Hypoxia-Inducible Factor 1α Affects Yak Oocyte Maturation and Early Embryonic Development by Regulating Autophagy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Oocyte Collection and Treatment with DFOM and LW6
2.3. Parthenogenetic Activation and Embryo Culture
2.4. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
2.5. Immunofluorescence Staining
2.6. Detection of ROS Level in Oocytes
2.7. Detection of Actin Level in Oocytes
2.8. Detection of Mitochondrial Distribution in Oocytes
2.9. Detection of Mitochondrial Membrane Potential in Oocytes
2.10. Detection of Early Apoptosis of Oocytes
2.11. Detection of Apoptosis Level
2.12. Statistical Analyses
3. Results
3.1. DFOM and LW6 Regulate the Expression of HIF-1α
3.2. Effects of HIF-1α on Cumulus Expansion Area and First Polar Body Extrusion Rate of Yak Oocytes
3.3. Effect of HIF-1α on the Developmental Potential of Yak Oocytes
3.4. HIF-1α Regulates the Levels of Autophagy-Related Factors, CYP450s, and Cumulus Diffusion Factors in Yak Oocytes
3.5. HIF-1α Regulates the Levels of CYP450s and Cumulus Diffusion Factors in Yak Oocytes through Autophagy
3.6. HIF-1α Regulates the Developmental Potential of Yak Oocytes through Autophagy
3.7. HIF-1α Regulates the Dynamic Expression of Bax/Bcl-2 in Yak Oocytes and Preimplantation Parthenogenetic Embryos through Autophagy
3.8. HIF-1α Regulates Blastocyst Cell Fate and Apoptosis after Parthenogenetic Activation of Yak Oocytes through Autophagy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, H.; Wang, N.; Cheng, H.; Wang, Y.; Liu, X.; Qiao, B.; Zhao, L. Mapping conservation priorities for wild yak (Bos mutus) habitats on the Tibetan Plateau, China. Sci Total Environ. 2024, 914, 169803. [Google Scholar] [CrossRef]
- Mo, L.; Ma, J.; Xiong, Y.; Xiong, X.; Lan, D.; Li, J.; Yin, S. Factors Influencing the Maturation and Developmental Competence of Yak (Bos grunniens) Oocytes In Vitro. Genes 2023, 14, 1882. [Google Scholar] [CrossRef] [PubMed]
- Xiong, X.; Yang, M.; Yu, H.; Hu, Y.; Yang, L.; Zhu, Y.; Fei, X.; Pan, B.; Xiong, Y.; Fu, W.; et al. MicroRNA-342-3p regulates yak oocyte meiotic maturation by targeting DNA methyltransferase 1. Reprod. Domest. Anim. 2022, 57, 761–770. [Google Scholar] [CrossRef] [PubMed]
- Sapkota, S.; Acharya, K.; Laven, R.; Acharya, N. Possible Consequences of Climate Change on Survival, Productivity and Reproductive Performance, and Welfare of Himalayan Yak (Bos grunniens). Vet. Sci. 2022, 9, 449. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wang, Z.; Zhou, P.; Fu, L.; Zhang, L.; Xu, C.; Loor, J.J.; Zhang, T.; Chen, Y.; Zhou, Z.; et al. Vitamin E supplementation improves post-transportation systemic antioxidant capacity in yak. PLoS ONE 2022, 17, e0278660. [Google Scholar] [CrossRef] [PubMed]
- Cajas, Y.N.; Canon-Beltran, K.; Ladron de Guevara, M.; Millan de la Blanca, M.G.; Ramos-Ibeas, P.; Gutierrez-Adan, A.; Rizos, D.; Gonzalez, E.M. Antioxidant Nobiletin Enhances Oocyte Maturation and Subsequent Embryo Development and Quality. Int. J. Mol. Sci. 2020, 21, 5340. [Google Scholar] [CrossRef] [PubMed]
- Razza, E.M.; Pedersen, H.S.; Stroebech, L.; Fontes, P.K.; Kadarmideen, H.N.; Callesen, H.; Pihl, M.; Nogueira, M.F.G.; Hyttel, P. Simulated physiological oocyte maturation has side effects on bovine oocytes and embryos. J. Assist. Reprod. Genet. 2019, 36, 413–424. [Google Scholar] [CrossRef] [PubMed]
