Intestinal Microbiota Reduction Followed by Fasting Discloses Microbial Triggering of Inflammation in Rheumatoid Arthritis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Objective and Rationale
2.2. Study Design and Population
2.3. Cytometric Profiling
2.4. Analysis of Cytometric Data
2.5. Serum Markers
2.6. Microbiome Sequencing
- 16S Primer fw: ACCGCGGCTGCTGGCAC
- 16S Primer rev: AGAGTTTGATCMTGGCTCAG
- ITS Primer fw: GTCCCTGCCCTTTGTACAC
- ITS Primer rev: CCTGGTTAGTTTCTTTTCCTCCGC
- 18S Primer fw: AACCTGGTTGATCCTGCCAGT
- 18S Primer rev: CTACGAGCTTTTTAACTGCAACAACTTTAATATACGC
2.7. Analysis of Microbiome Sequencing Data
2.8. Calculation of Pathway Frequencies Using the MACADAM Pathway Scores
2.9. Statistical Analysis
3. Results
3.1. Study Population
3.2. Microbiota Reduction Rapidly Reduced Disease Activity in Almost All RA Patients
3.3. Non-Classical Monocytes Are the Most Sensitive and Specific Subset Indicating Response in RA
3.4. Serum Inflammatory Markers Declined upon Microbiota Reduction
3.5. Effects of Bowel Cleansing with Fasting on Metabolites and Cortisol
3.6. 16.S rRNA Sequencing of the Gut Microbiota Indicated a Shift towards “Generalist Species” after Fasting
3.7. Internal Transcribed Spacer (ITS) and 18S rRNA Sequencing Indicate a Higher Prevalence of Eukaryotic Microbes in RA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Farshbafnadi, M.; Agah, E.; Rezaei, N. The second brain: The connection between gut microbiota composition and multiple sclerosis. J. Neuroimmunol. 2021, 360, 577700. [Google Scholar] [CrossRef]
- Menozzi, E.; Macnaughtan, J.; Schapira, A.H.V. The gut-brain axis and Parkinson disease: Clinical and pathogenetic relevance. Ann. Med. 2021, 53, 611–625. [Google Scholar] [CrossRef]
- Yoon, W.; Park, S.H.; Lee, J.S.; Byeon, J.H.; Kim, S.H.; Lim, J.; Yoo, Y. Probiotic mixture reduces gut inflammation and microbial dysbiosis in children with atopic dermatitis. Australas. J. Dermatol. 2021, 62, e386–e392. [Google Scholar] [CrossRef]
- Cannarella, L.A.T.; Mari, N.L.; Alcantara, C.C.; Iryioda, T.M.V.; Costa, N.T.; Oliveira, S.R.; Lozovoy, M.A.B.; Reiche, E.M.V.; Dichi, I.; Simao, A.N.C. Mixture of probiotics reduces inflammatory biomarkers and improves the oxidative/nitrosative profile in people with rheumatoid arthritis. Nutrition 2021, 89, 111282. [Google Scholar] [CrossRef]
- Karl, J.P.; Armstrong, N.J.; McClung, H.L.; Player, R.A.; Rood, J.C.; Racicot, K.; Soares, J.W.; Montain, S.J. A diet of U.S. military food rations alters gut microbiota composition and does not increase intestinal permeability. J. Nutr. Biochem. 2019, 72, 108217. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, A.; Cerdo, T.; Jauregui, R.; Pieper, D.H.; Marcos, A.; Clemente, A.; Garcia, F.; Margolles, A.; Ferrer, M.; Campoy, C.; et al. One-year calorie restriction impacts gut microbial composition but not its metabolic performance in obese adolescents. Environ. Microbiol. 2017, 19, 1536–1551. [Google Scholar] [CrossRef] [PubMed]
