Potential Role of Rainbow Trout Erythrocytes as Mediators in the Immune Response Induced by a DNA Vaccine in Fish
Abstract
:1. Introduction
2. Material and Methods
2.1. Animals
2.2. Plasmids
2.3. DNA Immunization
2.4. Purification of Head Kidney and Peripheral Blood RBCs for Transcriptome Analysis, by Means of FACS Single-Cell Sorting
2.5. Transcriptome Analysis of RBCs
2.6. Proteome Analysis of RBCs
2.7. Pathway Enrichment Analysis
2.8. RNA Extraction, cDNA Synthesis, and RT-qPCR Gene Expression
2.9. Coculture of Transfected RBCs with White Blood Cells
2.10. Enzyme-Linked Immunosorbent Assay (ELISA)
2.11. Statistical Analysis
2.12. Ethics Statement
3. Results
3.1. RNA Sequencing of HK-RBC from GVHSV Immunized Rainbow Trout
3.2. RNA Sequencing of PB-RBCs from GVHSV-Immunized Rainbow Trout
3.3. Proteome Sequencing of PB-RBC from GVHSV-Immunized Rainbow Trout
3.4. Overrepresented pathways RT-qPCR analysis
3.5. Leukocyte Proliferation
3.6. Antibody Detection in GVHSV-RBCs Reinfusion/Immunization
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Food and Agriculture Organization of the United Nations (FAO). The State Of World Fisheries and Aquaculture. Meeting the Sustainable Development Goals; FAO: Rome, Italy, 2018. [Google Scholar]
- Collins, C.; Lorenzen, N.; Collet, B. DNA vaccination for finfish aquaculture. Fish. Shellfish Immunol. 2019, 85, 106–125. [Google Scholar] [CrossRef]
- Tonheim, T.C.; Bogwald, J.; Dalmo, R.A. What happens to the DNA vaccine in fish? A review of current knowledge. Fish. Shellfish Immunol. 2008, 25, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Kurath, G. Fish. Novirhabdoviruses; Caister Academic Press: Norfolk, UK, 2012. [Google Scholar]
- Sommerset, I.; Krossoy, B.; Biering, E.; Frost, P. Vaccines for fish in aquaculture. Expert Rev. Vaccines 2005, 4, 89–101. [Google Scholar] [CrossRef] [PubMed]
- Biering, E.; Villoing, S.; Sommerset, I.; Christie, K.E. Update on viral vaccines for fish. Dev. Biol. 2005, 121, 97–113. [Google Scholar]
- Morera, D.; MacKenzie, S.A. Is there a direct role for erythrocytes in the immune response? Vet. Res. 2011, 42, 89. [Google Scholar] [CrossRef]
- Nombela, I.; Ortega-Villaizan, M.D.M. Nucleated red blood cells: Immune cell mediators of the antiviral response. PLoS Pathog. 2018, 14, e1006910. [Google Scholar] [CrossRef]
- Nombela, I.; Puente-Marin, S.; Chico, V.; Villena, A.J.; Carracedo, B.; Ciordia, S.; Mena, M.C.; Mercado, L.; Perez, L.; Coll, J.; et al. Identification of diverse defense mechanisms in rainbow trout red blood cells in response to halted replication of VHS virus. F1000Research 2017, 6, 1958. [Google Scholar] [CrossRef]
- Nombela, I.; Carrion, A.; Puente-Marin, S.; Chico, V.; Mercado, L.; Perez, L.; Coll, J.; Ortega-Villaizan, M.D.M. Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective. F1000Research 2017, 6, 1968. [Google Scholar] [CrossRef]
- Workenhe, S.T.; Kibenge, M.J.; Wright, G.M.; Wadowska, D.W.; Groman, D.B.; Kibenge, F.S. Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes. Virol. J. 2008, 5, 36. [Google Scholar] [CrossRef]