- Straczynska, P.; Papis, K.; Morawiec, E.; Czerwinski, M.; Gajewski, Z.; Olejek, A.; Bednarska-Czerwinska, A. Signaling mechanisms and their regulation during in vivo or in vitro maturation of mammalian oocytes. Reprod. Biol. Endocrinol. 2022, 20, 37. [Google Scholar] [CrossRef] [PubMed]
- He, H.; Zhang, H.; Pan, Y.; Zhang, T.; Yang, S.; Liu, M.; Robert, N.; Wang, J.; Zhao, T.; Zhao, L.; et al. Low oxygen concentration improves yak oocyte maturation and inhibits apoptosis through HIF-1 and VEGF. Reprod. Domest. Anim. 2022, 57, 381–392. [Google Scholar] [CrossRef]
- Li, H.S.; Zhou, Y.N.; Li, L.; Li, S.F.; Long, D.; Chen, X.L.; Zhang, J.B.; Feng, L.; Li, Y.P. HIF-1alpha protects against oxidative stress by directly targeting mitochondria. Redox. Biol. 2019, 25, 101–109. [Google Scholar] [CrossRef]
- Wang, X.; Wei, L.; Li, Q.; Lai, Y. HIF-1alpha protects osteoblasts from ROS-induced apoptosis. Free Radic. Res. 2022, 56, 143–153. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Xing, C.; Deng, Y.; Ye, C.; Peng, H. HIF-1alpha signaling: Essential roles in tumorigenesis and implications in targeted therapies. Genes Dis. 2024, 11, 234–251. [Google Scholar] [CrossRef]
- Du, X.; Mi, X.; Liu, X.; Mawolo, J.B. Comparative study on the distribution and expression of Neuroglobin and Hypoxia-inducible factor-1alpha in the telencephalon of yak and cattle. Braz. J. Biol. 2021, 83, e248911. [Google Scholar]
- Li, C.; Liu, Z.; Li, W.; Zhang, L.; Zhou, J.; Sun, M.; Zhou, J.; Yao, W.; Zhang, X.; Wang, H.; et al. The FSH-HIF-1alpha-VEGF Pathway Is Critical for Ovulation and Oocyte Health but Not Necessary for Follicular Growth in Mice. Endocrinology 2020, 161, 4. [Google Scholar] [CrossRef]
- Hu, J.; Wu, J.; Liu, X.; Zhang, Y.; Mo, L.; Liu, L.; Liu, S.; Ou, C.; He, Y. Hypoxia enhances autophagy level of human sperms. Sci. Rep. 2024, 14, 8465. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.K.; Yadav, P.K.; Chaudhary, G.R.; Tiwari, M.; Gupta, A.; Sharma, A.; Pandey, A.N.; Pandey, A.K.; Chaube, S.K. Autophagy in hypoxic ovary. Cell. Mol. Life Sci. 2019, 76, 3311–3322. [Google Scholar] [CrossRef]
- Glick, D.; Barth, S.; Macleod, K.F. Autophagy: Cellular and molecular mechanisms. J. Pathol. 2010, 221, 3–12. [Google Scholar] [CrossRef]
- Kim, K.H.; Lee, M.S. Autophagy—A key player in cellular and body metabolism. Nat. Rev. Endocrinol. 2014, 10, 322–337. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Liu, X.; Ma, S. The Roles of Mitochondria in Autophagic Cell Death. Cancer Biother. Radiopharm. 2016, 31, 269–276. [Google Scholar] [CrossRef]
- Maroni, P.; Matteucci, E.; Bendinelli, P.; Desiderio, M.A. Functions and Epigenetic Regulation of Wwox in Bone Metastasis from Breast Carcinoma: Comparison with Primary Tumors. Int. J. Mol. Sci. 2017, 18, 75. [Google Scholar] [CrossRef]
- Tang, Z.; Zhang, Z.; Tang, Y.; Qi, L.; Yang, F.; Wang, Z. Effects of dimethyl carbonate-induced autophagic activation on follicular development in the mouse ovary. Exp. Ther. Med. 2017, 14, 5981–5989. [Google Scholar] [CrossRef] [PubMed]
- Xiong, S.; Jing, J.; Wu, J.; Ma, W.; Dawar, F.U.; Mei, J.; Gui, J.F. Characterization and sexual dimorphic expression of Cytochrome P450 genes in the hypothalamic-pituitary-gonad axis of yellow catfish. Gen. Comp. Endocrinol. 2015, 216, 90–97. [Google Scholar] [CrossRef]
