Curcumin Attenuates Fumonisin B1-Induced PK-15 Cell Apoptosis by Upregulating miR-1249 Expression to Inhibit the IRE1/MKK7/JNK/CASPASE3 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Test Reagents
2.3. Sequencing and Analysis
2.4. Prediction of the miRNA Target Genes
2.5. The Cell Viability Assay Using CCK-8
2.6. Cell Transfection and Target Gene Validation
2.7. Analysis of Cell Apoptosis Using a TUNEL Assay
2.8. Evaluation of Apoptosis and ROS Content Using a Flow Cytometry Analysis
2.9. Immunofluorescence Detection of Target Gene Expression
2.10. Determination of the Cell Proliferation Capability
2.11. Validation of Target Gene Expression
2.12. Detection of Apoptotic Proteins
2.13. Data Analysis
3. Results
3.1. Curcumin Alleviates FB1-Induced Apoptosis in Porcine Kidney Cells
3.2. FB1 Modulates the miRNA and mRNA Expression in Porcine Kidney Cells
3.3. Validation of the miR-1249 Target Gene Ern1
3.4. FB1 Activates the Target Gene Ern1 to Induce Apoptosis and ER Stress in PK-15 Cells
3.5. Cur Alleviates the Effect of FB1 on the ER Stress Pathway in PK-15 Cells
3.6. Effects of miR-1249 on ER Stress and Apoptosis
3.7. Cur and the miR-1249 Mimic Suppress Ern1-Induced ER Stress and Cell Apoptosis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, J.; Wen, J.; Tang, Y.; Shi, J.; Mu, G.; Yan, R.; Cai, J.; Long, M. Research Progress on Fumonisin B1 Contamination and Toxicity: A Review. Molecules 2021, 26, 5238. [Google Scholar] [CrossRef]
- Gao, Z.; Luo, K.; Zhu, Q.; Peng, J.; Liu, C.; Wang, X.; Li, S.; Zhang, H. The natural occurrence, toxicity mechanisms and management strategies of Fumonisin B1: A review. Environ. Pollut. 2023, 320, 121065. [Google Scholar] [CrossRef] [PubMed]
- Alvito, P.; Assunção, R.M.; Bajard, L.; Martins, C.; Mengelers, M.J.B.; Mol, H.; Namorado, S.; van den Brand, A.D.; Vasco, E.; Viegas, S.; et al. Current Advances, Research Needs and Gaps in Mycotoxins Biomonitoring under the HBM4EU—Lessons Learned and Future Trends. Toxins 2022, 14, 826. [Google Scholar] [CrossRef]
- Chen, J.; Wei, Z.; Wang, Y.; Long, M.; Wu, W.; Kuca, K. Fumonisin B(1): Mechanisms of toxicity and biological detoxification progress in animals. Food Chem. Toxicol. 2021, 149, 111977. [Google Scholar] [CrossRef]
- Zhu, L.; Yuhan, J.; Huang, K.; He, X.; Liang, Z.; Xu, W. Multidimensional analysis of the epigenetic alterations in toxicities induced by mycotoxins. Food Chem. Toxicol. 2021, 153, 112251. [Google Scholar] [CrossRef]
- Ezdini, K.; Ben Salah-Abbès, J.; Belgacem, H.; Mannai, M.; Abbès, S. Lactobacillus paracasei alleviates genotoxicity, oxidative stress status and histopathological damage induced by Fumonisin B1 in BALB/c mice. Toxicon 2020, 185, 46–56. [Google Scholar] [CrossRef]
- González-Quiroz, M.; Blondel, A.; Sagredo, A.; Hetz, C.; Chevet, E.; Pedeux, R. When Endoplasmic Reticulum Proteostasis Meets the DNA Damage Response. Trends Cell Biol. 2020, 30, 881–891. [Google Scholar] [CrossRef] [PubMed]
- Pontisso, I.; Ornelas-Guevara, R.; Combettes, L.; Dupont, G. A journey in UPR modelling. Biol. Cell 2023, 115, e2200111. [Google Scholar] [CrossRef]