- Morera, D.; Roher, N.; Ribas, L.; Balasch, J.C.; Donate, C.; Callol, A.; Boltana, S.; Roberts, S.; Goetz, G.; Goetz, F.W.; et al. RNA-Seq reveals an integrated immune response in nucleated erythrocytes. PLoS ONE 2011, 6, e26998. [Google Scholar] [CrossRef] [PubMed]
- Dahle, M.K.; Wessel, O.; Timmerhaus, G.; Nyman, I.B.; Jorgensen, S.M.; Rimstad, E.; Krasnov, A. Transcriptome analyses of Atlantic salmon (Salmo salar L.) erythrocytes infected with piscine orthoreovirus (PRV). Fish. Shellfish Immunol. 2015, 45, 780–790. [Google Scholar] [CrossRef] [PubMed]
- Puente-Marin, S.; Nombela, I.; Chico, V.; Ciordia, S.; Mena, M.C.; Coll, J.; Mercado, L.; Ortega-Villaizan, M.D.M. Rainbow trout erythrocytes ex vivo transfection with a DNA vaccine encoding VHSV glycoprotein G induces an antiviral immune response. Front. Immunol. 2018, 9, 2477. [Google Scholar] [CrossRef] [PubMed]
- Murray, A.M.; Pearson, I.F.; Fairbanks, L.D.; Chalmers, R.A.; Bain, M.D.; Bax, B.E. The mouse immune response to carrier erythrocyte entrapped antigens. Vaccine 2006, 24, 6129–6139. [Google Scholar] [CrossRef] [PubMed]
- Cremel, M.; Guerin, N.; Horand, F.; Banz, A.; Godfrin, Y. Red blood cells as innovative antigen carrier to induce specific immune tolerance. Int. J. Pharm. 2013, 443, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Hamidi, M.; Zarei, N.; Zarrin, A.; Mohammadi-Samani, S. Preparation and validation of carrier human erythrocytes loaded by bovine serum albumin as a model antigen/protein. Drug Deliv. 2007, 14, 295–300. [Google Scholar] [CrossRef] [PubMed]
- Hamidi, M.; Zarei, N.; Zarrin, A.H.; Mohammadi-Samani, S. Preparation and in vitro characterization of carrier erythrocytes for vaccine delivery. Int. J. Pharm. 2007, 338, 70–78. [Google Scholar] [CrossRef]
- Garu, A.; Moku, G.; Gulla, S.K.; Chaudhuri, A. Genetic immunization with in vivo dendritic cell-targeting liposomal DNA vaccine carrier induces long-lasting antitumor immune response. Mol. Ther. 2016, 24, 385–397. [Google Scholar] [CrossRef] [PubMed]
- Zaneti, A.B.; Yamamoto, M.M.; Sulczewski, F.B.; Almeida, B.D.S.; Souza, H.F.S.; Ferreira, N.S.; Maeda, D.; Sales, N.S.; Rosa, D.S.; Ferreira, L.C.S.; et al. Dendritic cell targeting using a DNA vaccine induces specific antibodies and CD4+ T cells to the dengue virus envelope protein domain III. Front. Immunol. 2019, 10, 59. [Google Scholar] [CrossRef]
- Andersen, T.K.; Zhou, F.; Cox, R.; Bogen, B.; Grodeland, G. A DNA vaccine that targets hemagglutinin to antigen-presenting cells protects mice against H7 influenza. J. Virol. 2017, 91, e01340-17. [Google Scholar] [CrossRef]
- Nombela, I.; Requena-Platek, R.; Morales-Lange, B.; Chico, V.; Puente-Marin, S.; Ciordia, S.; Mena, M.C.; Coll, J.; Perez, L.; Mercado, L.; et al. Rainbow trout red blood cells exposed to viral hemorrhagic septicemia virus up-regulate antigen-processing mechanisms and MHC I&II, CD86, and CD83 antigen-presenting cell markers. Cells 2019, 8, 386. [Google Scholar] [CrossRef]