- Zarrinpar, A.; Chaix, A.; Yooseph, S.; Panda, S. Diet and feeding pattern affect the diurnal dynamics of the gut microbiome. Cell Metab. 2014, 20, 1006–1017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karl, J.P.; Hatch, A.M.; Arcidiacono, S.M.; Pearce, S.C.; Pantoja-Feliciano, I.G.; Doherty, L.A.; Soares, J.W. Effects of Psychological, Environmental and Physical Stressors on the Gut Microbiota. Front. Microbiol. 2018, 9, 2013. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.D.; Nguyen, L.H.; Li, Y.; Yan, Y.; Ma, W.; Rinott, E.; Ivey, K.L.; Shai, I.; Willett, W.C.; Hu, F.B.; et al. The gut microbiome modulates the protective association between a Mediterranean diet and cardiometabolic disease risk. Nat. Med. 2021, 27, 333–343. [Google Scholar] [CrossRef]
- Choi, I.Y.; Lee, C.; Longo, V.D. Nutrition and fasting mimicking diets in the prevention and treatment of autoimmune diseases and immunosenescence. Mol. Cell Endocrinol. 2017, 455, 4–12. [Google Scholar] [CrossRef] [Green Version]
- Jordan, S.; Tung, N.; Casanova-Acebes, M.; Chang, C.; Cantoni, C.; Zhang, D.; Wirtz, T.H.; Naik, S.; Rose, S.A.; Brocker, C.N.; et al. Dietary Intake Regulates the Circulating Inflammatory Monocyte Pool. Cell 2019, 178, 1102–1114.e17. [Google Scholar] [CrossRef] [PubMed]
- Nagai, M.; Noguchi, R.; Takahashi, D.; Morikawa, T.; Koshida, K.; Komiyama, S.; Ishihara, N.; Yamada, T.; Kawamura, Y.I.; Muroi, K.; et al. Fasting-Refeeding Impacts Immune Cell Dynamics and Mucosal Immune Responses. Cell 2019, 178, 1072–1087.e14. [Google Scholar] [CrossRef] [PubMed]
- Kjeldsen-Kragh, J.; Haugen, M.; Borchgrevink, C.F.; Laerum, E.; Eek, M.; Mowinkel, P.; Hovi, K.; Forre, O. Controlled trial of fasting and one-year vegetarian diet in rheumatoid arthritis. Lancet 1991, 338, 899–902. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, A.M.; Dell’Oro, M.; Kessler, C.S.; Schumann, D.; Steckhan, N.; Jeitler, M.; Fischer, J.M.; Spoo, M.; Kriegel, M.A.; Schneider, J.G.; et al. Efficacy of therapeutic fasting and plant-based diet in patients with rheumatoid arthritis (NutriFast): Study protocol for a randomised controlled clinical trial. BMJ Open 2021, 11, e047758. [Google Scholar] [CrossRef]
- Hartmann, A.M.; Dell’Oro, M.; Spoo, M.; Fischer, J.M.; Steckhan, N.; Jeitler, M.; Häupl, T.; Kandil, F.I.; Michalsen, A.; Koppold-Liebscher, D.A.; et al. To eat or not to eat—An exploratory randomized controlled trial on fasting and plant-based diet in rheumatoid arthritis (NutriFast-Study). Front. Nutr. 2022, 9, 1030380. [Google Scholar] [CrossRef]
- von Schwartzenberg, R.J.; Bisanz, J.E.; Lyalina, S.; Spanogiannopoulos, P.; Ang, Q.Y.; Cai, J.; Dickmann, S.; Friedrich, M.; Liu, S.Y.; Collins, S.L.; et al. Caloric restriction disrupts the microbiota and colonization resistance. Nature 2021, 595, 272–277. [Google Scholar] [CrossRef]
