Clostridium difficile-induced IL-8 production by colonic epithelial cells. BMC Microbiol. 2014, 14, 1–11. [Google Scholar] [CrossRef]
- Yeganegi, M.; Leung, C.G.; Martins, A.; Kim, S.O.; Reid, G.; Challis, J.R.G.; Bocking, A.D. Lactobacillus rhamnosus GR-1-induced IL-10 production in human placental trophoblast cells involves activation of JAK/STAT and MAPK pathways. Reprod. Sci. 2010, 17, 1043–1051. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, N.; Caicedo, R.; Neu, J. Alive and dead Lactobacillus rhamnosus GG decrease tumor necrosis factor-alpha-induced interleukin-8 production in Caco-2 cells. J. Nutr. 2005, 135, 1752–1756. [Google Scholar] [CrossRef] [PubMed]
- Justiz Vaillant, A.A.; Qurie, A. Interleukin; StatPearls: Treasure Island, FL, USA, 2023. Available online: https://pubmed.ncbi.nlm.nih.gov/29763015/ (accessed on 12 May 2023).
- Högbom, M.; Ihalin, R. Functional and structural characteristics of bacterial proteins that bind host cytokines. Virulence 2017, 8, 1592. [Google Scholar] [CrossRef]
- Zav’yalov, V.P.; Chernovskaya, T.V.; Navolotskaya, E.V.; Karlyshev, A.V.; MacIntyre, S.; Vasiliev, A.M.; Abramov, V.M. Specific high affinity binding of human interleukin 1β by Caf1A usher protein of Yersinia pestis. FEBS Lett. 1995, 371, 65–68. [Google Scholar] [CrossRef]
- Wu, L.; Estrada, O.; Zaborina, O.; Bains, M.; Shen, L.; Kohler, J.E.; Patel, N.; Musch, M.W.; Chang, E.B.; Fu, Y.X.; et al. Microbiology: Recognition of host immune activation by Pseudomonas aeruginosa. Science 2005, 309, 774–777. [Google Scholar] [CrossRef]
- Tao, J.J.; Li, S.H.; Wu, J.H.; Peng, X.X.; Li, H. pts promoter influences antibiotic resistance via proton motive force and ROS in Escherichia coli. Front. Microbiol. 2023, 14, 1276954. [Google Scholar] [CrossRef]
- Molloy, M.J.; Grainger, J.R.; Bouladoux, N.; Hand, T.W.; Koo, L.Y.; Naik, S.; Quinones, M.; Dzutsev, A.K.; Gao, J.L.; Trinchieri, G.; et al. Intraluminal Containment of Commensal Outgrowth in the Gut during Infection-Induced Dysbiosis. Cell Host Microbe 2013, 14, 318–328. [Google Scholar] [CrossRef]
- Aghamohamadi, E.; Asri, N.; Odak, A.; Rostami-Nejad, M.; Chaleshi, V.; Hajinabi, Y.; Eslami, M.; Mohammadian Haftcheshmeh, S.; Gholam-Mostafaei, F.S.; Asadzadeh-Aghdaei, H.; et al. Gene expression analysis of intestinal IL-8, IL-17 A and IL-10 in patients with celiac and inflammatory bowel diseases. Mol. Biol. Rep. 2022, 49, 6085–6091. [Google Scholar] [CrossRef]
- Mitselou, A.; Grammeniatis, V.; Varouktsi, A.; Papadatos, S.S.; Katsanos, K.; Galani, V. Proinflammatory cytokines in irritable bowel syndrome: A comparison with inflammatory bowel disease. Intest. Res. 2020, 18, 115–120. [Google Scholar] [CrossRef]
- Lammers, K.M.; Jansen, J.; Bijlsma, P.B.; Ceska, M.; Tytgat, G.N.J.; Laboisse, C.L.; Van Deventer, S.J.H. Polarised interleukin 8 secretion by HT 29/19A cells. Gut 1994, 35, 338–342. [Google Scholar] [CrossRef][Green Version]
- Fusunyan, R.D.; Quinn, J.J.; Ohno, Y.; MacDermott, R.P.; Sanderson, I.R. Butyrate Enhances Interleukin (IL)-8 Secretion by Intestinal Epithelial Cells in Response to IL-1β and Lipopolysaccharide. Pediatr. Res. 1998, 43, 84–90. [Google Scholar] [CrossRef] [PubMed]
- Keshavarzian, A.; Fusunyan, R.D.; Jacyno, M.; Winship, D.; MacDermott, R.P.; Sanderson, I.R. Increased Interleukin-8 (II-8) in Rectal Dialysate From Patients With Ulcerative Colitis: Evidence for A Biological Role for IL-8 in Inflammation of The Colon. Am. J. Gastroenterol. 1999, 94, 704–712. [Google Scholar] [CrossRef]
- Jakubczyk, D.; Leszczyńska, K.; Górska, S. The Effectiveness of Probiotics in the Treatment of Inflammatory Bowel Disease (IBD)—A Critical Review. Nutrients 2020, 12, 1973. [Google Scholar] [CrossRef]