- Ai, H.W.; Henderson, J.N.; Remington, S.J.; Campbell, R.E. Directed evolution of a monomeric, bright and photostable version of Clavularia cyan fluorescent protein: Structural characterization and applications in fluorescence imaging. Biochem. J. 2006, 400, 531–540. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Valtanen, P.; Ortega-Villaizan Mdel, M.; Martinez-Lopez, A.; Medina-Gali, R.; Perez, L.; Mackenzie, S.; Figueras, A.; Coll, J.M.; Estepa, A. Autophagy-inducing peptides from mammalian VSV and fish VHSV rhabdoviral G glycoproteins (G) as models for the development of new therapeutic molecules. Autophagy 2014, 10, 1666–1680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez-Lopez, A.; Garcia-Valtanen, P.; Ortega-Villaizan Mdel, M.; Chico, V.; Medina-Gali, R.M.; Perez, L.; Coll, J.; Estepa, A. Increasing versatility of the DNA vaccines through modification of the subcellular location of plasmid-encoded antigen expression in the in vivo transfected cells. PLoS ONE 2013, 8, e77426. [Google Scholar] [CrossRef] [PubMed]
- Chico, V.; Ortega-Villaizan, M.; Falco, A.; Tafalla, C.; Perez, L.; Coll, J.M.; Estepa, A. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences. Vaccine 2009, 27, 1938–1948. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Lopez, A.; Encinas, P.; Garcia-Valtanen, P.; Gomez-Casado, E.; Coll, J.M.; Estepa, A. Improving the safety of viral DNA vaccines: Development of vectors containing both 5′ and 3′ homologous regulatory sequences from non-viral origin. Appl. Microbiol. Biotechnol. 2013, 97, 3007–3016. [Google Scholar] [CrossRef] [PubMed]
- Garver, K.A.; Conway, C.M.; Elliott, D.G.; Kurath, G. Analysis of DNA-vaccinated fish reveals viral antigen in muscle, kidney and thymus, and transient histopathologic changes. Mar. Biotechnol. 2005, 7, 540–553. [Google Scholar] [CrossRef]
- Puente-Marin, S.; Nombela, I.; Ciordia, S.; Mena, M.C.; Chico, V.; Coll, J.; Ortega-Villaizan, M.D.M. In silico functional networks identified in fish nucleated red blood cells by means of transcriptomic and proteomic profiling. Genes 2018, 9, 202. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.H.; Pages, F.; Trajanoski, Z.; Galon, J. ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef]
- Bindea, G.; Galon, J.; Mlecnik, B. CluePedia Cytoscape plugin: Pathway insights using integrated experimental and in silico data. Bioinformatics 2013, 29, 661–663. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: protein—Pprotein association networks with increased coverage, supporting functional discovery in genome—wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [PubMed]
- Gotz, S.; Garcia-Gomez, J.M.; Terol, J.; Williams, T.D.; Nagaraj, S.H.; Nueda, M.J.; Robles, M.; Talon, M.; Dopazo, J.; Conesa, A. High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 2008, 36, 3420–3435. [Google Scholar] [CrossRef] [PubMed]
- Ortega-Villaizan, M.; Martinez-Lopez, A.; Garcia-Valtanen, P.; Chico, V.; Perez, L.; Coll, J.M.; Estepa, A. Ex vivo transfection of trout pronephros leukocytes, a model for cell culture screening of fish DNA vaccine candidates. Vaccine 2012, 30, 5983–5990. [Google Scholar] [CrossRef] [PubMed]