- Mesnage, R.; Grundler, F.; Schwiertz, A.; Le Maho, Y.; Wilhelmi de Toledo, F. Changes in human gut microbiota composition are linked to the energy metabolic switch during 10 d of Buchinger fasting. J. Nutr. Sci. 2019, 8, e36. [Google Scholar] [CrossRef] [Green Version]
- Rinninella, E.; Cintoni, M.; Raoul, P.; Ianiro, G.; Laterza, L.; Lopetuso, L.R.; Ponziani, F.R.; Gasbarrini, A.; Mele, M.C. Gut Microbiota during Dietary Restrictions: New Insights in Non-Communicable Diseases. Microorganisms 2020, 8, 1140. [Google Scholar] [CrossRef]
- Schmidt, N.S.; Lorentz, A. Dietary restrictions modulate the gut microbiota: Implications for health and disease. Nutr. Res. 2021, 89, 10–22. [Google Scholar] [CrossRef]
- Mohr, A.E.; Gumpricht, E.; Sears, D.D.; Sweazea, K.L. Recent advances and health implications of dietary fasting regimens on the gut microbiome. Am. J. Physiol. Gastrointest. Liver Physiol. 2021, 320, G847–G863. [Google Scholar] [CrossRef]
- Sundqvist, T.; Lindstrom, F.; Magnusson, K.E.; Skoldstam, L.; Stjernstrom, I.; Tagesson, C. Influence of fasting on intestinal permeability and disease activity in patients with rheumatoid arthritis. Scand. J. Rheumatol. 1982, 11, 33–38. [Google Scholar] [CrossRef] [PubMed]
- Tajik, N.; Frech, M.; Schulz, O.; Schalter, F.; Lucas, S.; Azizov, V.; Durholz, K.; Steffen, F.; Omata, Y.; Rings, A.; et al. Targeting zonulin and intestinal epithelial barrier function to prevent onset of arthritis. Nat. Commun. 2020, 11, 1995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zaiss, M.M.; Joyce Wu, H.J.; Mauro, D.; Schett, G.; Ciccia, F. The gut-joint axis in rheumatoid arthritis. Nat. Rev. Rheumatol. 2021, 17, 224–237. [Google Scholar] [CrossRef] [PubMed]
- Scherer, H.U.; Häupl, T.; Burmester, G.R. The etiology of rheumatoid arthritis. J. Autoimmun. 2020, 110, 102400. [Google Scholar] [CrossRef] [PubMed]
- Fraser, D.A.; Thoen, J.; Selvaag, A.M.; Djoseland, O.; Forre, O.; Kjeldsen-Kragh, J. A preliminary study of circadian serum cortisol concentrations in response to a 72-hour fast in rheumatoid arthritis patients not previously treated with corticosteroids. Clin. Rheumatol. 2001, 20, 85–87. [Google Scholar] [CrossRef]
- Smiljanovic, B.; Radzikowska, A.; Kuca-Warnawin, E.; Kurowska, W.; Grün, J.R.; Stuhlmüller, B.; Bonin, M.; Schulte-Wrede, U.; Sörensen, T.; Kyogoku, C.; et al. Monocyte alterations in rheumatoid arthritis are dominated by preterm release from bone marrow and prominent triggering in the joint. Ann. Rheum. Dis. 2018, 77, 300–308. [Google Scholar] [CrossRef]
- Smiljanovic, B.; Grützkau, A.; Sorensen, T.; Grün, J.R.; Vogl, T.; Bonin, M.; Schendel, P.; Stuhlmüller, B.; Claussnitzer, A.; Hermann, S.; et al. Synovial tissue transcriptomes of long-standing rheumatoid arthritis are dominated by activated macrophages that reflect microbial stimulation. Sci. Rep. 2020, 10, 7907. [Google Scholar] [CrossRef]
- Seignalet, J. Diet, fasting, and rheumatoid arthritis. Lancet 1992, 339, 68–69. [Google Scholar]
