Effects of Maternal Probiotics and Piglet Dietary Tryptophan Level on Gastric Function Pre- and Post-Weaning
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Animal Management
2.1.1. Sow Dietary Groups and Management
2.1.2. Farrowing, Piglet Management, and Piglet Dietary Groups
2.1.3. Post-Weaning Period
2.2. Sample Collection
2.3. Gene Expression Analysis
2.3.1. RNA Extraction and cDNA Synthesis
2.3.2. Quantitative PCR
2.4. Immunohistochemistry
2.4.1. Method
2.4.2. Analysis
2.5. Feed Analysis
2.6. Statistical Analysis
3. Results
3.1. Performance
3.2. Gastric pH and Stomach Weight
3.2.1. Effect of Time on Gastric pH and Stomach Weight
3.2.2. Effect of Maternal Diet on Gastric pH and Stomach Weight
3.2.3. Effect of Creep Diet on Gastric pH and Stomach Weight
3.3. Gene Expression
3.3.1. Effect of Time on Gene Expression
3.3.2. Effect of Maternal Diet and Interactions with Time on Gene Expression
3.3.3. Effect of Creep Diet and Interactions with Time on Gene Expression
3.3.4. Maternal and Creep Diet Interactions on Gene Expression
3.4. Genes Grouped by Function
3.4.1. Time Effect on Genes Grouped by Function
3.4.2. Maternal Effect and Interaction with Time on Genes Grouped by Function
3.5. Parietal Cell Counts
3.6. Correlation Analysis
3.6.1. Weaning
3.6.2. Seven Days Post-Weaning
4. Discussion
4.1. Effect of Time: The Day of Weaning vs. 7 Days Post-Weaning
4.2. Effect of Maternal Probiotic Supplementation
4.3. Effect of Increased Piglet Dietary Tryptophan Level
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Appendix A
| Maternal Diet | Control | Probiotic | SEM | p-Value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Creep Diet | 0.22% Trp | 0.27% Trp | 0.33% Trp | 0.22% Trp | 0.27% Trp | 0.33% Trp | M | C | M × C | ||
| Function | Gene | ||||||||||
| The fundic gland region | |||||||||||
| Acid secretion | ATP4A | 0.80 | 0.68 | 0.75 | 1.10 | 1.31 | 1.28 | 0.17 | 0.0013 | 0.9186 | 0.6150 | 
| CLIC6 | 1.03 | 0.50 | 0.90 | 1.87 | 2.28 | 1.93 | 0.51 | 0.0067 | 0.9931 | 0.6392 | |
| HRH2 | 0.77 | 0.64 | 0.65 | 0.98 | 1.18 | 1.23 | 0.16 | 0.0013 | 0.9197 | 0.4533 | |
| KCNE1 | 0.72 | 0.65 | 0.771 | 0.79 | 1.19 | 1.09 | 0.20 | 0.0490 | 0.6683 | 0.5093 | |
| KCNQ1 | 0.63 | 0.59 | 0.64 | 0.95 | 1.27 | 1.14 | 0.17 | 0.0007 | 0.6822 | 0.5798 | |
| Aryl hydrocarbon receptor | AHR | 1.09 | 1.12 | 1.14 | 1.16 | 1.26 | 1.25 | 0.08 | 0.1205 | 0.5894 | 0.9169 | 
| Calcium-sensing receptor | CASR | 1.41 | 2.26 | 1.83 | 1.61 | 1.47 | 1.54 | 0.44 | 0.4297 | 0.7339 | 0.5490 | 
| Cholinergic receptor muscarinic 3 | CHRM3 | 0.75 | 0.65 | 0.78 | 0.97 | 0.92 | 1.18 | 0.08 | <0.0001 | 0.0681 | 0.5477 | 
| Digestive enzyme | CHIA | 0.65 | 0.44 | 0.61 | 0.83 | 0.91 | 1.07 | 0.16 | 0.0072 | 0.5754 | 0.5841 | 
| LCT | 2.13 | 0.90 | 1.11 | 1.96 | 1.70 | 3.40 | 0.80 | 0.1465 | 0.4796 | 0.3081 | |
| PGA5 | 0.73 | 0.71 | 0.65 | 0.89 | 0.90 | 1.08 | 0.11 | 0.0074 | 0.8385 | 0.3994 | |
| Gastrin receptor | CCKBR | 0.66 | 0.56 | 0.50 | 1.24 | 1.24 | 1.31 | 0.22 | 0.0006 | 0.9735 | 0.8818 | 
| Ghrelin | GHRL | 0.87 | 0.95 | 0.95 | 1.25 | 1.19 | 1.42 | 0.15 | 0.0048 | 0.6409 | 0.7508 | 
| Histamine production | HDC | 0.82 | 0.91 | 0.88 | 1.69 | 1.38 | 1.33 | 0.18 | 0.0002 | 0.6851 | 0.4167 | 
| Inflammation | CXCL8 | 1.89 | 1.87 | 1.88 | 1.49 | 1.99 | 1.26 | 0.50 | 0.4733 | 0.7743 | 0.7544 | 
| IL22 | 2.32 | 1.39 | 1.88 | 1.66 | 1.60 | 1.04 | 0.76 | 0.4869 | 0.7304 | 0.7615 | |
| TNF | 1.19 | 1.19 | 1.41 | 1.06 | 1.34 | 1.08 | 0.16 | 0.4430 | 0.6532 | 0.3498 | |
| Mucus production | MUC1 | 0.98 | 1.17 | 0.98 | 1.00 | 1.07 | 1.04 | 0.12 | 0.9750 | 0.5546 | 0.8048 | 
| MUC5AC | 1.33 | 1.49 | 1.22 | 1.09 | 1.22 | 0.97 | 0.19 | 0.1023 | 0.4074 | 0.9966 | |
| MUC6 | 0.86 | 0.83 | 1.21 | 1.74 | 1.45 | 1.58 | 0.32 | 0.0224 | 0.7360 | 0.7291 | |
| Somatostatin | SST | 0.93 | 1.10 | 1.08 | 1.19 | 1.09 | 1.21 | 0.18 | 0.3987 | 0.8874 | 0.7628 | 
| Somatostatin receptor | SSTR2 | 0.63 | 0.69 | 0.65 | 1.10 | 1.28 | 1.13 | 0.14 | <0.0001 | 0.6714 | 0.8953 | 
| Toll-like receptor | TLR4 | 1.30 | 1.26 | 1.25 | 1.03 | 1.11 | 1.14 | 0.09 | 0.0180 | 0.9512 | 0.6416 | 
| The pyloric gland region | |||||||||||
| Aryl hydrocarbon receptor | AHR | 1.12 | 1.00 | 1.00 | 1.00 | 1.23 | 1.21 | 0.10 | 0.1947 | 0.7983 | 0.1305 | 
| Calcium-sensing receptor | CASR | 1.65 | 1.52 | 1.38 | 1.53 | 1.56 | 1.73 | 0.23 | 0.6307 | 0.9747 | 0.5813 | 
| Gastrin | GAST | 2.36 | 1.08 | 1.03 | 1.68 | 1.82 | 2.33 | 0.37 | 0.1268 | 0.2734 | 0.0208 | 
| Inflammation | CXCL8 | 1.85 | 1.19 | 1.21 | 1.35 | 1.69 | 1.40 | 0.31 | 0.7968 | 0.6422 | 0.2707 | 
| TNF | 1.13 | 0.88 | 1.15 | 0.87 | 1.25 | 1.38 | 0.13 | 0.2871 | 0.1191 | 0.0525 | |
| Mucosal defense | PIGR | 0.69 | 0.97 | 0.94 | 0.53 | 1.30 | 1.46 | 0.17 | 0.1081 | 0.0028 | 0.1325 | 
| Mucus production | MUC5AC | 0.99 | 0.96 | 0.82 | 0.82 | 0.93 | 1.00 | 0.10 | 0.9145 | 0.9175 | 0.2111 | 
| MUC6 | 0.68 | 0.88 | 1.07 | 0.52 | 0.73 | 0.86 | 0.25 | 0.3882 | 0.3379 | 0.9918 | |
| Somatostatin | SST | 1.35 | 1.24 | 1.38 | 1.25 | 1.32 | 1.35 | 0.18 | 0.8992 | 0.8916 | 0.9049 | 
| Toll-like receptor | TLR4 | 1.20 | 1.01 | 1.12 | 0.99 | 1.37 | 1.30 | 0.14 | 0.5289 | 0.8874 | 0.0750 | 