- Raida, M.K.; Buchmann, K. Temperature-dependent expression of immune-relevant genes in rainbow trout following Yersinia ruckeri vaccination. Dis. Aquat. Org. 2007, 77, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Chico, V.; Gomez, N.; Estepa, A.; Perez, L. Rapid detection and quantitation of viral hemorrhagic septicemia virus in experimentally challenged rainbow trout by real-time RT-PCR. J. Virol. Methods 2006, 132, 154–159. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Barreda, D.R.; Zhang, Y.A.; Boshra, H.; Gelman, A.E.; Lapatra, S.; Tort, L.; Sunyer, J.O. B lymphocytes from early vertebrates have potent phagocytic and microbicidal abilities. Nat. Immunol. 2006, 7, 1116–1124. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Bird, S.; Koussounadis, A.; Holland, J.W.; Carrington, A.; Zou, J.; Secombes, C.J. Identification of a novel IL-1 cytokine family member in teleost fish. J. Immunol. 2009, 183, 962–974. [Google Scholar] [CrossRef] [PubMed]
- Chico, V.; Puente-Marin, S.; Nombela, I.; Ciordia, S.; Mena, M.C.; Carracedo, B.; Villena, A.; Mercado, L.; Coll, J.; Ortega-Villaizan, M.D.M. Shape-shifted red blood cells: A novel red blood cell stage? Cells 2018, 7, 31. [Google Scholar] [CrossRef]
- Holland, J.W.; Karim, A.; Wang, T.; Alnabulsi, A.; Scott, J.; Collet, B.; Mughal, M.S.; Secombes, C.J.; Bird, S. Molecular cloning and characterization of interferon regulatory factors 4 and 8 (IRF-4 and IRF-8) in rainbow trout, Oncorhynchus mykiss. Fish. Shellfish Immunol. 2010, 29, 157–166. [Google Scholar] [CrossRef]
- Chaves-Pozo, E.; Montero, J.; Cuesta, A.; Tafalla, C. Viral hemorrhagic septicemia and infectious pancreatic necrosis viruses replicate differently in rainbow trout gonad and induce different chemokine transcription profiles. Dev. Comp. Immunol. 2010, 34, 648–658. [Google Scholar] [CrossRef] [PubMed]
- Jorgensen, T.R.; Raida, M.K.; Kania, P.W.; Buchmann, K. Response of rainbow trout (Oncorhynchus mykiss) in skin and fin tissue during infection with a variant of Gyrodactylus salaris (Monogenea: Gyrodactylidae). Folia Parasitol. 2009, 56, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Ortega-Villaizan, M.; Chico, V.; Martinez-Lopez, A.; Falco, A.; Perez, L.; Coll, J.M.; Estepa, A. In vitro analysis of the factors contributing to the antiviral state induced by a plasmid encoding the viral haemorrhagic septicaemia virus glycoprotein G in transfected trout cells. Vaccine 2011, 29, 737–743. [Google Scholar] [CrossRef] [PubMed]
- Zwollo, P.; Haines, A.; Rosato, P.; Gumulak-Smith, J. Molecular and cellular analysis of B-cell populations in the rainbow trout using Pax5 and immunoglobulin markers. Dev. Comp. Immunol. 2008, 32, 1482–1496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barabas, S.; Spindler, T.; Kiener, R.; Tonar, C.; Lugner, T.; Batzilla, J.; Bendfeldt, H.; Rascle, A.; Asbach, B.; Wagner, R.; et al. An optimized IFN-gamma ELISpot assay for the sensitive and standardized monitoring of CMV protein-reactive effector cells of cell-mediated immunity. BMC Immunol. 2017, 18, 14. [Google Scholar] [CrossRef] [PubMed]