- Yin, S.; Liu, X.; Fan, L.; Hu, H. Mechanisms of cell death induction by food-borne mycotoxins. Crit. Rev. Food Sci. Nutr. 2018, 58, 1406–1417. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Wang, Y. Fumonisin B(1) Induces Immunotoxicity and Apoptosis of Chicken Splenic Lymphocytes. Front. Vet. Sci. 2022, 9, 898121. [Google Scholar] [CrossRef]
- Li, H.; He, W.; Yue, D.; Wang, M.; Yuan, X.; Huang, K. Low doses of fumonisin B1 exacerbate ochratoxin A-induced renal injury in mice and the protective roles of heat shock protein 70. Chem. Biol. Interact. 2023, 369, 110240. [Google Scholar] [CrossRef] [PubMed]
- Johnson, V.J.; He, Q.; Kim, S.H.; Kanti, A.; Sharma, R.P. Increased susceptibility of renal epithelial cells to TNFalpha-induced apoptosis following treatment with fumonisin B1. Chem. Biol. Interact. 2003, 145, 297–309. [Google Scholar] [CrossRef]
- Kim, S.H.; Singh, M.P.; Sharma, C.; Kang, S.C. Fumonisin B1 actuates oxidative stress-associated colonic damage via apoptosis and autophagy activation in murine model. J. Biochem. Mol. Toxicol. 2018, 32, e22161. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Yang, S.; Huang, S.; Yan, R.; Wang, M.; Chen, S.; Cai, J.; Long, M.; Li, P. Transcriptome study reveals apoptosis of porcine kidney cells induced by fumonisin B1 via TNF signalling pathway. Food Chem. Toxicol. 2020, 139, 111274. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Zheng, H.; Niu, J.; Chen, X.; Li, H.; Rao, Z.; Guo, Y.; Zhang, W.; Wang, Z. Curcumin alleviates zearalenone-induced liver injury in mice by scavenging reactive oxygen species and inhibiting mitochondrial apoptosis pathway. Ecotoxicol. Environ. Saf. 2024, 277, 116343. [Google Scholar] [CrossRef] [PubMed]
- Saifi, B.; Haftcheshmeh, S.M.; Feligioni, M.; Izadpanah, E.; Rahimi, K.; Hassanzadeh, K.; Mohammadi, A.; Sahebkar, A. An overview of the therapeutic effects of curcumin in reproductive disorders with a focus on the antiinflammatory and immunomodulatory activities. Phytother. Res. 2022, 36, 808–823. [Google Scholar] [CrossRef]
- Fu, Y.S.; Chen, T.H.; Weng, L.; Huang, L.; Lai, D.; Weng, C.F. Pharmacological properties and underlying mechanisms of curcumin and prospects in medicinal potential. Biomed. Pharmacother. 2021, 141, 111888. [Google Scholar] [CrossRef]
- Tan, L.; Cao, Z.; Chen, H.; Xie, Y.; Yu, L.; Fu, C.; Zhao, W.; Wang, Y. Curcumin reduces apoptosis and promotes osteogenesis of human periodontal ligament stem cells under oxidative stress in vitro and in vivo. Life Sci. 2021, 270, 119125. [Google Scholar] [CrossRef]
- Liang, J.; Chen, J.; Yang, L.; Wu, D.; Xiong, L.; Guo, X.; Cao, H.; Zhang, C.; Hu, G.; Zhuang, Y. Curcumin alleviates atrazine-induced cardiotoxicity by inhibiting endoplasmic reticulum stress-mediated apoptosis in mice through ATF6/Chop/Bcl-2 signaling pathway. Biomed. Pharmacother. 2024, 171, 116205. [Google Scholar] [CrossRef] [PubMed]
- Fanoudi, S.; Alavi, M.S.; Mehri, S.; Hosseinzadeh, H. The protective effects of curcumin against cigarette smoke-induced toxicity: A comprehensive review. Phytother. Res. 2024, 38, 98–116. [Google Scholar] [CrossRef]
- Que, T.; Zheng, H.; Zeng, Y.; Liu, X.; Qi, G.; La, Q.; Liang, T.; Li, Z.; Yi, G.; Zhang, S.; et al. Correction to: HMGA1 stimulates MYH9-dependent ubiquitination of GSK-3β via PI3K/Akt/c-Jun signaling to promote malignant progression and chemoresistance in gliomas. Cell Death Dis. 2022, 13, 164. [Google Scholar] [CrossRef]