| Maternal Diet | Control | Probiotic | SEM | p-value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Creep Diet | 0.22% Trp | 0.27% Trp | 0.33% Trp | 0.22% Trp | 0.27% Trp | 0.33% Trp | Maternal | Creep | M × C | ||
| Function | Gene | ||||||||||
| The fundic gland region | |||||||||||
| Acid secretion | ATP4A | 1.38 | 1.25 | 1.39 | 1.31 | 1.58 | 1.34 | 0.15 | 0.5832 | 0.8838 | 0.3123 | 
| CLIC6 | 1.66 | 1.79 | 2.07 | 1.48 | 2.44 | 2.08 | 0.47 | 0.6761 | 0.4611 | 0.6647 | |
| HRH2 | 1.41 | 1.32 | 1.20 | 1.34 | 1.75 | 1.42 | 0.16 | 0.1581 | 0.3708 | 0.3121 | |
| KCNE1 | 1.33 | 1.40 | 1.38 | 1.52 | 1.44 | 2.05 | 0.22 | 0.1027 | 0.3120 | 0.3248 | |
| KCNQ1 | 1.34 | 1.37 | 1.52 | 1.51 | 1.84 | 1.57 | 0.18 | 0.1192 | 0.6020 | 0.4827 | |
| Aryl hydrocarbon receptor | AHR | 0.82 | 0.99 | 0.82 | 0.87 | 0.99 | 0.93 | 0.09 | 0.4650 | 0.2263 | 0.8397 | 
| Calcium-sensing receptor | CASR | 0.72 | 0.79 | 0.71 | 0.92 | 0.89 | 0.83 | 0.11 | 0.1274 | 0.8066 | 0.8908 | 
| Cholinergic receptor muscarinic 3 | CHRM3 | 1.26 | 1.24 | 1.14 | 1.15 | 1.33 | 1.40 | 0.13 | 0.4631 | 0.8183 | 0.3937 | 
| Digestive enzyme | CHIA | 1.71 | 1.96 | 2.01 | 1.62 | 1.95 | 1.95 | 0.21 | 0.7489 | 0.2864 | 0.9854 | 
| LCT | 1.07 | 0.70 | 0.80 | 0.65 | 1.00 | 1.13 | 0.20 | 0.6897 | 0.8174 | 0.1299 | |
| PGA5 | 1.69 | 1.52 | 1.53 | 1.56 | 1.75 | 1.64 | 0.22 | 0.7088 | 0.9653 | 0.7087 | |
| Gastrin receptor | CCKBR | 1.70 | 1.54 | 1.61 | 1.79 | 1.99 | 1.96 | 0.23 | 0.1237 | 0.9846 | 0.7437 | 
| Ghrelin | GHRL | 1.10 | 1.05 | 1.05 | 1.14 | 1.06 | 0.94 | 0.14 | 0.8550 | 0.6633 | 0.8368 | 
| Histamine production | HDC | 1.15 | 0.93 | 1.13 | 1.05 | 1.37 | 0.79 | 0.14 | 0.9853 | 0.4106 | 0.0281 | 
| Inflammation | CXCL8 | 0.50 | 1.27 | 0.85 | 0.99 | 0.89 | 1.04 | 0.22 | 0.6058 | 0.3466 | 0.1595 | 
| IL22 | 0.77 | 1.22 | 1.17 | 0.92 | 1.01 | 2.10 | 0.41 | 0.3937 | 0.1634 | 0.3635 | |
| TNF | 0.74 | 1.03 | 0.74 | 1.11 | 1.02 | 0.91 | 0.10 | 0.0295 | 0.1206 | 0.1722 | |
| Mucus production | MUC1 | 1.02 | 1.04 | 0.91 | 1.06 | 1.22 | 1.21 | 0.10 | 0.0474 | 0.6783 | 0.4697 | 
| MUC5AC | 1.05 | 1.02 | 1.04 | 1.39 | 1.48 | 1.36 | 0.11 | 0.0003 | 0.9165 | 0.7843 | |
| MUC6 | 1.02 | 1.71 | 1.63 | 2.31 | 1.81 | 1.43 | 0.32 | 0.1486 | 0.7673 | 0.0726 | |
| Somatostatin | SST | 0.97 | 0.99 | 1.09 | 1.22 | 1.05 | 1.07 | 0.14 | 0.3790 | 0.8719 | 0.6121 | 
| Somatostatin receptor | SSTR2 | 1.27 | 1.14 | 1.32 | 1.22 | 1.66 | 1.61 | 0.22 | 0.1718 | 0.6134 | 0.4460 | 
| Toll-like receptor | TLR4 | 0.83 | 0.91 | 0.77 | 0.92 | 1.05 | 0.96 | 0.09 | 0.0831 | 0.4052 | 0.8786 | 
| The pyloric gland region | |||||||||||
| Aryl hydrocarbon receptor | AHR | 1.07 | 0.94 | 1.07 | 0.96 | 0.88 | 0.90 | 0.08 | 0.0945 | 0.3642 | 0.8229 | 
| Calcium-sensing receptor | CASR | 1.07 | 0.82 | 0.85 | 0.76 | 0.65 | 0.80 | 0.11 | 0.0523 | 0.2523 | 0.4802 | 
| Gastrin | GAST | 1.22 | 0.70 | 0.62 | 0.56 | 0.66 | 1.27 | 0.17 | 0.9064 | 0.2748 | 0.0022 | 
| Inflammation | CXCL8 | 1.14 | 1.69 | 0.92 | 1.36 | 1.18 | 1.03 | 0.46 | 0.8770 | 0.6094 | 0.6968 | 
| TNF | 1.09 | 1.24 | 1.00 | 0.99 | 1.08 | 0.94 | 0.19 | 0.4803 | 0.6047 | 0.9691 | |
| Mucosal defense | PIGR | 1.07 | 1.26 | 1.27 | 1.34 | 1.98 | 1.81 | 0.31 | 0.0569 | 0.4034 | 0.7871 | 
| Mucus production | MUC5AC | 1.27 | 1.24 | 1.13 | 1.27 | 1.30 | 1.10 | 0.15 | 0.6673 | 0.5603 | 0.7463 | 
| MUC6 | 2.32 | 5.47 | 2.88 | 2.34 | 2.55 | 2.88 | 0.84 | 0.1682 | 0.1418 | 0.1421 | |
| Somatostatin | SST | 0.94 | 0.89 | 0.88 | 0.79 | 0.73 | 0.85 | 0.10 | 0.1667 | 0.8246 | 0.7735 | 
| Toll-like receptor | TLR4 | 1.08 | 1.00 | 1.15 | 0.95 | 0.91 | 1.11 | 0.16 | 0.5487 | 0.5569 | 0.9621 | 


References
- Trevisi, P.; Luise, D.; Correa, F.; Messori, S.; Mazzoni, M.; Lallès, J.P.; Bosi, P. Maternal antibiotic treatment affects offspring gastric sensing for umami taste and ghrelin regulation in the pig. J. Anim. Sci. Biotechnol. 2021, 12, 31. [Google Scholar] [CrossRef]
- Du, G.M.; Shi, Z.M.; Wei, X.H.; Liu, M.J.; Zhang, L.; Zhao, R.Q. Expression of gastric ghrelin and H+–K+-ATPase MRNA in weanling piglets and effect of ghrelin on H+–K+-ATPase expression and activity in gastric mucosal cells in vitro. Res. Vet. Sci. 2007, 82, 99–104. [Google Scholar] [CrossRef]
- Cranwell, P.; Moughan, P. Biological limitations imposed by the digestive system to the growth performance of weaned pigs. In Manipulating Pig Produduction II, Proceedings of the Biennial Conference of the Australasian Pig Science Association, Albury, Australia, 27–29 November 1989; Australasian Pig Science Association: Werribee, Australia, 1989; pp. 140–160. [Google Scholar]
- Cranwell, P.; Noakes, D.; Hill, K. Gastric secretion and fermentation in the suckling pig. Br. J. Nutr. 1976, 36, 71–86. [Google Scholar] [CrossRef] [PubMed]
- Suiryanrayna, M.V.A.N.; Ramana, J.V. A review of the effects of dietary organic acids fed to swine. J. Anim. Sci. Biotechnol. 2015, 6, 45. [Google Scholar] [CrossRef] [PubMed]
- Hedemann, M.S.; Jensen, B.B. Variations in enzyme activity in stomach and pancreatic tissue and digesta in piglets around weaning. Arch. Anim. Nutr. 2004, 58, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Henry, R.; Pickard, D.; Hughes, P. Citric acid and fumaric acid as food additives for early-weaned piglets. Anim. Sci. 1985, 40, 505–509. [Google Scholar] [CrossRef]