- Ceuppens, J.L.; Baroja, M.L.; Lorre, K.; Van Damme, J.; Billiau, A. Human T cell activation with phytohemagglutinin. The function of IL-6 as an accessory signal. J. Immunol. 1988, 141, 3868–3874. [Google Scholar] [PubMed]
- Wykes, M.; Renia, L. ELISPOT assay to measure peptide-specific IFN-γ production. Bio-Protoc. 2017, 7. [Google Scholar] [CrossRef]
- Morten, B.C.; Scott, R.J.; Avery-Kiejda, K.A. Comparison of three different methods for determining cell proliferation in breast cancer cell lines. J. Vis. Exp. 2016. [Google Scholar] [CrossRef]
- Sánchez, C.; Coll, J.; Domínguez, J. One-step purification of the major rainbow trout immunoglobulin. Vet. Immunol. Immunopathol. 1991, 27, 383–391. [Google Scholar] [CrossRef]
- Jung, M.H.; Chico, V.; Ciordia, S.; Mena, M.C.; Jung, S.J.; Ortega-Villaizan, M.D.M. The Megalocytivirus RBIV Induces Apoptosis and MHC Class I Presentation in Rock Bream (Oplegnathus fasciatus) Red Blood Cells. Front. Immunol. 2019, 10, 160. [Google Scholar] [CrossRef]
- Press, C.M.; Evensen, Ø. The morphology of the immune system in teleost fishes. Fish. Shellfish Immunol. 1999, 9, 309–318. [Google Scholar] [CrossRef] [Green Version]
- Tort, L.; Balasch, J.C.; Mackenzie, S. Fish immune system. A crossroads between innate and adaptive responses. Inmunología 2003, 22, 277–286. [Google Scholar]
- Mendez-Enriquez, E.; Garcia-Zepeda, E.A. The multiple faces of CCL13 in immunity and inflammation. Inflammopharmacology 2013, 21, 397–406. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Bing, Y.; Wang, X.; Yu, Q.; Wang, Y.; Xu, S.; Song, L.; Wang, X.; Xia, B.; Zhu, Y.; et al. CCL25/CCR9 interactions regulate the function of iNKT cells in oxazolone-induced colitis in mice. PLoS ONE 2014, 9, e100167. [Google Scholar] [CrossRef] [PubMed]
- Kucia, M.; Jankowski, K.; Reca, R.; Wysoczynski, M.; Bandura, L.; Allendorf, D.J.; Zhang, J.; Ratajczak, J.; Ratajczak, M.Z. CXCR4-SDF-1 signalling, locomotion, chemotaxis and adhesion. J. Mol. Histol. 2004, 35, 233–245. [Google Scholar] [CrossRef] [PubMed]
- Uehara, S.; Song, K.; Farber, J.M.; Love, P.E. Characterization of CCR9 expression and CCL25/thymus-expressed chemokine responsiveness during T cell development: CD3highCD69+ thymocytes and gammadeltaTCR+ thymocytes preferentially respond to CCL25. J. Immunol. 2002, 168, 134–142. [Google Scholar] [CrossRef] [PubMed]
- Galindo-Villegas, J.; Mulero, I.; Garcia-Alcazar, A.; Munoz, I.; Penalver-Mellado, M.; Streitenberger, S.; Scapigliati, G.; Meseguer, J.; Mulero, V. Recombinant TNFalpha as oral vaccine adjuvant protects European sea bass against vibriosis: Insights into the role of the CCL25/CCR9 axis. Fish. Shellfish Immunol. 2013, 35, 1260–1271. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Zhou, L.; Wang, H.Q.; Luo, X.C.; Dan, X.M.; Li, Y.W. Molecular cloning and expression analysis of CCL25 and its receptor CCR9s from Epinephelus coioides post Cryptocaryon irritans infection. Fish. Shellfish Immunol. 2017, 67, 402–410. [Google Scholar] [CrossRef]