- e Silva, N.O.; de Brito, B.B.; da Silva, F.A.F.; Santos, M.L.C.; de Melo, F.F. Probiotics in inflammatory bowel disease: Does it work? World J. Meta-Anal. 2020, 8, 54–66. [Google Scholar] [CrossRef]
- Jadhav, A.; Jagtap, S.; Vyavahare, S.; Sharbidre, A.; Kunchiraman, B. Reviewing the potential of probiotics, prebiotics and synbiotics: Advancements in treatment of ulcerative colitis. Front. Cell. Infect. Microbiol. 2023, 13, 1268041. [Google Scholar] [CrossRef]
- Derwa, Y.; Gracie, D.J.; Hamlin, P.J.; Ford, A.C. Systematic review with meta-analysis: The efficacy of probiotics in inflammatory bowel disease. Aliment. Pharmacol. Ther. 2017, 46, 389–400. [Google Scholar] [CrossRef]
- Basso, P.J.; Saraiva Câmara, N.O.; Sales-Campos, H. Microbial-based therapies in the treatment of inflammatory bowel disease—An overview of human studies. Front. Pharmacol. 2019, 9, 430081. [Google Scholar] [CrossRef]
Genes | Forward Primer | Reverse Primer | Product Length |
---|---|---|---|
QJQ50_RS06580 | TCGACTGAAGATAAAGGGCACA | CGCTACTTTTCGTGCCGATG | 131 |
QJQ50_RS06020 | TTATCGCTGGGAATGCTTGC | CGTGCATGGCACTTAAGATCA | 79 |
QJQ50_RS09120 | GATTACGCATCTGCTGCACG | ACTGCCTTGATCACCCGTTT | 80 |
QJQ50_RS03685 | GGCCAGTTAGCCATCAGCAA | ATTGGTTTTTCGGCTGGCAC | 80 |
QJQ50_RS04870 | ACTGGCAAGGTAGTAGGCGT | CGTCCTCCTGTTTGATTGGC | 70 |
Cytokines | Concentration of Cytokines, ng/mL | Number of DEGs |
---|---|---|
IL-6 | 0.1 | - |
1 | 0 | |
10 | 0 | |
IL-8 | 0.1 | - |
1 | 190 | |
10 | 89 | |
IL-10 | 0.1 | 75 |
1 | 98 | |
10 | 123 | |
TNFα | 0.1 | 34 |
1 | 6 | |
10 | 14 |
L. rhamnosus K32 | 10 ng/mL | 1 ng/mL | 0.1 ng/mL | ||
---|---|---|---|---|---|
GeneID | IL-10 | IL-8 | IL-10 | IL-8 | IL-10 |
QJQ50_RS03835 | −1.614876 | −1.667862 | −1.653061 | −1.731752 | −1.539934 |
QJQ50_RS04815 | 1.688911 | 1.584739 | 1.510946 | 1.539842 | 1.551358 |
QJQ50_RS05005 | 1.611521 | 1.614288 | 1.531467 | 1.588289 | 1.511980 |
QJQ50_RS06985 | 1.606293 | 1.836675 | 1.684830 | 1.774548 | 1.579407 |
QJQ50_RS08010 | −1.523734 | −1.595751 | −1.599999 | −1.569289 | −1.526031 |
QJQ50_RS11360 | 1.888934 | 1.723103 | 1.823643 | 1.761015 | 1.760617 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Klimina, K.M.; Dyachkova, M.S.; Veselovsky, V.A.; Zakharevich, N.V.; Strokach, A.A.; Selezneva, O.V.; Shitikov, E.A.; Bespiatykh, D.A.; Yunes, R.A.; Poluektova, E.U.; et al. Transcriptional Responses of Lacticaseibacillus rhamnosus to TNFα, IL-6, IL-8, and IL-10 Cytokines. Biology 2024, 13, 931. https://doi.org/10.3390/biology13110931
Klimina KM, Dyachkova MS, Veselovsky VA, Zakharevich NV, Strokach AA, Selezneva OV, Shitikov EA, Bespiatykh DA, Yunes RA, Poluektova EU, et al. Transcriptional Responses of Lacticaseibacillus rhamnosus to TNFα, IL-6, IL-8, and IL-10 Cytokines. Biology. 2024; 13(11):931. https://doi.org/10.3390/biology13110931
Chicago/Turabian StyleKlimina, Ksenia M., Marina S. Dyachkova, Vladimir A. Veselovsky, Natalia V. Zakharevich, Aleksandra A. Strokach, Oksana V. Selezneva, Egor A. Shitikov, Dmitry A. Bespiatykh, Roman A. Yunes, Elena U. Poluektova, and et al. 2024. "Transcriptional Responses of Lacticaseibacillus rhamnosus to TNFα, IL-6, IL-8, and IL-10 Cytokines" Biology 13, no. 11: 931. https://doi.org/10.3390/biology13110931
APA StyleKlimina, K. M., Dyachkova, M. S., Veselovsky, V. A., Zakharevich, N. V., Strokach, A. A., Selezneva, O. V., Shitikov, E. A., Bespiatykh, D. A., Yunes, R. A., Poluektova, E. U., Odorskaya, M. V., Ostroukhova, P. S., Bruskin, S. A., Danilenko, V. N., & Olekhnovich, E. I. (2024). Transcriptional Responses of Lacticaseibacillus rhamnosus to TNFα, IL-6, IL-8, and IL-10 Cytokines. Biology, 13(11), 931. https://doi.org/10.3390/biology13110931