- Canibe, N.; Højberg, O.; Højsgaard, S.; Jensen, B.B. Feed physical form and formic acid addition to the feed affect the gastrointestinal ecology and growth performance of growing pigs. J. Anim. Sci. 2005, 83, 1287–1302. [Google Scholar] [CrossRef] [PubMed]
- Nowak, P.; Zaworska-Zakrzewska, A.; Frankiewicz, A.; Kasprowicz-Potocka, M. Accepted Author Version of the Manuscript: The effects and mechanisms of acids on the health of piglets and weaners—A review. Ann. Anim. Sci. 2020, 21, 433–455. [Google Scholar]
- Lawlor, P.G.; Lynch, P.B.; Caffrey, P.J. Effect of Fumaric Acid, Calcium Formate and Mineral Levels in Diets on the Intake and Growth Performance of Newly Weaned Pigs. Ir. J. Agric. Food Res. 2006, 45, 61–71. [Google Scholar]
- Stas, E.B.; Tokach, M.D.; DeRouchey, J.M.; Goodband, R.D.; Woodworth, J.C.; Gebhardt, J.T. Evaluation of the acid-binding capacity of ingredients and complete diets commonly used for weanling pigs. Transl. Anim. Sci. 2022, 6, txac104. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Bergstrom, J.; Hahn, J.; Young, M.; Zijlstra, R. Acid-binding capacity of feed in swine nutrition. Anim. Feed. Sci. Technol. 2023, 295, 115519. [Google Scholar] [CrossRef]
- Sangild, P.T.; Fowden, A.L.; Trahair, J.F. How does the foetal gastrointestinal tract develop in preparation for enteral nutrition after birth? Livest. Prod. Sci. 2000, 66, 141–150. [Google Scholar] [CrossRef]
- Sangild, P.T.; Schmidt, M.; Elnif, J.; Björnvad, R.; Weström, B.R.; Buddington, B.K. Prenatal development of gastrointestinal function in the pig and the effects of fetal esophageal obstruction. Pediatr. Res. 2002, 52, 416–424. [Google Scholar] [CrossRef]
- Trevisi, P.; Gandolfi, G.; Priori, D.; Messori, S.; Colombo, M.; Mazzoni, M.; Lallès, J.-P.; Bosi, P. Age-Related Expression of the Polymeric Immunoglobulin Receptor (pIgR) in the Gastric Mucosa of Young Pigs. PLoS ONE 2013, 8, e81473. [Google Scholar] [CrossRef]
- Colombo, M.; Priori, D.; Trevisi, P.; Bosi, P. Differential Gene Expression in the Oxyntic and Pyloric Mucosa of the Young Pig. PLoS ONE 2014, 9, e111447. [Google Scholar] [CrossRef] [PubMed]
- Fothergill, L.J.; Galiazzo, G.; Hunne, B.; Stebbing, M.J.; Fakhry, J.; Weissenborn, F.; Coles, T.E.F.; Furness, J.B. Distribution and co-expression patterns of specific cell markers of enteroendocrine cells in pig gastric epithelium. Cell Tissue Res. 2019, 378, 457–469. [Google Scholar] [CrossRef]
- Kiernan, D.P.; O’doherty, J.V.; Connolly, K.R.; Ryan, M.; Sweeney, T. Exploring the Differential Expression of a Set of Key Genes Involved in the Regulation and Functioning of the Stomach in the Post-Weaned Pig. Vet. Sci. 2023, 10, 473. [Google Scholar] [CrossRef] [PubMed]
- Cranwell, P.D. The development of acid and pepsin (EC 3. 4. 23. 1) secretory capacity in the pig; the effects of age and weaning: 1. Studies in anaesthetized pigs. Br. J. Nutr. 1985, 54, 305–320. [Google Scholar] [CrossRef] [PubMed]
- Bosi, P.; Maurizio, M.; Sara, D.F.; Paolo, T.; Luisa, C.; Gregorio, P.; Giovanna, L.-C. A continuous dietary supply of free calcium formate negatively affects the parietal cell population and gastric RNA expression for H+/K+-ATPase in weaning pigs. J. Nutr. 2006, 136, 1229–1235. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mazzoni, M.; Le Gall, M.; De Filippi, S.; Minieri, L.; Trevisi, P.; Wolinski, J.; Lalatta-Costerbosa, G.; Lallès, J.-P.; Guilloteau, P.; Bosi, P. Supplemental Sodium Butyrate Stimulates Different Gastric Cells in Weaned Pigs. J. Nutr. 2008, 138, 1426–1431. [Google Scholar] [CrossRef]
- Colombo, M.; Priori, D.; Gandolfi, G.; Boatto, G.; Nieddu, M.; Bosi, P.; Trevisi, P. Effect of free thymol on differential gene expression in gastric mucosa of the young pig. Animal 2014, 8, 786–791. [Google Scholar] [CrossRef] [PubMed]
- Luise, D.; Motta, V.; Salvarani, C.; Chiappelli, M.; Fusco, L.; Bertocchi, M.; Mazzoni, M.; Maiorano, G.; Costa, L.N.; Van Milgen, J.; et al. Long-term administration of formic acid to weaners: Influence on intestinal microbiota, immunity parameters and growth performance. Anim. Feed. Sci. Technol. 2017, 232, 160–168. [Google Scholar] [CrossRef]
- Trevisi, P.; Priori, D.; Motta, V.; Luise, D.; Jansman, A.J.M.; Koopmans, S.-J.; Bosi, P. Effects of starter microbiota and the early life feeding of medium chain triglycerides on the gastric transcriptome profile of 2-or 3-week-old cesarean delivered piglets. J. Anim. Sci. Biotechnol. 2017, 8, 82. [Google Scholar] [CrossRef] [PubMed]
- Maher, S.; Sweeney, T.; Kiernan, D.P.; Ryan, M.T.; Gath, V.; Vigors, S.; Connolly, K.R.; O’doherty, J.V. Organic acid preservation of cereal grains improves grain quality, growth performance, and intestinal health of post-weaned pigs. Anim. Feed. Sci. Technol. 2024, 316, 116078. [Google Scholar] [CrossRef]
- Connolly, K.R.; Sweeney, T.; Kiernan, D.; Round, A. The Role of Propionic Acid as a Feed Additive and Grain Preservative on Weanling Pig Performance and Digestive Health. 2024. Available online: https://ssrn.com/abstract=4919186 (accessed on 18 October 2024).