- Monaco, J.J. A molecular model of MHC class-I-restricted antigen processing. Immunol. Today 1992, 13, 173–179. [Google Scholar] [CrossRef]
- Hewitt, E.W. The MHC class I antigen presentation pathway: Strategies for viral immune evasion. Immunology 2003, 110, 163–169. [Google Scholar] [CrossRef]
- Storni, T.; Bachmann, M.F. Loading of MHC class I and II presentation pathways by exogenous antigens: A quantitative in vivo comparison. J. Immunol. 2004, 172, 6129–6135. [Google Scholar] [CrossRef]
- Huang, A.Y.; Bruce, A.T.; Pardoll, D.M.; Levitsky, H.I. In vivo cross-priming of MHC class I-restricted antigens requires the TAP transporter. Immunity 1996, 4, 349–355. [Google Scholar] [CrossRef]
- Sever, L.; Vo, N.T.K.; Bols, N.C.; Dixon, B. Tapasin’s protein interactions in the rainbow trout peptide-loading complex. Dev. Comp. Immunol. 2018, 81, 262–270. [Google Scholar] [CrossRef] [PubMed]
- Joffre, O.P.; Segura, E.; Savina, A.; Amigorena, S. Cross-presentation by dendritic cells. Nat. Rev. Immunol. 2012, 12, 557–569. [Google Scholar] [CrossRef] [PubMed]
- Landis, E.D.; Palti, Y.; Dekoning, J.; Drew, R.; Phillips, R.B.; Hansen, J.D. Identification and regulatory analysis of rainbow trout tapasin and tapasin-related genes. Immunogenetics 2006, 58, 56–69. [Google Scholar] [CrossRef] [PubMed]
- Ritz, U.; Seliger, B. The transporter associated with antigen processing (TAP): Structural integrity, expression, function, and its clinical relevance. Mol. Med. 2001, 7, 149–158. [Google Scholar] [CrossRef] [PubMed]
- Ackerman, A.L.; Kyritsis, C.; Tampe, R.; Cresswell, P. Early phagosomes in dendritic cells form a cellular compartment sufficient for cross presentation of exogenous antigens. Proc. Natl. Acad. Sci. USA 2003, 100, 12889–12894. [Google Scholar] [CrossRef] [Green Version]
- Voeten, J.T.; Rimmelzwaan, G.F.; Nieuwkoop, N.J.; Fouchier, R.A.; Osterhaus, A.D. Antigen processing for MHC class I restricted presentation of exogenous influenza A virus nucleoprotein by B-lymphoblastoid cells. Clin. Exp. Immunol. 2001, 125, 423–431. [Google Scholar] [CrossRef]
- Yewdell, J.W.; Norbury, C.C.; Bennink, J.R. Mechanisms of exogenous antigen presentation by MHC class I molecules in vitro and in vivo: Implications for generating CD8+ T cell responses to infectious agents, tumors, transplants, and vaccines. Adv. Immunol. 1999, 73, 1–77. [Google Scholar]
- St Paul, M.; Paolucci, S.; Barjesteh, N.; Wood, R.D.; Sharif, S. Chicken erythrocytes respond to Toll-like receptor ligands by up-regulating cytokine transcripts. Res. Vet. Sci. 2013, 95, 87–91. [Google Scholar] [CrossRef]
- Sanchez-Mejorada, G.; Rosales, C. Signal transduction by immunoglobulin Fc receptors. J. Leukoc. Biol. 1998, 63, 521–533. [Google Scholar] [CrossRef]
- Lowell, C.A. Src-family kinases: Rheostats of immune cell signaling. Mol. Immunol. 2004, 41, 631–643. [Google Scholar] [CrossRef] [PubMed]
- Wang, A.V.; Scholl, P.R.; Geha, R.S. Physical and functional association of the high affinity immunoglobulin G receptor (FcγRI) with the kinases Hck and Lyn. J. Exp. Med. 1994, 180, 1165–1170. [Google Scholar] [CrossRef] [PubMed]