- Li, J.; Zhou, Y.; Zhang, W.; Bao, C.; Xie, Z. Relief of oxidative stress and cardiomyocyte apoptosis by using curcumin nanoparticles. Colloids Surf. B Biointerfaces 2017, 153, 174–182. [Google Scholar] [CrossRef]
- Tang, F.; Ling, C. Curcumin ameliorates chronic obstructive pulmonary disease by modulating autophagy and endoplasmic reticulum stress through regulation of SIRT1 in a rat model. J. Int. Med. Res. 2019, 47, 4764–4774. [Google Scholar] [CrossRef] [PubMed]
- Ayed, A. The role of natural products versus miRNA in renal cell carcinoma: Implications for disease mechanisms and diagnostic markers. Naunyn Schmiedebergs Arch. Pharmacol. 2024, 397, 6417–6437. [Google Scholar] [CrossRef]
- Smolarz, B.; Durczyński, A.; Romanowicz, H.; Szyłło, K.; Hogendorf, P. miRNAs in Cancer (Review of Literature). Int. J. Mol. Sci. 2022, 23, 2805. [Google Scholar] [CrossRef]
- Farasati Far, B.; Vakili, K.; Fathi, M.; Yaghoobpoor, S.; Bhia, M.; Naimi-Jamal, M.R. The role of microRNA-21 (miR-21) in pathogenesis, diagnosis, and prognosis of gastrointestinal cancers: A review. Life Sci. 2023, 316, 121340. [Google Scholar] [CrossRef] [PubMed]
- Murtaza, B.; Li, X.; Nawaz, M.Y.; Saleemi, M.K.; Li, G.; Jin, B.; Wang, L.; Xu, Y. Toxicodynamic of combined mycotoxins: MicroRNAs and acute-phase proteins as diagnostic biomarkers. Compr. Rev. Food Sci. Food Saf. 2024, 23, e13338. [Google Scholar] [CrossRef] [PubMed]
- Moon, Y.; Korcsmáros, T.; Nagappan, A.; Ray, N. MicroRNA target-based network predicts androgen receptor-linked mycotoxin stress. Ecotoxicol. Environ. Saf. 2022, 230, 113130. [Google Scholar] [CrossRef] [PubMed]
- Stachurska, A.; Ciesla, M.; Kozakowska, M.; Wolffram, S.; Boesch-Saadatmandi, C.; Rimbach, G.; Jozkowicz, A.; Dulak, J.; Loboda, A. Cross-talk between microRNAs, nuclear factor E2-related factor 2, and heme oxygenase-1 in ochratoxin A-induced toxic effects in renal proximal tubular epithelial cells. Mol. Nutr. Food Res. 2013, 57, 504–515. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Zhang, M.Y.; Li, N.; Wang, J.J.; Ge, W.; Tan, S.J.; Shen, W.; Li, L. Zearalenone exposure triggered porcine granulosa cells apoptosis via microRNAs-mediated focal adhesion pathway. Toxicol. Lett. 2020, 330, 80–89. [Google Scholar] [CrossRef]
- Chen, X.; Shi, C.; He, M.; Xiong, S.; Xia, X. Endoplasmic reticulum stress: Molecular mechanism and therapeutic targets. Signal Transduct. Target. Ther. 2023, 8, 352. [Google Scholar] [CrossRef]
- Wiseman, R.L.; Mesgarzadeh, J.S.; Hendershot, L.M. Reshaping endoplasmic reticulum quality control through the unfolded protein response. Mol. Cell 2022, 82, 1477–1491. [Google Scholar] [CrossRef] [PubMed]
- Niu, L.; Liu, X.; Zhao, J.; Wang, Y.; Li, Y.; Li, K.; Sun, Y.; Zheng, Y. 5-Nitro-2-(3-phenylpropylamino) benzoic acid induces apoptosis of human lens epithelial cells via reactive oxygen species and endoplasmic reticulum stress through the mitochondrial apoptosis pathway. Int. J. Mol. Med. 2021, 47, 59. [Google Scholar] [CrossRef]
- Kövesi, B.; Kulcsár, S.; Zándoki, E.; Szabó-Fodor, J.; Mézes, M.; Balogh, K.; Ancsin, Z.; Pelyhe, C. Short-term effects of deoxynivalenol, T-2 toxin, fumonisin B1 or ochratoxin on lipid peroxidation and glutathione redox system and its regulatory genes in common carp (Cyprinus carpio L.) liver. Fish. Physiol. Biochem. 2020, 46, 1921–1932. [Google Scholar] [CrossRef] [PubMed]