- Heidarzadehpilehrood, R.; Pirhoushiaran, M.; Abdollahzadeh, R.; Binti Osman, M.; Sakinah, M.; Nordin, N.; Abdul Hamid, H. A Review on CYP11A1; CYP17A1; and CYP19A1 Polymorphism Studies: Candidate Susceptibility Genes for Polycystic Ovary Syndrome (PCOS) and Infertility. Genes 2022, 13, 302. [Google Scholar] [CrossRef] [PubMed]
- Kaur, R.; Kaur, T.; Kaur, A. Genetic association study from North India to analyze association of CYP19A1 and CYP17A1 with polycystic ovary syndrome. J. Assist. Reprod. Genet. 2018, 35, 1123–1129. [Google Scholar] [CrossRef] [PubMed]
- Olson, S.H.; Bandera, E.V.; Orlow, I. Variants in estrogen biosynthesis genes; sex steroid hormone levels; and endometrial cancer: A HuGE review. Am. J. Epidemiol. 2007, 165, 235–245. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Li, J.; Wang, Y.; Qu, J.; Bi, F.; Xiang, H.; Zhao, X.; Sun, M.; Huan, Y. Astaxanthin protects oocyte maturation against cypermethrin-induced defects in pigs. Theriogenology 2023, 209, 31–39. [Google Scholar] [CrossRef]
- Wan, J.J.; Yi, J.; Wang, F.Y.; Zhang, C.; Dai, A.G. Expression and regulation of HIF-1a in hypoxic pulmonary hypertension: Focus on pathological mechanism and Pharmacological Treatment. Int. J. Med. Sci. 2024, 21, 45–60. [Google Scholar] [CrossRef] [PubMed]
- Shi, S.; Zhou, X.; Li, J.; Zhang, L.; Hu, Y.; Li, Y.; Yang, G.; Chu, G. MiR-214-3p promotes proliferation and inhibits estradiol synthesis in porcine granulosa cells. J. Anim. Sci. Biotechnol. 2020, 11, 94. [Google Scholar] [CrossRef] [PubMed]
- Kanke, T.; Fujii, W.; Naito, K.; Sugiura, K. Effect of fibroblast growth factor signaling on cumulus expansion in mice in vitro. Mol. Reprod. Dev. 2022, 89, 281–289. [Google Scholar] [CrossRef]
- Heldin, P.; Basu, K.; Kozlova, I.; Porsch, H. HAS2 and CD44 in breast tumorigenesis. Adv. Cancer Res. 2014, 123, 211–229. [Google Scholar]
- Anamthathmakula, P.; Winuthayanon, W. Prostaglandin-Endoperoxide Synthase 2 (PTGS2) in the Oviduct: Roles in Fertilization and Early Embryo Development. Endocrinology 2021, 162, bqab025. [Google Scholar] [CrossRef] [PubMed]
- Evrard, C.; Faway, E.; De Vuyst, E.; Svensek, O.; De Glas, V.; Bergerat, D.; Salmon, M.; De Backer, O.; Flamion, B.; Le-Buanec, H.; et al. Deletion of TNFAIP6 Gene in Human Keratinocytes Demonstrates a Role for TSG-6 to Retain Hyaluronan Inside Epidermis. JID Innov. 2021, 1, 100054. [Google Scholar] [CrossRef] [PubMed]
- Moorey, S.E.; Hessock, E.A.; Edwards, J.L. Preovulatory follicle contributions to oocyte competence in cattle: Importance of the ever-evolving intrafollicular environment leading up to the luteinizing hormone surge. J. Anim. Sci. 2022, 100, skac153. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Wang, Y.; Guo, Y.H.; Wang, L.; Yang, Z.; Zhai, Z.H.; Tang, L. HIF-1alpha Alleviates High-Glucose-Induced Renal Tubular Cell Injury by Promoting Parkin/PINK1-Mediated Mitophagy. Front. Med. 2021, 8, 803874. [Google Scholar]