- Lerch, F.; Yosi, F.; Vötterl, J.C.; Koger, S.; Ehmig, J. An insight into the temporal dynamics in the gut microbiome, metabolite signaling, immune response, and barrier function in suckling and weaned piglets under production conditions. Front. Vet. Sci. 2023, 10. [Google Scholar] [CrossRef]
- Quinn, S.J.; Bai, M.; Brown, E.M. pH Sensing by the calcium-sensing receptor. J. Biol. Chem. 2004, 279, 37241–37249. [Google Scholar] [CrossRef] [PubMed]
- Busque, S.M.; Kerstetter, J.E.; Geibel, J.P.; Insogna, K. l-Type amino acids stimulate gastric acid secretion by activation of the calcium-sensing receptor in parietal cells. Am. J. Physiol.-Gastrointest. Liver Physiol. 2005, 289, G664–G669. [Google Scholar] [CrossRef]
- Xian, Y.; Zhao, X.; Wang, C.; Kang, C.; Ding, L.; Zhu, W.; Hang, S. Phenylalanine and tryptophan stimulate gastrin and somatostatin secretion and H+-K+-ATPase activity in pigs through calcium-sensing receptor. Gen. Comp. Endocrinol. 2018, 267, 1–8. [Google Scholar] [CrossRef]
- Casare, F.; Milan, D.; Fernandez, R. Stimulation of calcium-sensing receptor increases biochemical H+-ATPase activity in mouse cortex and outer medullary regions. Can. J. Physiol. Pharmacol. 2013, 92, 181–188. [Google Scholar] [CrossRef]
- Dufner, M.M.; Kirchhoff, P.; Remy, C.; Hafner, P. The calcium-sensing receptor acts as a modulator of gastric acid secretion in freshly isolated human gastric glands. Am. J. Physiol.-Gastrointest. Liver Physiol. 2005, 289, G1084–G1090. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kiernan, D.P.; O’Doherty, J.V.; Sweeney, T. The effect of maternal probiotic or synbiotic supplementation on sow and offspring microbiome, health, and performance. Animals 2023, 13, 2996. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.S.; Lee, E.-B.; Hsu, W.H.; Suk, K.; Sayem, S.A.J.; Ullah, H.M.A.; Lee, S.-J.; Park, S.-C. Probiotics and Postbiotics as an Alternative to Antibiotics: An Emphasis on Pigs. Pathogens 2023, 12, 874. [Google Scholar] [CrossRef] [PubMed]
- Babińska, I.; Rotkiewicz, T.; Otrocka-Domagała, I. The effect of Lactobacillus acidophilus and Bifidobacterium spp. administration on the morphology of the gastrointestinal tract, liver and pancreas in piglets. Pol. J. Vet. Sci. 2005, 8, 29–35. [Google Scholar] [PubMed]
- Chen, X.; Xu, J.; Ren, E.; Su, Y.; Zhu, W. Co-occurrence of early gut colonization in neonatal piglets with microbiota in the maternal and surrounding delivery environments. Anaerobe 2018, 49, 30–40. [Google Scholar] [CrossRef]
- Adams, S.; Knapp, J.P.; Neujahr, A.; Burkey, T.; Miller, P.S. 276 Investigating the Colonization History of Early-Life Microbiome of Piglets. J. Anim. Sci. 2023, 101 (Suppl. S2), 165–166. [Google Scholar]
- Sauvant, D.; Perez, J.-M.; Tran, G. Tables of Composition and Nutritional Value of Feed Materials: Pigs, Poultry, Cattle, Sheep, Goats, Rabbits, Horses and Fish; Brill: Leiden, The Netherlands, 2023. [Google Scholar]
- NRC. Nutrient Requirements of Swine, 11th ed.; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
- Capozzalo, M.; Kim, J.; Htoo, J.; de Lange, C.; Mullan, B.; Resink, J.; Hansen, C.; Stumbles, P.; Hampson, D.; Ferguson, N.; et al. Estimating the standardised ileal digestible tryptophan requirement of pigs kept under commercial conditions in the immediate post-weaning period. Anim. Feed. Sci. Technol. 2020, 259, 114342. [Google Scholar] [CrossRef]
- Capozzalo, M.M.; Kim, J.C.; Htoo, J.K.; de Lange, J.F. Effect of increasing the dietary tryptophan to lysine ratio on plasma levels of tryptophan, kynurenine and urea and on production traits in weaner pigs experimentally infected with an enterotoxigenic strain of Escherichia coli. Arch. Anim. Nutr. 2015, 69, 17–29. [Google Scholar] [CrossRef] [PubMed]
- Capozzalo, M.M.; Kim, J.C.; Htoo, J.K.; de Lange, C.F.M.; Mullan, B.P.; Hansen, C.F.; Resink, J.W.; Stumbles, P.A.; Hampson, D.J.; Pluske, J.R. An increased ratio of dietary tryptophan to lysine improves feed efficiency and elevates plasma tryptophan and kynurenine in the absence of antimicrobials and regardless of infection with enterotoxigenic Escherichia coli in weaned pigs. J. Anim. Sci. 2012, 90 (Suppl. S4), 191–193. [Google Scholar] [CrossRef] [PubMed]
- Chae, B.; Poaty Ditengou, J.I.C.; Lee, A.-L.; Tak, J.; Cheon, I.; Choi, N.-J. An Estimation of the Requirements of the Standardized Ileal Digestible Tryptophan, Valine, Isoleucine and Methionine on Young Pigs’ (Up to 50 kg) Feed Efficiency: A Meta-Regression Analysis. Animals 2024, 14, 2884. [Google Scholar] [CrossRef]
- Lamas, B.; Natividad, J.M.; Sokol, H. Aryl hydrocarbon receptor and intestinal immunity. Mucosal Immunol. 2018, 11, 1024–1038. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Ma, N.; He, T.; Johnston, L.J.; Ma, X. Tryptophan (Trp) modulates gut homeostasis via aryl hydrocarbon receptor (AhR). Crit. Rev. Food Sci. Nutr. 2020, 60, 1760–1768. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of AOAC International; AOAC International Gaithersburg: Gaithersburg, MD, USA, 2005; Volume 1. [Google Scholar]
- Van Soest, P.V.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [PubMed]
- Iwaki, K.; Nimura, N.; Hiraga, Y.; Kinoshita, T.; Takeda, K.; Ogura, H. Amino acid analysis by reversed-phase high-performance liquid chromatography. Automatic pre-column derivatization with activated carbamate reagent. J. Chromatogr. 1987, 407, 273–279. [Google Scholar] [CrossRef] [PubMed]
- Harrell, F.E. Package ‘hmisc’. CRAN2018 2019, 2019, 235–236. [Google Scholar]
- Barret Schloerke, D.C.; Larmarange, J.; Briatte, F.; Marback, M.; Theon, E.; Elberg, A.; Toomet, O.; Crowley, J. GGally: Extension to ‘ggplot2’, R package version 2.2.1. 2024.