- Jalanka, J.; Salonen, A.; Salojarvi, J.; Ritari, J.; Immonen, O.; Marciani, L.; Gowland, P.; Hoad, C.; Garsed, K.; Lam, C.; et al. Effects of bowel cleansing on the intestinal microbiota. Gut 2015, 64, 1562–1568. [Google Scholar] [CrossRef]
- Martel, M.; Barkun, A.N.; Menard, C.; Restellini, S.; Kherad, O.; Vanasse, A. Split-Dose Preparations Are Superior to Day-Before Bowel Cleansing Regimens: A Meta-analysis. Gastroenterology 2015, 149, 79–88. [Google Scholar] [CrossRef] [Green Version]
- Faul, F.; Erdfelder, E.; Lang, A.G.; Buchner, A. G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav. Res. Methods 2007, 39, 175–191. [Google Scholar] [CrossRef] [PubMed]
- Fransen, J.; van Riel, P.L. The Disease Activity Score and the EULAR response criteria. Clin. Exp. Rheumatol. 2005, 23, S93–S99. [Google Scholar] [CrossRef] [PubMed]
- Aletaha, D.; Martinez-Avila, J.; Kvien, T.K.; Smolen, J.S. Definition of treatment response in rheumatoid arthritis based on the simplified and the clinical disease activity index. Ann. Rheum. Dis. 2012, 71, 1190–1196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schulte-Wrede, U.; Sörensen, T.; Grün, J.R.; Häupl, T.; Hirseland, H.; Steinbrich-Zollner, M.; Wu, P.; Radbruch, A.; Poddubnyy, D.; Sieper, J.; et al. An explorative study on deep profiling of peripheral leukocytes to identify predictors for responsiveness to anti-tumour necrosis factor alpha therapies in ankylosing spondylitis: Natural killer cells in focus. Arthritis Res. Ther. 2018, 20, 191. [Google Scholar] [CrossRef] [Green Version]
- Sörensen, T.; Baumgart, S.; Durek, P.; Grützkau, A.; Häupl, T. immunoClust—An automated analysis pipeline for the identification of immunophenotypic signatures in high-dimensional cytometric datasets. Cytometry A 2015, 87, 603–615. [Google Scholar] [CrossRef]
- Kohonen, T. The self-organizing map. Proc. IEEE 1990, 78, 1464–1480. [Google Scholar] [CrossRef]
- Raje, D.V.; Purohit, H.J.; Badhe, Y.P.; Tambe, S.S.; Kulkarni, B.D. Self-organizing maps: A tool to ascertain taxonomic relatedness based on features derived from 16S rDNA sequence. J. Biosci. 2010, 35, 617–627. [Google Scholar] [CrossRef]
- Iwasaki, Y.; Abe, T.; Wada, K.; Wada, Y.; Ikemura, T. A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM). Microorganisms 2013, 1, 137–157. [Google Scholar] [CrossRef] [Green Version]
- Yan, J. Self-Organizing Map (with Application in Gene Clustering). Available online: https://cran.r-project.org/web/packages/som/index.html (accessed on 1 June 2018).
- Le Boulch, M.; Dehais, P.; Combes, S.; Pascal, G. The MACADAM database: A MetAboliC pAthways DAtabase for Microbial taxonomic groups for mining potential metabolic capacities of archaeal and bacterial taxonomic groups. Database 2019, 2019, baz049. [Google Scholar] [CrossRef] [Green Version]
- Sugimoto, C.; Hasegawa, A.; Saito, Y.; Fukuyo, Y.; Chiu, K.B.; Cai, Y.; Breed, M.W.; Mori, K.; Roy, C.J.; Lackner, A.A.; et al. Differentiation Kinetics of Blood Monocytes and Dendritic Cells in Macaques: Insights to Understanding Human Myeloid Cell Development. J. Immunol. 2015, 195, 1774–1781. [Google Scholar] [CrossRef] [Green Version]