- Baruzzi, A.; Iacobucci, I.; Soverini, S.; Lowell, C.A.; Martinelli, G.; Berton, G. c-Abl and Src-family kinases cross-talk in regulation of myeloid cell migration. FEBS Lett. 2010, 584, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Zarbock, A.; Ley, K. Protein tyrosine kinases in neutrophil activation and recruitment. Arch. Biochem. Biophys. 2011, 510, 112–119. [Google Scholar] [CrossRef] [PubMed]
- Buttari, B.; Profumo, E.; Rigano, R. Crosstalk between red blood cells and the immune system and its impact on atherosclerosis. Biomed. Res. Int. 2015, 2015, 616834. [Google Scholar] [CrossRef]
- Choi, Y.; Bowman, J.W.; Jung, J.U. Autophagy during viral infection—A double-edged sword. Nat. Rev. Microbiol. 2018, 16, 341–354. [Google Scholar] [CrossRef] [PubMed]
- Glick, D.; Barth, S.; Macleod, K.F. Autophagy: Cellular and molecular mechanisms. J. Pathol. 2010, 221, 3–12. [Google Scholar] [CrossRef]
- Liu, L.; Zhu, B.; Wu, S.; Lin, L.; Liu, G.; Zhou, Y.; Wang, W.; Asim, M.; Yuan, J.; Li, L.; et al. Spring viraemia of carp virus induces autophagy for necessary viral replication. Cell Microbiol. 2015, 17, 595–605. [Google Scholar] [CrossRef]
- Li, C.; Fu, X.; Lin, Q.; Liu, L.; Liang, H.; Huang, Z.; Li, N. Autophagy promoted infectious kidney and spleen necrosis virus replication and decreased infectious virus yields in CPB cell line. Fish. Shellfish Immunol. 2017, 60, 25–32. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, N.; Hegazy, A.M.; Liu, X.; Wu, Z.; Liu, X.; Zhao, L.; Qin, Q.; Lan, J.; Lin, L. Autophagy induced by snakehead fish vesiculovirus inhibited its replication in SSN-1 cell line. Fish. Shellfish Immunol. 2016, 55, 415–422. [Google Scholar] [CrossRef]
- Pereiro, P.; Romero, A.; Diaz-Rosales, P.; Estepa, A.; Figueras, A.; Novoa, B. Nucleated teleost erythrocytes play an Nk-Lysin- and autophagy-dependent role in antiviral immunity. Front. Immunol. 2017, 8, 1458. [Google Scholar] [CrossRef] [PubMed]
- Sun, E.W.; Shi, Y.F. Apoptosis: The quiet death silences the immune system. Pharm. Ther. 2001, 92, 135–145. [Google Scholar] [CrossRef]
- Foller, M.; Huber, S.M.; Lang, F. Erythrocyte programmed cell death. IUBMB Life 2008, 60, 661–668. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Zhang, Q.; Xu, L.; Li, S.; Wang, D.; Zhao, J.; Liu, H.; Feng, J.; Lu, T. Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model. Oncotarget 2017, 8, 112222–112235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, C.J.; Sun, B.; Robertsen, B. Adjuvant activity of fish type I interferon shown in a virus DNA vaccination model. Vaccine 2015, 33, 2442–2448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kambayashi, T.; Laufer, T.M. Atypical MHC class II-expressing antigen-presenting cells: Can anything replace a dendritic cell? Nat. Rev. Immunol. 2014, 14, 719–730. [Google Scholar] [CrossRef] [PubMed]
- Cassatella, M.A. Human mature neutrophils as atypical APC. Blood 2017, 129, 1895–1896. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer | Probe | Reference or Accession Number |