- Kulcsár, S.; Kövesi, B.; Balogh, K.; Zándoki, E.; Ancsin, Z.; Márta, B.E.; Mézes, M. Effects of Fusarium Mycotoxin Exposure on Lipid Peroxidation and Glutathione Redox System in the Liver of Laying Hens. Antioxidants 2021, 10, 1313. [Google Scholar] [CrossRef]
- Arumugam, T.; Pillay, Y.; Ghazi, T.; Nagiah, S.; Abdul, N.S.; Chuturgoon, A.A. Fumonisin B(1)-induced oxidative stress triggers Nrf2-mediated antioxidant response in human hepatocellular carcinoma (HepG2) cells. Mycotoxin Res. 2019, 35, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Cao, T.; Peng, B.; Zhou, X.; Cai, J.; Tang, Y.; Luo, J.; Xie, H.; Zhang, J.; Liu, S. Integrated signaling system under endoplasmic reticulum stress in eukaryotic microorganisms. Appl. Microbiol. Biotechnol. 2021, 105, 4805–4818. [Google Scholar] [CrossRef]
- Belyy, V.; Tran, N.H.; Walter, P. Quantitative microscopy reveals dynamics and fate of clustered IRE1α. Proc. Natl. Acad. Sci. USA 2020, 117, 1533–1542. [Google Scholar] [CrossRef]
- Sak, F.; Sengul, F.; Vatansev, H. The Role of Endoplasmic Reticulum Stress in Metabolic Diseases. Metab. Syndr. Relat. Disord. 2024, 22, 487–493. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Xu, T.; Peng, L.; Tang, X.; Chi, Q.; Li, M.; Li, S. Polystyrene nanoplastics aggravates lipopolysaccharide-induced apoptosis in mouse kidney cells by regulating IRE1/XBP1 endoplasmic reticulum stress pathway via oxidative stress. J. Cell. Physiol. 2023, 238, 151–164. [Google Scholar] [CrossRef] [PubMed]
- Karagöz, G.E.; Acosta-Alvear, D.; Nguyen, H.T.; Lee, C.P.; Chu, F.; Walter, P. An unfolded protein-induced conformational switch activates mammalian IRE1. Elife 2017, 6, e30700. [Google Scholar] [CrossRef]
- Fu, W.; Im, Y.G.; Kim, B.; Kim, O.S.; Yang, Y.; Song, J.; Liu, D.; Zhu, S.; Kang, J.S.; Kim, O. 625 nm Light Irradiation Prevented MC3T3-E1 Cells from Accumulation of Misfolded Proteins via ROS and ATP Production. Int. J. Mol. Sci. 2023, 24, 9257. [Google Scholar] [CrossRef]
- He, S.; Fu, T.; Yu, Y.; Liang, Q.; Li, L.; Liu, J.; Zhang, X.; Zhou, Q.; Guo, Q.; Xu, D.; et al. IRE1α regulates skeletal muscle regeneration through Myostatin mRNA decay. J. Clin. Investig. 2021, 131, e143737. [Google Scholar] [CrossRef]
- Dostálová, A.; Vlachová, M.; Gregorová, J.; Moráň, L.; Pečinka, L.; Gabrielová, V.; Vaňhara, P.; Ševčíková, S. The endoplasmic reticulum and its signaling pathways—A novel target for multiple myeloma treatment. Klin. Onkol. 2023, 37, 440–446. [Google Scholar] [CrossRef]
- Lam, M.; Marsters, S.A.; Ashkenazi, A.; Walter, P. Misfolded proteins bind and activate death receptor 5 to trigger apoptosis during unresolved endoplasmic reticulum stress. Elife 2020, 9, e52291. [Google Scholar] [CrossRef] [PubMed]
- Sisinni, L.; Pietrafesa, M.; Lepore, S.; Maddalena, F.; Condelli, V.; Esposito, F.; Landriscina, M. Endoplasmic Reticulum Stress and Unfolded Protein Response in Breast Cancer: The Balance between Apoptosis and Autophagy and Its Role in Drug Resistance. Int. J. Mol. Sci. 2019, 20, 857. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Guo, J.; Yang, N.; Huang, Y.; Hu, T.; Rao, C. Endoplasmic reticulum stress-mediated cell death in liver injury. Cell Death Dis. 2022, 13, 1051. [Google Scholar] [CrossRef]