- O’Doherty, J.V.; Kiernan, D.P.; Sweeney, T. Advances in understanding pig digestive physiology. In Advances in Pig Nutrition; Wiseman, J., Ed.; Burleigh Dodds Science Publishing: Cambridge, UK, 2024. [Google Scholar]
- Dos Santos, P.M.C.; Amaral, D.; Tararthuch, A.L.; Fernandez, R. Calcium-sensing receptor (CaSR) modulates vacuolar H+-ATPase activity in a cell model of proximal tubule. Clin. Exp. Nephrol. 2018, 22, 1258–1265. [Google Scholar] [CrossRef]
- Cheng, Y.; Ding, S.; Azad, A.K.; Song, B.; Kong, X. Small Intestinal Digestive Functions and Feed Efficiency Differ in Different Pig Breeds. Animals 2023, 13, 1172. [Google Scholar] [CrossRef]
- Liu, G.; Mo, W.; Cao, W.; Jia, G.; Zhao, H.; Chen, X.; Wu, C.; Zhang, R.; Wang, J. Digestive abilities, amino acid transporter expression, and metabolism in the intestines of piglets fed with spermine. J. Food Biochem. 2020, 44, e13167. [Google Scholar] [CrossRef] [PubMed]
- Lallès, J.P.; Sève, B.; Pié, S.; Blazy, F.; Laffitte, J.; Oswald, I.P.; Sève, B. Weaning Is Associated with an Upregulation of Expression of Inflammatory Cytokines in the Intestine of Piglets. J. Nutr. 2004, 134, 641–647. [Google Scholar] [CrossRef]
- Bomba, L.; Minuti, A.; Moisá, S.J.; Trevisi, E.; Eufemi, E.; Lizier, M.; Chegdani, F.; Lucchini, F.; Rzepus, M.; Prandini, A.; et al. Gut response induced by weaning in piglet features marked changes in immune and inflammatory response. Funct. Integr. Genom. 2014, 14, 657–671. [Google Scholar] [CrossRef]
- Dong, X.-Y.; Xu, J.; Tang, S.-Q.; Li, H.-Y.; Jiang, Q.-Y.; Zou, X.-T. Ghrelin and its biological effects on pigs. Peptides 2009, 30, 1203–1211. [Google Scholar] [CrossRef] [PubMed]
- Scrimgeour, K.; Gresham, M.J.; Giles, L.R.; Thomson, P.C.; Wynn, P.C.; E Newman, R. Ghrelin secretion is more closely aligned to energy balance than with feeding behaviour in the grower pig. J. Endocrinol. 2008, 198, 135. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
- Pang, J.; Liu, Y.; Kang, L.; Ye, H.; Zang, J.; Wang, J.; Han, D. Bifidobacterium animalis promotes the growth of weaning piglets by improving intestinal development, enhancing antioxidant capacity, and modulating gut microbiota. Appl. Environ. Microbiol. 2022, 88, e01296-22. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Zhu, Y.-H.; Zhou, D.; Wu, Q.; Song, D.; Dicksved, J.; Wang, J.-F. Oral Administration of a Select Mixture of Bacillus Probiotics Affects the Gut Microbiota and Goblet Cell Function following Escherichia coli Challenge in Newly Weaned Pigs of Genotype MUC4 That Are Supposed To Be Enterotoxigenic E. coli F4ab/ac Receptor Negative. Appl. Environ. Microbiol. 2017, 83, e02747-16. [Google Scholar]
- Desantis, S.; Mastrodonato, M.; Accogli, G.; Rossi, G.; Crovace, A.M. Effects of a probiotic on the morphology and mucin composition of pig intestine. Histol. Histopathol. 2019, 34, 1037–1050. [Google Scholar] [PubMed]
- Barbosa, A.M.S.; Carvalho, M.P.S.; Naves, L.d.P.; da Motta, S.A.B.; Chaves, R.F.; Resende, M.; de Lima, D.; Hansen, L.H.B.; Cantarelli, V.D.S. Performance and Health Parameters of Sows and Their Litters Using a Probiotic Supplement Composed of Bacillus subtilis 541 and Bacillus amyloliquefaciens 516. Animals 2024, 14, 3511. [Google Scholar] [CrossRef] [PubMed]
- Konieczka, P.; Ferenc, K.; Jørgensen, J.N.; Hansen, L.H.; Zabielski, R.; Olszewski, J.; Gajewski, Z.; Mazur-Kuśnirek, M.; Szkopek, D.; Szyryńska, N.; et al. Feeding Bacillus-based probiotics to gestating and lactating sows is an efficient method for improving immunity, gut functional status and biofilm formation by probiotic bacteria in piglets at weaning. Anim. Nutr. 2023, 13, 361–372. [Google Scholar] [CrossRef] [PubMed]
- Mazur-Kuśnirek, M.; Lipiński, K.; Jørgensen, J.N.; Hansen, L.H.B.; Antoszkiewicz, Z.; Zabielski, R.; Konieczka, P. The Effect of a Bacillus-Based Probiotic on Sow and Piglet Performance in Two Production Cycles. Animals 2023, 13, 3163. [Google Scholar] [CrossRef] [PubMed]
- Crespo-Piazuelo, D.; Gardiner, G.E.; Ranjitkar, S.; Bouwhuis, M.A.; Ham, R.; Phelan, J.P.; Marsh, A.; Lawlor, P.G. Maternal supplementation with Bacillus altitudinis spores improves porcine offspring growth performance and carcass weight. Br. J. Nutr. 2022, 127, 403–420. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zeng, X.; Zhang, G.; Hou, C.; Li, N.; Yu, H.; Shang, L.; Zhang, X.; Trevisi, P.; Yang, F.; et al. Maternal Breast Milk and Fecal Microbes Guide the Spatiotemporal Development of Mucosa-Associated Microbiota and Barrier Function in the Neonatal Gut. 2019. Available online: https://ssrn.com/abstract=3403346 (accessed on 18 July 2024).
- Lim, J.-A.; Cha, J.; Choi, S.; Kim, J.-H.; Kim, D. Early Colonization of the Intestinal Microbiome of Neonatal Piglets Is Influenced by the Maternal Microbiome. Animals 2023, 13, 3378. [Google Scholar] [CrossRef]
- Liu, S.; Zhang, Z.; Ma, L. A Review Focusing on Microbial Vertical Transmission during Sow Pregnancy. Vet. Sci. 2023, 10, 123. [Google Scholar] [CrossRef] [PubMed]
- Quan, J.; Xu, C.; Ruan, D.; Ye, Y.; Qiu, Y.; Wu, J.; Zhou, S.; Luan, M.; Zhao, X.; Chen, Y.; et al. Composition, function, and timing: Exploring the early-life gut microbiota in piglets for probiotic interventions. J. Anim. Sci. Biotechnol. 2023, 14, 143. [Google Scholar] [CrossRef] [PubMed]