---|---|---|---|---|
ccl13 | CCTCTTCAACAAGTGGTTTCTCTCA | AGAAGGGTCAACACAAAATGTCTTC | - | NM_001160689.1 |
cd8 | GAC TGC TGG CTG TGG CTT CC | CCC CGG AGC TGC CAT TCT | - | [25] |
cd83 | TTGGCTGATGAT TCTTTCGATATC | TGCTGCCAGGAG ACACTTGT | TCCTGCCCAATG TAACGGCTGTTG | [35] |
dnm2 | GTCAACAAGTCCATCAGGGATCT | CAACTCAGAATGGATGAAGTCTTTAGC | - | [14] |
ef1α | ACCCTCCTCTTGGTCGTTTC | TGATGACACCAACAGCAACA | GCTGTGCGTGACATGAGGCA | [36] |
gabarap | CCTCATCCATCCATTT TTACCTCTT | ATTCAACCGAAATCCCC ATCT | TCTGAATTTTATTTG CCTCCGGGTCTCC | [22] |
gvhsv | GGGCCTTCCTTCTACTGGTACTC | CGGAATCCCGTAATTTGGAAT | CTGTTGCTGCAAGGCGTCCCCT | [37] |
hck | CCATCTCCACTGGCCCTACA | TACCCTCATAGTCATACAGTGCGATAG | - | XM_021567092.1 |
ifit5 | CCCTGCCCTCATCTTTCTTCT | CCCTCAATGACTCTGACAAGCA | CCAGCTTCGGCCTGTTTCTGTTCCA | [14] |
igm | AAAGCCTACAAGAGGGAGACCGAT | AGAGTTATGAGGAAGAGTATGATGAAGGTG | CTCGTGTTGACTGACTGTCCATGCAGCAAC | [38] |
il8 | AGAGACACTGA GATCATTGCCAC | CCCTCTTCATTTG TTGTTGGC | TCCTGGCCCTCC TGACCATTACTG AG | [39,40] |
irf8 | CCGAGGAGGAGCAGAAGAGTAAAAG | GCGGCATTGAAAGAACCCAT | - | [41] |
mhcI | GACAGTCCGTCCCTCAGTGT | CTGGAAGGTTCCATCATCGT | - | [42] |
mhcII | TGCCATGCTGATGTGCAG | GTCCCTCAGCCAGGTCACT | CGCCTATGACTTCTACCCCAAACAAAT | [43] |
mx1-3 | TGAAGCCCAGGATGAAATGG | TGGCAGGTCGATGAGTGTGA | ACCTCATCAGCCTAGAGATTGGCTCCCC | [44] |
pax5 | ACGGAGATCGGATGTTCCTCTG | GATGCCGCGCTGTAGTAGTAC | - | [45] |
pkr | ACACCGCGTACCGATGTG | GGACGAACTGCTGCCTGAAT | CACCACCTCTGAGAGCGACACCACTTC | [9] |
tcr | AGCACCCAGACTGCCAAGCT | GAGGAGCCCTGGAACTCCA | TCT TCA TCG CTA AGA GTA CCT TCT ATG GCC TGG T | [25] |
ulk1 | CTTCTGCTGCTGGGTCTTCTG | GGTGACGGAAGAACTCCTCAAA | CGAAACCACAAGGACCGCATGGA | [22] |
wipi1 | CAAAGACATGAAGCTG CTGAAGA | GGTTCACAGAGAGGGC ACAGA | CTCAACACGCCCCACAA CCCCT | XM_021581280.1 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Puente-Marin, S.; Nombela, I.; Chico, V.; Ciordia, S.; Mena, M.C.; Perez, L.; Coll, J.; Ortega-Villaizan, M.d.M. Potential Role of Rainbow Trout Erythrocytes as Mediators in the Immune Response Induced by a DNA Vaccine in Fish. Vaccines 2019, 7, 60. https://doi.org/10.3390/vaccines7030060
Puente-Marin S, Nombela I, Chico V, Ciordia S, Mena MC, Perez L, Coll J, Ortega-Villaizan MdM. Potential Role of Rainbow Trout Erythrocytes as Mediators in the Immune Response Induced by a DNA Vaccine in Fish. Vaccines. 2019; 7(3):60. https://doi.org/10.3390/vaccines7030060
Chicago/Turabian StylePuente-Marin, Sara, Ivan Nombela, Veronica Chico, Sergio Ciordia, Maria Carmen Mena, Luis Perez, Julio Coll, and Maria del Mar Ortega-Villaizan. 2019. "Potential Role of Rainbow Trout Erythrocytes as Mediators in the Immune Response Induced by a DNA Vaccine in Fish" Vaccines 7, no. 3: 60. https://doi.org/10.3390/vaccines7030060
APA StylePuente-Marin, S., Nombela, I., Chico, V., Ciordia, S., Mena, M. C., Perez, L., Coll, J., & Ortega-Villaizan, M. d. M. (2019). Potential Role of Rainbow Trout Erythrocytes as Mediators in the Immune Response Induced by a DNA Vaccine in Fish. Vaccines, 7(3), 60. https://doi.org/10.3390/vaccines7030060