- Qiu, L.; Liu, H.; Chen, S.; Wu, Y.; Yan, J. Inhibition of the endoplasmic reticulum stress-associated IRE-1 pathway alleviates preterm birth. Am. J. Reprod. Immunol. 2024, 91, e13826. [Google Scholar] [CrossRef]
- Wang, G.S.; Chen, J.Y.; Chen, W.C.; Wei, I.C.; Lin, S.W.; Liao, K.W.; Yang, T.S.; Liu, J.F. Surfactin induces ER stress-mediated apoptosis via IRE1-ASK1-JNK signaling in human osteosarcoma. Environ. Toxicol. 2022, 37, 574–584. [Google Scholar] [CrossRef] [PubMed]
- Song, C.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Hesperetin protects hippocampal neurons from the neurotoxicity of Aflatoxin B1 in mice. Ecotoxicol. Environ. Saf. 2024, 269, 115782. [Google Scholar] [CrossRef] [PubMed]
- Yi, Y.; Zhao, F.; Wang, N.; Liu, H.; Yu, L.; Wang, A.; Jin, Y. Endoplasmic reticulum stress is involved in the T-2 toxin-induced apoptosis in goat endometrium epithelial cells. J. Appl. Toxicol. 2018, 38, 1492–1501. [Google Scholar] [CrossRef]
- Yu, Y.; Wu, D.; Li, Y.; Qiao, H.; Shan, Z. Ketamine enhances autophagy and endoplasmic reticulum stress in rats and SV-HUC-1 cells via activating IRE1-TRAF2-ASK1-JNK pathway. Cell Cycle 2021, 20, 1907–1922. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.Y.; Pan, P.H.; Wu, C.C.; Liao, S.L.; Chen, W.Y.; Kuan, Y.H.; Wang, W.Y.; Chen, C.J. Endoplasmic Reticulum Stress Contributes to Gefitinib-Induced Apoptosis in Glioma. Int. J. Mol. Sci. 2021, 22, 3934. [Google Scholar] [CrossRef] [PubMed]
- Zahid, M.; Rawat, P.S.; Singh, S.; Gupta, A.K.; Ahmad, R.; Mahdi, A.A.; Ahmad, M.K.; Mehrotra, S. Assessment of Role and Efficacy of Curcumin and Quercetin in Preventing Lead-Induced Oxidative Stress in Rats. Indian J. Clin. Biochem. 2022, 37, 303–310. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhu, M.; Xian, R.; Chen, S.; Zang, Q.; Zhu, H.; Cao, C. A preliminary study on the pathology and molecular mechanism of fumonisin B(1) nephrotoxicity in young quails. Environ. Sci. Pollut. Res. Int. 2023, 30, 114438–114451. [Google Scholar] [CrossRef]
- Barangi, S.; Hayes, A.W.; Karimi, G. The more effective treatment of atrial fibrillation applying the natural compounds; as NADPH oxidase and ion channel inhibitors. Crit. Rev. Food Sci. Nutr. 2018, 58, 1230–1241. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Yu, W.; Wu, S.; Tang, L.; Zhong, G.; Wan, F.; Lan, J.; Zhang, H.; Pan, J.; Tang, Z.; et al. Arsenic (III) and/or Antimony (III) induced disruption of calcium homeostasis and endoplasmic reticulum stress resulting in apoptosis in mice heart. Ecotoxicol. Environ. Saf. 2021, 220, 112394. [Google Scholar] [CrossRef]
- Khoder-Agha, F.; Kietzmann, T. The glyco-redox interplay: Principles and consequences on the role of reactive oxygen species during protein glycosylation. Redox Biol. 2021, 42, 101888. [Google Scholar] [CrossRef] [PubMed]
- Cortés, A.; Pejenaute, Á.; Marqués, J.; Izal, Í.; Cenoz, S.; Ansorena, E.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. NADPH Oxidase 5 Induces Changes in the Unfolded Protein Response in Human Aortic Endothelial Cells and in Endothelial-Specific Knock-in Mice. Antioxidants 2021, 10, 194. [Google Scholar] [CrossRef] [PubMed]