- FAO; WHO. Health and nutritional properties of probiotics in food including powder milk with live lactic acid bacteria. Prevention 2001, 5, 1–10. [Google Scholar]
- Baker, A.A.; Davis, E.; Spencer, J.D.; Moser, R.; Rehberger, T. The effect of a Bacillus-based direct-fed microbial supplemented to sows on the gastrointestinal microbiota of their neonatal piglets. J. Anim. Sci. 2013, 91, 3390–3399. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Pang, J.; Zhang, W.; Peng, X.; Yang, Z.; Bai, G.; Xia, Y. Tryptophan metabolism and piglet diarrhea: Where we stand and the challenges ahead. Anim. Nutr. 2024, 17, 123–133. [Google Scholar] [CrossRef]
- Hu, Z.; Feng, L.; Jiang, Q.; Wang, W.; Tan, B.; Tang, X.; Yin, Y. Intestinal tryptophan metabolism in disease prevention and swine production. Anim. Nutr. 2023, 15, 364–374. [Google Scholar] [CrossRef]
- Kiernan, D.P.; O’Doherty, J.V.; Sweeney, T. The effect of prebiotic supplements on the gastrointestinal microbiota and associated health parameters in the pig. Animals 2023, 13, 3012. [Google Scholar] [CrossRef]
- Zhang, H.; Yin, J.; Li, D.; Zhou, X.; Li, X. Tryptophan enhances ghrelin expression and secretion associated with increased food intake and weight gain in weanling pigs. Domest. Anim. Endocrinol. 2007, 33, 47–61. [Google Scholar] [CrossRef]
- Chen, C.; Hu, H.; Li, Z.; Qi, M.; Qiu, Y.; Hu, Z.; Feng, F.; Tang, W.; Diao, H.; Sun, W.; et al. Dietary tryptophan improves growth and intestinal health by promoting the secretion of intestinal β-defensins against enterotoxigenic Escherichia coli F4 in weaned piglets. J. Nutr. Biochem. 2024, 129, 109637. [Google Scholar] [CrossRef]
- Simongiovanni, A.; Corrent, E.; Le Floc’H, N.; van Milgen, J. Estimation of the tryptophan requirement in piglets by meta-analysis. Animal 2012, 6, 594–602. [Google Scholar] [CrossRef]
- Le Floc’h, N.; Seve, B. Biological roles of tryptophan and its metabolism: Potential implications for pig feeding. Livest. Sci. 2007, 112, 23–32. [Google Scholar] [CrossRef]
- Le Floc’H, N.; LeBellego, L.; Matte, J.J.; Melchior, D.; Sève, B. The effect of sanitary status degradation and dietary tryptophan content on growth rate and tryptophan metabolism in weaning pigs. J. Anim. Sci. 2009, 87, 1686–1694. [Google Scholar] [CrossRef] [PubMed]
- Jayaraman, B.; Htoo, J.K.; Nyachoti, C.M. Effects of different dietary tryptophan: Lysine ratios and sanitary conditions on growth performance, plasma urea nitrogen, serum haptoglobin and ileal histomorphology of weaned pigs. Anim. Sci. J. 2017, 88, 763–771. [Google Scholar] [CrossRef]
- Zhao, X.; Xian, Y.; Wang, C.; Ding, L.; Meng, X.; Zhu, W.; Hang, S. Calcium-sensing receptor-mediated L-tryptophan-induced secretion of cholecystokinin and glucose-dependent insulinotropic peptide in swine duodenum. J. Vet. Sci. 2018, 19, 179–187. [Google Scholar] [CrossRef] [PubMed]
- Piñeiro, C.; Manso, A.; Manzanilla, E.G.; Morales, J. Influence of sows’ parity on performance and humoral immune response of the offspring. Porc. Health Manag. 2019, 5, 1. [Google Scholar] [CrossRef] [PubMed]
- Craig, J.R.; Dunshea, F.R.; Cottrell, J.J.; Furness, J.B.; A Wijesiriwardana, U.; Pluske, J.R. A comparison of the anatomical and gastrointestinal functional development between gilt and sow progeny around birth and weaning. J. Anim. Sci. 2019, 97, 3809–3822. [Google Scholar] [CrossRef]






| Ingredients (g/kg) | Gestation Sow Diet a | Lactation Sow Diet a | Creep | ||
|---|---|---|---|---|---|
| 0.22% Trp b | 0.27% Trp b | 0.33% Trp b | |||
| Wheat | - | 380 | 472 | 472 | 472 | 
| Barley | 750 | 250 | 100 | 100 | 100 | 
| Maize | - | - | 120 | 120 | 120 | 
| Soya bean meal | 90 | 170 | - | - | - | 
| Soya bean 50 | - | - | 90 | 90 | 90 | 
| Full-fat soya | - | 80 | 90 | 90 | 90 | 
| Soycomil | - | - | 30 | 30 | 30 | 
| Whey protein | - | - | 40 | 40 | 40 | 
| Soya oil | 12 | 25 | 30 | 30 | 30 | 
| Soya hulls | 120 | 10 | - | - | - | 
| Beet pulp | 4 | 10 | - | - | - | 
| Pollard | - | 40 | - | - | - | 
| Vitamin and mineral premix c | 1.5 | 1.5 | 3 | 3 | 3 | 
| Salt | 4 | 5 | 2 | 2 | 2 | 
| Monocalcium phosphate | 6 | 8 | 4.2 | 4.2 | 4.2 | 
| Limestone | 9 | 12 | 4.5 | 4.5 | 4.5 | 
| Lysine-HCL 78.8% | 2.2 | 4 | 5.8 | 5.8 | 5.8 | 
| Methionine | 0.6 | 1.3 | 2.5 | 2.5 | 2.5 | 
| Threonine | 0.7 | 2.5 | 2.8 | 2.8 | 2.8 | 
| Tryptophan | 0 | 0.7 | 0.2 | 0.7 | 1.2 | 
| Ingredients g/kg | Gestation Sow Diet a | Lactation Sow Diet a | Creep | ||
|---|---|---|---|---|---|
| 0.22% Trp b | 0.27% Trp b | 0.33% Trp b | |||
| Dry matter | 870 | 870 | 900 | 880 | 900 | 
| Crude protein (N × 6.25) | 141.5 | 170.3 | 180.5 | 177.0 | 182.5 | 
| Gross energy (MJ/kg) | 15.9 | 16.0 | 16.6 | 16.8 | 16.8 | 
| Ash | 50.5 | 52.6 | 50 | 60 | 50 | 
| Neutral detergent fiber | 220.0 | 140.0 | 145.1 | 135.2 | 141.2 | 
| Crude oil | 26.6 | 51.0 | 38.2 | 46.0 | 42.4 | 
| Arginine | 9.3 | 11.0 | 10.7 | 11.4 | 10.6 | 
| Histidine | 3.5 | 4.1 | 4.3 | 4.3 | 4.2 | 
| Isoleucine | 5.1 | 7.2 | 7.4 | 7.8 | 7.5 | 
| Leucine | 11.3 | 12.6 | 13.1 | 13.5 | 14.4 | 
| Lysine | 7.5 | 11.3 | 13.9 | 14.0 | 14.1 | 
| Methionine | 2.5 | 2.5 | 4.8 | 4.5 | 4.5 | 
| Phenylalanine | 6.1 | 8.0 | 8.2 | 8.0 | 8.3 | 
| Threonine | 5.7 | 6.9 | 8.9 | 8.5 | 9.1 | 
| Tryptophan | 1.8 | 2.2 | 2.4 | 2.8 | 3.2 | 
| Valine | 6.6 | 7.9 | 9.7 | 8.2 | 9.3 | 
| Target Gene | Gene Name | Accession No. | Forward Primer (5′-3′) Reverse Primer (5’-3’) | Amplicon Length (bp) | 