- Patel, A.A.; Zhang, Y.; Fullerton, J.N.; Boelen, L.; Rongvaux, A.; Maini, A.A.; Bigley, V.; Flavell, R.A.; Gilroy, D.W.; Asquith, B.; et al. The fate and lifespan of human monocyte subsets in steady state and systemic inflammation. J. Exp. Med. 2017, 214, 1913–1923. [Google Scholar] [CrossRef] [Green Version]
- Culemann, S.; Gruneboom, A.; Nicolas-Avila, J.A.; Weidner, D.; Lammle, K.F.; Rothe, T.; Quintana, J.A.; Kirchner, P.; Krljanac, B.; Eberhardt, M.; et al. Locally renewing resident synovial macrophages provide a protective barrier for the joint. Nature 2019, 572, 670–675. [Google Scholar] [CrossRef]
- Fasano, A.; Not, T.; Wang, W.; Uzzau, S.; Berti, I.; Tommasini, A.; Goldblum, S.E. Zonulin, a newly discovered modulator of intestinal permeability, and its expression in coeliac disease. Lancet 2000, 355, 1518–1519. [Google Scholar] [CrossRef]
- Caviglia, G.P.; Dughera, F.; Ribaldone, D.G.; Rosso, C.; Abate, M.L.; Pellicano, R.; Bresso, F.; Smedile, A.; Saracco, G.M.; Astegiano, M. Serum zonulin in patients with inflammatory bowel disease: A pilot study. Minerva Med. 2019, 110, 95–100. [Google Scholar] [CrossRef]
- Heidt, C.; Kammerer, U.; Fobker, M.; Ruffer, A.; Marquardt, T.; Reuss-Borst, M. Assessment of Intestinal Permeability and Inflammation Bio-Markers in Patients with Rheumatoid Arthritis. Nutrients 2023, 15, 2386. [Google Scholar] [CrossRef] [PubMed]
- Fasano, A. Intestinal permeability and its regulation by zonulin: Diagnostic and therapeutic implications. Clin. Gastroenterol. Hepatol. 2012, 10, 1096–1100. [Google Scholar] [CrossRef] [Green Version]
- van der Heijden, I.M.; Wilbrink, B.; Tchetverikov, I.; Schrijver, I.A.; Schouls, L.M.; Hazenberg, M.P.; Breedveld, F.C.; Tak, P.P. Presence of bacterial DNA and bacterial peptidoglycans in joints of patients with rheumatoid arthritis and other arthritides. Arthritis Rheum. 2000, 43, 593–598. [Google Scholar] [CrossRef] [PubMed]
- Fraenkel, L.; Bathon, J.M.; England, B.R.; St Clair, E.W.; Arayssi, T.; Carandang, K.; Deane, K.D.; Genovese, M.; Huston, K.K.; Kerr, G.; et al. 2021 American College of Rheumatology Guideline for the Treatment of Rheumatoid Arthritis. Arthritis Rheumatol. 2021, 73, 1108–1123. [Google Scholar] [CrossRef] [PubMed]
- Sabi, E.M.; Singh, A.; Althafar, Z.M.; Behl, T.; Sehgal, A.; Singh, S.; Sharma, N.; Bhatia, S.; Al-Harrasi, A.; Alqahtani, H.M.; et al. Elucidating the role of hypoxia-inducible factor in rheumatoid arthritis. Inflammopharmacology 2022, 30, 737–748. [Google Scholar] [CrossRef]
- Sehgal, A.; Behl, T.; Singh, S.; Sharma, N.; Albratty, M.; Alhazmi, H.A.; Meraya, A.M.; Aleya, L.; Sharma, A.; Bungau, S. Exploring the pivotal role of endothelin in rheumatoid arthritis. Inflammopharmacology 2022, 30, 1555–1567. [Google Scholar] [CrossRef]