- Camargo, L.L.; Wang, Y.; Rios, F.J.; McBride, M.; Montezano, A.C.; Touyz, R.M. Oxidative Stress and Endoplasmic Reticular Stress Interplay in the Vasculopathy of Hypertension. Can. J. Cardiol. 2023, 39, 1874–1887. [Google Scholar] [CrossRef] [PubMed]
- Rong, X.; Sun-Waterhouse, D.; Wang, D.; Jiang, Y.; Li, F.; Chen, Y.; Zhao, S.; Li, D. The Significance of Regulatory MicroRNAs: Their Roles in Toxicodynamics of Mycotoxins and in the Protection Offered by Dietary Therapeutics Against Mycotoxin-Induced Toxicity. Compr. Rev. Food Sci. Food Saf. 2019, 18, 48–66. [Google Scholar] [CrossRef] [PubMed]
- Chuturgoon, A.A.; Phulukdaree, A.; Moodley, D. Fumonisin B₁ modulates expression of human cytochrome P450 1b1 in human hepatoma (Hepg2) cells by repressing Mir-27b. Toxicol. Lett. 2014, 227, 50–55. [Google Scholar] [CrossRef]
- Chen, R.; Deng, L.; Yu, X.; Wang, X.; Zhu, L.; Yu, T.; Zhang, Y.; Zhou, B.; Xu, W.; Chen, L.; et al. MiR-122 partly mediates the ochratoxin A-induced GC-2 cell apoptosis. Toxicol In Vitro 2015, 30, 264–273. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Gao, J.; Huang, K.; Luo, Y.; Zhang, B.; Xu, W. miR-34a screened by miRNA profiling negatively regulates Wnt/β-catenin signaling pathway in Aflatoxin B1 induced hepatotoxicity. Sci. Rep. 2015, 5, 16732. [Google Scholar] [CrossRef]
- Chen, J.; Yang, S.; Li, P.; Wu, A.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. MicroRNA regulates the toxicological mechanism of four mycotoxins in vivo and in vitro. J. Anim. Sci. Biotechnol. 2022, 13, 37. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′-3′) | Accession |
---|---|---|
Ern1-F | ACCGTGGTGTCTCAGGATGTGG | XM_005668695.3 |
Ern1-R | CCAGCCAATGAGCAGGAAGGTG | |
Map2k7-F | GACTCCATTGCCAAGACCAGAGATG | XM_005661260.3 |
Map2k7-R | GCCAGTTCGTACAGTGTGATCCC | |
Jnk-F | ACTACAGAGCACCTGAGGTCATCC | XM_021073086.1 |
Jnk-R | ATTTCTCCCATAATGCACCCCACAG | |
Caspase3-F | AGAATTGGACTGTGGGATTGAGACG | NM_214131.1 |
Caspase3-R | GCCAGGAATAGTAACCAGGTGCTG | |
Gadph-F | GGCTGTGGGCAAGGTCATCC | NM_001206359.1 |
Gadph-R | TCTCCAGGCGGCAGGTCAG | |
miR-1249-F | AGTGCAGGGTCCGAGGTATTTATATACGCCCTTCCCCCCCT | MIMAT0025385 |
miR-1249-R | ATCCAGTGCAGGGTCCGAGG | |
U6-F | TCGCTTTGGCAGCACCTAT | |
U6-R | AATATGGAACGCTTCGCAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Xiong, D.; Long, M. Curcumin Attenuates Fumonisin B1-Induced PK-15 Cell Apoptosis by Upregulating miR-1249 Expression to Inhibit the IRE1/MKK7/JNK/CASPASE3 Signaling Pathway. Antioxidants 2025, 14, 168. https://doi.org/10.3390/antiox14020168
Chen J, Xiong D, Long M. Curcumin Attenuates Fumonisin B1-Induced PK-15 Cell Apoptosis by Upregulating miR-1249 Expression to Inhibit the IRE1/MKK7/JNK/CASPASE3 Signaling Pathway. Antioxidants. 2025; 14(2):168. https://doi.org/10.3390/antiox14020168
Chicago/Turabian StyleChen, Jia, Dongwei Xiong, and Miao Long. 2025. "Curcumin Attenuates Fumonisin B1-Induced PK-15 Cell Apoptosis by Upregulating miR-1249 Expression to Inhibit the IRE1/MKK7/JNK/CASPASE3 Signaling Pathway" Antioxidants 14, no. 2: 168. https://doi.org/10.3390/antiox14020168
APA StyleChen, J., Xiong, D., & Long, M. (2025). Curcumin Attenuates Fumonisin B1-Induced PK-15 Cell Apoptosis by Upregulating miR-1249 Expression to Inhibit the IRE1/MKK7/JNK/CASPASE3 Signaling Pathway. Antioxidants, 14(2), 168. https://doi.org/10.3390/antiox14020168