|---|---|---|---|---|
| Acid secretion | ||||
| ATP4A | H+/K+-ATPase Transporting Subunit Alpha | XM_021093570.1 | F: GGACATGGCAGCCAAGATG R: TGTTCTCCAGCTTCTCCTTCCT | 74 | 
| CLIC6 | Chloride Intracellular Channel 6 | XM_003358948.4 | F: CGGAACCAGTCAGAAGAACGA R: TCCTACCGCCCAAGAAGCT | 87 | 
| HRH2 | Histamine Receptor 2 | XM_003354192.4 | F: CCAGCCTGGATGTCATGCCT R: CCGGTCGAGGCTGATCAT | 65 | 
| KCNQ1 | Potassium Voltage-Gated Channel Subfamily Q Member 1 | XM_021082620.1 | F: CGCGTCTACAACTTCCTCGAA R: CGATAAGGAAGACAGCAAAGTGGTA | 73 | 
| KCNE1 | Potassium Voltage-Gated Channel Subfamily E Regulatory Subunit 1 | NM_214165.2 | F: AGGTCCCCAGGCCATGA R: GCCCAGCACCATGAGAATGT | 60 | 
| Aryl hydrocarbon receptor | ||||
| AHR | Aryl Hydrocarbon Receptor | NM_001303026.1 | F: GCAGCGCCAACATCACCT R: GGGATTGGCTTGACAGTTTTC | 70 | 
| Calcium-sensing receptor | ||||
| CASR | Calcium-sensing receptor | XM_021068447.1 | F: GGTGGTGGCAGGATA R: TCGACACTGCTGATG | 77 | 
| Cholinergic receptor muscarinic 3 | ||||
| CHRM3 | Cholinergic Receptor Muscarinic 3 | XM_021071815.1 | F: TGGACGCTGCCACTTCTG R: GCTGTGGTCTTGGTCCATCTG | 73 | 
| Digestive enzymes | ||||
| CHIA | Chitinase Acidic | NM_001258377.1 | F: GCCTTTTGTACCCACCTGGTCTA R: TCAGTGGTGGTGATCTCGTTGT | 65 | 
| PGA5 | Pepsinogen A5 | NM_213872.2 | F: CGGCAGCGTGGTGGTGTTGT R: GGAAACAGGCACCCAGTTCA | 73 | 
| LCT | Lactase | XM_021076418.1 | F: TGGTCCTACGAGCTG R: CAGAAGACAAATCAAGAGAGAGGAAGT | 102 | 
| Gastrin | ||||
| GAST | Gastrin | NM_001004036.2 | F: TCCCAGCTCTGCAGTCAAGA R: CCAGAGCCAGCACATGGA | 65 | 
| Gastrin receptor | ||||
| CCKBR | Cholecystokinin B Receptor | XM_021062350 | F: CATGGGCACGTTTATCTTTGG R: TCACAGACACCCCCATGAAGT | 68 | 
| Ghrelin production | ||||
| GHRL | Ghrelin | XM_013981924.2 | F: AAGCTGGAAATCCGGTTCAA R: CGGACTGAGCCCCTGACA | 64 | 
| Histamine production | ||||
| HDC | Histidine Decarboxylase | XM_001925342.5 | F: ATCTGCCAGTACCTGAGCACTGT R: GCAGGTAGCCAGGTCTCACATC | 67 | 
| Inflammation | ||||
| CXCL8 | C-X-C Motif Chemokine Ligand 8 | NM_213867.1 | F: TGCACTTACTCTTGCCAGAACTG R: CAAACTGGCTGTTGCCTTCTT | 82 | 
| IL22 | Interleukin 22 | XM_021091968.1 | F: GATGAGAGAGCGCTGCTACCTGG R: GAAGGACGCCACCTCCTGCATGT | 112 | 
| TNF | Tumor Necrosis Factor | NM_214022.1 | F: TGGCCCCTTGAGCATCA R: CGGGCTTATCTGAGGTTTGAG | 68 | 
| Mucins | ||||
| MUC1 | Mucin 1 | XM_001926883.1 | F: ACACCCATGGGCGCTATGT R: GCCTGCAGAAACCTGCTCAT | 68 | 
| MUC5AC | Mucin 5AC | XM_021092583.1 | F: GGATGTCGCCAGAGACTGAGTA R: CCCCCTCGTCTCCTTTTACC | 71 | 
| MUC6 | Mucin 6 | XM_021082474.1 | F: AAAACGTGGGCAGGATGTGT R: GCCATCCTCGCTCAGAAACT | 77 | 
| Mucosal defense | ||||
| PIGR | Polymeric Immunoglobulin Receptor | XM_021102216.1 | F: GGGCTCGGTGACATTTGACT R: TTTAGCTGGCACAGAAATTTGG | 72 | 
| Somatostatin | ||||
| SST | Somatostatin | NM_001009583.1 | F: CCCTGGAGCCTGAAGATTTG R: GCCGGGTTTGAGTTAGCTGAT | 85 | 
| Somatostatin receptor | ||||
| SSTR2 | Somatostatin Receptor | XM_005668643.3 | F: TTTTGTGGTCTGCATCATTGG R: GCGTAGCGGAGGATGACGTA | 66 | 
| Toll-like receptors | ||||
| TLR4 | Toll-Like Receptor 4 | NM_001293317.1 | F: TGCATGGAGCTGAATTTCTACAA R: GATAAATCCAGCACCTGCAGTTC | 140 | 
| Reference genes | ||||
| ACTB | Beta Actin | XM_001927228.1 | F: GGACATCGGATACCCAAGGA R: AAGTTGGAAGGCCGGTTAATTT | 71 | 
| B2M | Beta-2-Microglobulin | NM_213978.1 | F: CGGAAAGCCAAATTACCTGAAC R: TCTCCCCGTTTTTCAGCAAAT | 83 | 
| RPL27 | Ribosomal Protein L27 | NM_001097479.1 | F: GTCCTGGCTGGTCGCTACTC R: GGTCTGAGGTGCCATCATCA | 70 | 
| Maternal | SEM | Creep | SEM | p-Value + | |||||
|---|---|---|---|---|---|---|---|---|---|
| Control | Probiotic | 0.22% Trp | 0.27% Trp | 0.33% Trp | M | C | |||
| Piglet Bodyweight (kg) | |||||||||
| Pre-weaning | |||||||||
| Birth | 1.46 | 1.51 | 0.04 | 1.50 | 1.51 | 1.45 | 0.05 | 0.4358 | 0.6432 | 
| Weaning | 7.20 | 7.33 | 0.23 | 7.47 | 7.24 | 7.03 | 0.28 | 0.7417 | 0.5313 | 
| Post-weaning | |||||||||
| Initial weight | 7.63 | 7.97 | 0.30 | 7.92 | 8.10 | 7.38 | 0.37 | 0.4149 | 0.3455 | 
| D7 post-weaning | 8.03 | 8.18 | 0.39 | 8.24 | 8.50 | 7.57 | 0.47 | 0.7804 | 0.3479 | 
| Daily Gain (kg) | |||||||||
| Pre-weaning | |||||||||
| D0–D26 | 0.22 | 0.22 | 0.01 | 0.23 | 0.22 | 0.21 | 0.01 | 0.7946 | 0.5030 | 
| Post-weaning | |||||||||
| D0–D7 | 0.06 | 0.03 | 0.42 | 0.04 | 0.06 | 0.03 | 0.03 | 0.4168 | 0.7634 | 
| Feed Intake (kg) | |||||||||
| Pre-weaning litter intake | |||||||||
| Total | 0.74 | 0.98 | 0.14 | 0.98 | 0.90 | 0.71 | 0.17 | 0.2272 | 0.5364 | 
| Post-weaning intake per pig D0–D7 | |||||||||
| ADFI | 0.26 | 0.27 | 0.02 | 0.29 | 0.27 | 0.25 | 0.03 | 0.6661 | 0.5304 | 
| Trp Intake (g/day) | 0.70 | 0.74 | 0.05 | 0.63 | 0.72 | 0.82 | 0.06 | 0.6542 | 0.1287 | 
| Gain:Feed | |||||||||
| Post-weaning | |||||||||
| D0–D7 | 0.14 | 0.02 | 0.08 | 0.08 | 0.10 | 0.07 | 0.10 | 0.2695 | 0.9756 | 
| Time | SEM | Maternal | SEM | Creep | SEM | p-Value + | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pre | Post | Control | Probiotic | 0.22% Trp | 0.27% Trp | 0.33% Trp | T | M | C | ||||
| Bodyweight (kg) * | 8.49 | 7.96 | 0.25 | 8.24 | 8.20 | 0.26 | 8.09 | 8.53 | 8.05 | 0.31 | 0.1418 | 0.9236 | 0.4668 | 
| Gastric pH | 3.57 | 3.53 | 0.13 | 3.70 | 3.40 | 0.13 | 3.49 | 3.59 | 3.58 | 0.16 | 0.8322 | 0.0980 | 0.8875 | 
| Full stomach weight (g) | 151.67 | 307.16 | 0.13 | 233.54 | 225.29 | 11.02 | 226.36 | 232.97 | 228.91 | 13.57 | <0.0001 | 0.5953 | 0.9403 | 