- Kumar, S.; Behl, T.; Sachdeva, M.; Sehgal, A.; Kumari, S.; Kumar, A.; Kaur, G.; Yadav, H.N.; Bungau, S. Implicating the effect of ketogenic diet as a preventive measure to obesity and diabetes mellitus. Life Sci. 2021, 264, 118661. [Google Scholar] [CrossRef]
- Werumeus Buning, J.; Touw, D.J.; Brummelman, P.; Dullaart, R.P.F.; van den Berg, G.; van der Klauw, M.M.; Kamp, J.; Wolffenbuttel, B.H.R.; van Beek, A.P. Pharmacokinetics of oral hydrocortisone—Results and implications from a randomized controlled trial. Metabolism 2017, 71, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Borresen, S.W.; Klose, M.; Baslund, B.; Rasmussen, A.K.; Hilsted, L.; Friis-Hansen, L.; Locht, H.; Hansen, A.; Hetland, M.L.; Lydolph, M.C.; et al. Adrenal insufficiency is seen in more than one-third of patients during ongoing low-dose prednisolone treatment for rheumatoid arthritis. Eur. J. Endocrinol. 2017, 177, 287–295. [Google Scholar] [CrossRef] [Green Version]
- Malinin, T.I.; Pekin, T.J., Jr.; Zvaifler, N.J. Cytology of synovial fluid in rheumatoid arthritis. Am. J. Clin. Pathol. 1967, 47, 203–208. [Google Scholar] [CrossRef] [Green Version]
- Qin, Y.; Havulinna, A.S.; Liu, Y.; Jousilahti, P.; Ritchie, S.C.; Tokolyi, A.; Sanders, J.G.; Valsta, L.; Brozynska, M.; Zhu, Q.; et al. Combined effects of host genetics and diet on human gut microbiota and incident disease in a single population cohort. Nat. Genet. 2022, 54, 134–142. [Google Scholar] [CrossRef] [PubMed]
- Boren, T.; Falk, P.; Roth, K.A.; Larson, G.; Normark, S. Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science 1993, 262, 1892–1895. [Google Scholar] [CrossRef]
- Yang, H.; Wu, J.; Huang, X.; Zhou, Y.; Zhang, Y.; Liu, M.; Liu, Q.; Ke, S.; He, M.; Fu, H.; et al. ABO genotype alters the gut microbiota by regulating GalNAc levels in pigs. Nature 2022, 606, 358–367. [Google Scholar] [CrossRef] [PubMed]
- Ye, B.D.; Kim, B.M.; Jung, S.; Lee, H.S.; Hong, M.; Kim, K.; Moon, J.W.; Baek, J.; Oh, E.H.; Hwang, S.W.; et al. Association of FUT2 and ABO with Crohn’s disease in Koreans. J. Gastroenterol. Hepatol. 2020, 35, 104–109. [Google Scholar] [CrossRef]
- Bungau, S.G.; Behl, T.; Singh, A.; Sehgal, A.; Singh, S.; Chigurupati, S.; Vijayabalan, S.; Das, S.; Palanimuthu, V.R. Targeting Probiotics in Rheumatoid Arthritis. Nutrients 2021, 13, 3376. [Google Scholar] [CrossRef]
- Behl, T.; Mehta, K.; Sehgal, A.; Singh, S.; Sharma, N.; Ahmadi, A.; Arora, S.; Bungau, S. Exploring the role of polyphenols in rheumatoid arthritis. Crit. Rev. Food Sci. Nutr. 2022, 62, 5372–5393. [Google Scholar] [CrossRef]
- Behl, T.; Upadhyay, T.; Singh, S.; Chigurupati, S.; Alsubayiel, A.M.; Mani, V.; Vargas-De-La-Cruz, C.; Uivarosan, D.; Bustea, C.; Sava, C.; et al. Polyphenols Targeting MAPK Mediated Oxidative Stress and Inflammation in Rheumatoid Arthritis. Molecules 2021, 26, 6570. [Google Scholar] [CrossRef] [PubMed]
- Sietsma, J.H.; Wessels, J.G.H. Evidence for Covalent Linkages between Chitin and β-Glucan in a Fungal Wall. Microbiology 1979, 114, 99–108. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, S.; Luckowitsch, M.; Hogardt, M.; Lehrnbecher, T. Natural Killer Cell Line NK-92-Mediated Damage of Medically Important Fungi. J. Fungi 2021, 7, 144. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, S.; Tramsen, L.; Lehrnbecher, T. Natural Killer Cells in Antifungal Immunity. Front. Immunol. 2017, 8, 1623. [Google Scholar] [CrossRef]
Patient | Age | Gender | BMI | Diseased | RF | ACPA | Pred | Current Therapy | Previous Therapy | DAS28 | DAS28 Response | DAS | SDAI | SDAI Response | SDAI | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
(Years) | (Years) | (U/L) | (U/L) | (mg/d) | cDMARD | bDMARD | cDMARD | bDMARD | T0 | T1 | T2 | T3 | T1 | T2 | T3 | Best | Remission | T0 | T1 | T2 | T3 | T1 | T2 | T3 | Best | Remission | ||||
no immunosupressive medication | RA_01 | 49 | f | 32.4 | 6.9 | 59.3 | 184 | MTX | 4.06 | 4.08 | 4.10 | 3.17 | NR | NR | MR | MR | 11.3 | 11.8 | 9.6 | 7.3 | 4% | −15% | −35% | |||||||
RA_03 | 54 | f | 27.2 | 0.3 | 14 | 0.9 | 4.46 | 4.02 | 3.18 | 2.50 | NR | GR | GR | GR | Remission | 15.1 | 12.9 | 10.0 | 7.5 | −15% | −34% | −50% | MiR | |||||||
RA_09 | 22 | f | 17.2 | 21.2 | 14 | 0.5 | 5.54 | 4.63 | 4.49 | 3.98 | MR | MR | MR | MR | 41.4 | 41.4 | 41.1 | 36.3 | 0% | −1% | −12% | |||||||||
RA_13 | 61 | f | 24.0 | 11.3 | 49.9 | 300 | MTX | TOC | 4.97 | 5.76 | 5.68 | 6.64 | NR | NR | NR | NR | 24.3 | 33.5 | 27.3 | 46.0 | 38% | 12% | 89% | |||||||
Prednisolone | RA_08 | 65 | f | 20.0 | 5.1 | 935.4 | 272 | 2 | MTX | 4.42 | 3.92 | 3.63 | 3.24 | NR | MR | MR | MR | 30.8 | 21.7 | 22.9 | 19.4 | −30% | −26% | −37% | ||||||
RA_16 | 41 | f | 25.4 | 0.9 | 14 | 0.4 | 2.5 | 2.32 | 2.18 | 2.47 | 2.18 | SR | SR | SR | SR | Remission | 6.3 | 4.6 | 5.7 | 4.9 | −27% | −10% | −22% | |||||||
RA_12 | 31 | f | 22.7 | 7.3 | 70.6 | 212 | 5 | 3.13 | 2.75 | 1.99 | 2.48 | NR | MR | MR | MR | Remission | 13.0 | 7.4 | 6.0 | 6.3 | −43% | −54% | −52% | MiR | ||||||
RA_18 | 65 | f | 20.5 | 4.6 | 14 | 340 | 5 | 4.98 | 4.47 | 3.98 | 3.17 | NR | MR | GR | GR | 26.3 | 22.2 | 18.1 | 14.8 | −16% | −31% | −44% | ||||||||
RA_19 | 70 | f | 25.1 | 6.6 | 14 | 0.4 | 5 | MTX | 5.96 | 5.37 | 4.64 | 4.37 | NR | MR | MR | MR | 33.5 | 23.5 | 21.3 | 19.7 | −30% | −36% | −41% | |||||||
cDMARD ± prednisolone | RA_05 | 77 | m | 20.6 | 36.1 | 31.3 | 67 | MTX | 5.04 | 3.23 | 2.66 | 2.58 | MR | GR | GR | GR | Remission | 19.5 | 8.8 | 12.2 | 5.6 | −55% | −37% | −71% | MoR | |||||
RA_04 | 50 | f | 21.5 | 1.7 | 31.3 | 340 | 5 | MTX | 1.82 | 1.25 | 1.05 | 0.49 | SR | MR | GR | GR | Remission | 3.6 | 2.8 | 2.7 | 0.1 | −22% | −25% | −97% | MaR | Remission | ||||
RA_17 | 52 | f | 20.8 | 8.6 | 104 | 285 | 5 | LEF | MTX | 4.78 | 4.70 | 3.21 | 3.75 | NR | MR | MR | MR | 24.7 | 23.6 | 18.1 | 17.6 | −4% | −27% | −29% | ||||||
RA_11 | 72 | f | 27.8 | 16.1 | 195.1 | 275 | 6 | MTX | 5.20 | 5.03 | 4.45 | 3.96 | NR | MR | MR | MR | 28.4 | 20.8 | 14.0 | 10.5 | −27% | −51% | −63% | MiR | ||||||