| Empty stomach weight (g) | 76.46 | 70.30 | 11.02 | 71.56 | 75.19 | 1.90 | 73.42 | 73.60 | 73.13 | 2.34 | 0.0233 | 0.1769 | 0.9894 | 
| Empty-stomach-to-bodyweight ratio (%) | 0.93 | 0.90 | 0.03 | 0.88 | 0.95 | 0.03 | 0.94 | 0.87 | 0.93 | 0.03 | 0.3025 | 0.0998 | 0.2834 | 
| Time | Pre-Weaning | Post-Weaning | SEM | p-Value + | |||||
|---|---|---|---|---|---|---|---|---|---|
| Maternal Diet | Control | Probiotic | Control | Probiotic | T | M | T × M | ||
| Function | Gene | ||||||||
| The fundic gland region | |||||||||
| Acid secretion | ATP4A | 0.74 a | 1.23 b | 1.34 b | 1.41 b | 0.12 | <0.0001 | 0.0037 | 0.0262 | 
| CLIC6 | 0.81 | 2.02 | 1.84 | 2.05 | 0.29 | 0.0825 | 0.0194 | 0.0734 | |
| HRH2 | 0.68 | 1.13 | 1.31 | 1.50 | 0.09 | <0.0001 | 0.0009 | 0.1673 | |
| KCNE1 | 0.69 | 1.02 | 1.37 | 1.37 | 0.12 | <0.0001 | 0.0111 | 0.8952 | |
| KCNQ1 | 0.62 | 1.12 | 1.40 | 1.64 | 0.10 | <0.0001 | 0.0004 | 0.1891 | |
| Aryl hydrocarbon receptor | AHR | 1.12 | 1.22 | 0.88 | 0.93 | 0.05 | <0.0001 | 0.1112 | 0.6078 | 
| Calcium-sensing receptor | CASR | 1.83 | 1.54 | 0.74 | 0.88 | 0.19 | <0.0001 | 0.6850 | 0.2564 | 
| Cholinergic receptor muscarinic 3 | CHRM3 | 0.73 | 1.02 | 1.21 | 1.30 | 0.06 | <0.0001 | 0.0047 | 0.1053 | 
| Digestive enzyme | CHIA | 0.56 a | 0.93 b | 1.89 c | 1.84 c | 0.11 | <0.0001 | 0.1518 | 0.0500 | 
| LCT | 1.38 | 2.36 | 0.86 | 0.93 | 0.34 | 0.0052 | 0.1290 | 0.1849 | |
| PGA5 | 0.70 | 0.96 | 1.58 | 1.65 | 0.10 | <0.0001 | 0.1114 | 0.3509 | |
| Gastrin receptor | CCKBR | 0.57 | 1.26 | 1.62 | 1.92 | 0.14 | <0.0001 | 0.0004 | 0.1498 | 
| Ghrelin | GHRL | 0.92 a | 1.29 b | 1.07 b | 1.04 b | 0.08 | 0.5348 | 0.0408 | 0.0225 | 
| Histamine production | HDC | 0.87 a | 1.47 b | 1.07 a | 1.07 a | 0.09 | 0.2954 | 0.0022 | 0.0024 | 
| Inflammation | CXCL8 | 1.88 | 1.58 | 0.88 | 0.97 | 0.23 | 0.0006 | 0.6554 | 0.3851 | 
| IL22 | 1.87 | 1.44 | 1.05 | 1.34 | 0.35 | 0.1993 | 0.8382 | 0.3069 | |
| TNF | 1.26 | 1.16 | 0.84 | 1.02 | 0.08 | 0.0005 | 0.6248 | 0.0722 | |
| Mucus production | MUC1 | 1.04 | 1.04 | 0.99 | 1.16 | 0.07 | 0.5814 | 0.2019 | 0.1857 | 
| MUC5AC | 1.35 ab | 1.09 a | 1.04 a | 1.41 b | 0.09 | 0.9747 | 0.5364 | 0.0008 | |
| MUC6 | 0.97 | 1.59 | 1.46 | 1.85 | 0.19 | 0.0494 | 0.0081 | 0.5401 | |
| Somatostatin | SST | 1.04 | 1.16 | 1.02 | 1.12 | 0.10 | 0.7343 | 0.2274 | 0.8843 | 
| Somatostatin receptor | SSTR2 | 0.66 | 1.17 | 1.24 | 1.49 | 0.11 | <0.0001 | 0.0007 | 0.2324 | 
| Toll-like receptor | TLR4 | 1.27 a | 1.09 ab | 0.84 c | 0.98 bc | 0.05 | <0.0001 | 0.7243 | 0.0039 | 
| The pyloric gland region | |||||||||
| Aryl hydrocarbon receptor | AHR | 1.03 a | 1.15 b | 1.02 a | 0.92 a | 0.05 | 0.0218 | 0.9636 | 0.0388 | 
| Calcium-sensing receptor | CASR | 1.52 | 1.61 | 0.91 | 0.73 | 0.11 | <0.0001 | 0.6906 | 0.2046 | 
| Gastrin | GAST | 1.49 | 1.94 | 0.85 | 0.83 | 0.16 | <0.0001 | 0.1778 | 0.1471 | 
| Inflammation | CXCL8 | 1.41 | 1.48 | 1.24 | 1.19 | 0.23 | 0.3226 | 0.9888 | 0.7853 | 
| TNF | 1.05 | 1.17 | 1.11 | 0.99 | 0.10 | 0.5767 | 0.9853 | 0.2352 | |
| Mucosal defense | PIGR | 0.86 | 1.10 | 1.20 | 1.71 | 0.15 | 0.0019 | 0.0141 | 0.3588 | 
| Mucus production | MUC5AC | 0.93 | 0.92 | 1.17 | 1.22 | 0.07 | 0.0002 | 0.7673 | 0.6766 | 
| MUC6 | 0.88 | 0.70 | 3.55 | 2.59 | 0.36 | <0.0001 | 0.1151 | 0.2756 | |
| Somatostatin | SST | 1.32 | 1.30 | 0.90 | 0.79 | 0.08 | <0.0001 | 0.4367 | 0.5789 | 
| Toll-like receptor | TLR4 | 1.14 | 1.22 | 1.07 | 0.99 | 0.09 | 0.1080 | 0.9737 | 0.3856 | 
| Time | Pre-Weaning | Post-Weaning | SEM | p-Value + | |||||
|---|---|---|---|---|---|---|---|---|---|
| Maternal Diet | Control | Probiotic | Control | Probiotic | T | M | T × M | ||
| Function | Gene | ||||||||
| The fundic gland region | |||||||||
| Acid stimulation | HRH2, CCKBR, CHRM3, HDC | 0.94 | 1.28 | 1.18 | 1.33 | 0.06 | 0.0251 | 0.0003 | 0.1217 | 
| Acid inhibition | SST, SSTR2 | 0.85 | 1.17 | 1.13 | 1.30 | 0.08 | 0.0075 | 0.0018 | 0.3545 | 
| Acid secretion | ATP4A, CLIC6, KCNE1, KCNQ1 | 0.72 a | 1.35 b | 1.49 b | 1.68 b | 0.11 | <0.0001 | 0.0003 | 0.0452 | 
| Mucus production | MUC1, MUC5AC, MUC6 | 1.12 | 1.24 | 1.16 | 1.47 | 0.08 | 0.0809 | 0.0068 | 0.2292 | 
| The pyloric gland region | |||||||||
| Mucus production | MUC5AC, MUC6 | 0.90 | 0.81 | 2.36 | 1.91 | 0.18 | <0.0001 | 0.1286 | 0.3131 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kiernan, D.P.; O’Doherty, J.V.; Ryan, M.T.; Sweeney, T. Effects of Maternal Probiotics and Piglet Dietary Tryptophan Level on Gastric Function Pre- and Post-Weaning. Agriculture 2025, 15, 310. https://doi.org/10.3390/agriculture15030310
Kiernan DP, O’Doherty JV, Ryan MT, Sweeney T. Effects of Maternal Probiotics and Piglet Dietary Tryptophan Level on Gastric Function Pre- and Post-Weaning. Agriculture. 2025; 15(3):310. https://doi.org/10.3390/agriculture15030310
Chicago/Turabian StyleKiernan, Dillon. P., John V. O’Doherty, Marion T. Ryan, and Torres Sweeney. 2025. "Effects of Maternal Probiotics and Piglet Dietary Tryptophan Level on Gastric Function Pre- and Post-Weaning" Agriculture 15, no. 3: 310. https://doi.org/10.3390/agriculture15030310
APA StyleKiernan, D. P., O’Doherty, J. V., Ryan, M. T., & Sweeney, T. (2025). Effects of Maternal Probiotics and Piglet Dietary Tryptophan Level on Gastric Function Pre- and Post-Weaning. Agriculture, 15(3), 310. https://doi.org/10.3390/agriculture15030310
 
        


 
       