RA_02 | 63 | f | 32.9 | 14.9 | 14 | 0.4 | 10 | MTX | ABT RTX | 7.05 | 6.26 | 6.70 | 6.18 | NR | NR | NR | NR | 49.9 | 36.8 | 44.9 | 41.2 | −26% | −10% | −17% | ||||||
bDMARD ± prednisolone | RA_10 | 53 | f | 25.5 | 35.2 | 600 | 12.4 | TOC | MTX, SSZ, HCQ | ADA ETN | 2.64 | 1.93 | 1.41 | 1.55 | MR | GR | MR | GR | Remission | 11.1 | 7.6 | 3.2 | 2.6 | −32% | −71% | −77% | MoR | Remission | ||
RA_07 | 52 | f | 39.9 | 0.9 | 151 | 60 | 5 | ETN | MTX | 5.83 | 4.57 | 4.31 | 2.93 | MR | MR | GR | GR | 38.3 | 24.4 | 21.2 | 7.1 | −36% | −45% | −81% | MoR | |||||
RA_14 | 34 | f | 23.9 | 20.3 | 119.7 | 30 | 15 | CZP | 3.97 | 5.16 | 3.89 | 3.61 | NR | NR | NR | NR | 19.3 | 27.6 | 19.4 | 16.3 | 43% | 1% | −16% | |||||||
bDMARD & MTX & prednisolone | RA_20 | 61 | f | 26.1 | 25.6 | 14 | 0.8 | 5 | MTX | ABT | 4.93 | 5.06 | 4.26 | 3.49 | NR | MR | MR | MR | 24.7 | 25.1 | 15.4 | 14.5 | 2% | −38% | −41% | |||||
RA_06 | 22 | f | 25.5 | 6.1 | 240.4 | 2.6 | 7.5 | MTX | ADA | LEF | CZP TOC | 3.24 | 2.62 | 1.93 | 1.96 | MR | GR | GR | GR | Remission | 11.4 | 6.0 | 5.5 | 1.7 | −47% | −52% | −85% | MaR | Remission | |
RA_15 | 30 | f | 22.3 | 1.9 | 14 | 136 | 10 | MTX | ETN | ADA ABT | 3.45 | 3.17 | 2.51 | 2.23 | NR | MR | GR | GR | Remission | 13.6 | 11.1 | 6.1 | 6.0 | −18% | −55% | −56% | MiR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Häupl, T.; Sörensen, T.; Smiljanovic, B.; Darcy, M.; Scheder-Bieschin, J.; Steckhan, N.; Hartmann, A.M.; Koppold, D.A.; Stuhlmüller, B.; Skriner, K.; et al. Intestinal Microbiota Reduction Followed by Fasting Discloses Microbial Triggering of Inflammation in Rheumatoid Arthritis. J. Clin. Med. 2023, 12, 4359. https://doi.org/10.3390/jcm12134359
Häupl T, Sörensen T, Smiljanovic B, Darcy M, Scheder-Bieschin J, Steckhan N, Hartmann AM, Koppold DA, Stuhlmüller B, Skriner K, et al. Intestinal Microbiota Reduction Followed by Fasting Discloses Microbial Triggering of Inflammation in Rheumatoid Arthritis. Journal of Clinical Medicine. 2023; 12(13):4359. https://doi.org/10.3390/jcm12134359
Chicago/Turabian StyleHäupl, Thomas, Till Sörensen, Biljana Smiljanovic, Marine Darcy, Justus Scheder-Bieschin, Nico Steckhan, Anika M. Hartmann, Daniela A. Koppold, Bruno Stuhlmüller, Karl Skriner, and et al. 2023. "Intestinal Microbiota Reduction Followed by Fasting Discloses Microbial Triggering of Inflammation in Rheumatoid Arthritis" Journal of Clinical Medicine 12, no. 13: 4359. https://doi.org/10.3390/jcm12134359
APA StyleHäupl, T., Sörensen, T., Smiljanovic, B., Darcy, M., Scheder-Bieschin, J., Steckhan, N., Hartmann, A. M., Koppold, D. A., Stuhlmüller, B., Skriner, K., Walewska, B. M., Hoppe, B., Bonin, M., Burmester, G. R., Schendel, P., Feist, E., Liere, K., Meixner, M., Kessler, C., ... Michalsen, A. (2023). Intestinal Microbiota Reduction Followed by Fasting Discloses Microbial Triggering of Inflammation in Rheumatoid Arthritis. Journal of Clinical Medicine, 12(13), 4359. https://doi.org/10.3390/jcm12134359