- Lei, L.; Feng, J.; Wu, G.; Wei, Z.; Wang, J.Z.; Zhang, B.; Liu, R.; Liu, F.; Wang, X.; Li, H.L. HIF-1alpha Causes LCMT1/PP2A Deficiency and Mediates Tau Hyperphosphorylation and Cognitive Dysfunction during Chronic Hypoxia. Int. J. Mol. Sci. 2022, 23, 16140. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Lian, G. ROS and diseases: Role in metabolism and energy supply. Mol. Cell. Biochem. 2020, 467, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Janbandhu, V.; Tallapragada, V.; Patrick, R.; Li, Y.; Abeygunawardena, D.; Humphreys, D.T.; Martin, E.M.M.A.; Ward, A.O.; Contreras, O.; Farbehi, N.; et al. Hif-1a suppresses ROS-induced proliferation of cardiac fibroblasts following myocardial infarction. Cell Stem Cell 2022, 29, 281–297. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Xi, Q.; Wang, D.; Li, J.; Wang, M.; Li, D.; Zhu, L.; Jin, L. Mitochondrial dysfunction and endoplasmic reticulum stress involved in oocyte aging: An analysis using single-cell RNA-sequencing of mouse oocytes. J. Ovarian Res. 2019, 12, 53. [Google Scholar] [CrossRef]
- Kirillova, A.; Smitz, J.E.J.; Sukhikh, G.T.; Mazunin, I. The Role of Mitochondria in Oocyte Maturation. Cells 2021, 10, 2484. [Google Scholar] [CrossRef]
- Nikalayevich, E.; Terret, M.E. Meiosis: Actin and microtubule networks drive chromosome clustering in oocytes. Curr. Biol. 2023, 33, 272–274. [Google Scholar] [CrossRef]
- He, H.; Wang, J.; Mou, X.; Liu, X.; Li, Q.; Zhong, M.; Luo, B.; Yu, Z.; Zhang, J.; Xu, T.; et al. Selective autophagic degradation of ACLY (ATP citrate lyase) maintains citrate homeostasis and promotes oocyte maturation. Autophagy 2023, 19, 163–179. [Google Scholar] [CrossRef] [PubMed]
- Kohata-Ono, C.; Wakai, T.; Funahashi, H. The autophagic inducer and inhibitor display different activities on the meiotic and developmental competencies of porcine oocytes derived from small and medium follicles. J. Reprod. Dev. 2019, 65, 527–532. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, D.; Hu, H.; Zhang, P.; Xie, R.; Cui, W. HIF-1α/BNIP3 signaling pathway-induced-autophagy plays protective role during myocardial ischemia-reperfusion injury. Biomed. Pharmacother. 2019, 120, 109464. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Hou, L.; Zhang, C. FOXG1 is involved in mouse ovarian functions and embryogenesis. J. Steroid Biochem. Mol. Biol. 2023, 233, 106372. [Google Scholar] [CrossRef] [PubMed]
- Ul Haq Shah, M.Z.; Shrivastava, V.K.; Mir, M.A.; Olaniyi, K.S. Role of diacerein on steroidogenesis and folliculogenesis related genes in ovary of letrozole-induced PCOS mice. Chem. Biol. Interact. 2023, 377, 110468. [Google Scholar] [CrossRef] [PubMed]
- Katwal, G.; Baral, D.; Fan, X.; Weiyang, H.; Zhang, X.; Ling, L.; Xiong, Y.; Ye, Q.; Wang, Y. SIRT3 a Major Player in Attenuation of Hepatic Ischemia-Reperfusion Injury by Reducing ROS via Its Downstream Mediators: SOD2; CYP-D; and HIF-1alpha. Oxid. Med. Cell. Longev. 2018, 2018, 2976957. [Google Scholar] [CrossRef] [PubMed]
- Baddela, V.S.; Sharma, A.; Michaelis, M.; Vanselow, J. HIF1 driven transcriptional activity regulates steroidogenesis and proliferation of bovine granulosa cells. Sci. Rep. 2020, 10, 3906. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Pan, Y.; Wang, M.; Xu, R.; Han, X.; Ma, R.; Zhao, L.; Zhang, T.; Wang, Y.; Zhao, T.; et al. Follicular fluid exosomes regulate OVGP1 secretion in yak oviduct epithelial cells via autophagy in vitro. J. Cell Physiol. 2023, 238, 1020–1035. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Wang, J.; Wang, M.; Gao, L.; Zhang, R.; Zhao, L.; Liu, B.; Han, X.; Baloch, A.R.; Cui, Y.; et al. Exosomes Derived from Yak Follicular Fluid Increase 2-Hydroxyestradiol Secretion by Activating Autophagy in Cumulus Cells. Animals 2022, 12, 3174. [Google Scholar] [CrossRef]
- He, H.; Zhang, H.; Li, Q.; Fan, J.; Pan, Y.; Zhang, T.; Robert, N.; Zhao, L.; Hu, X.; Han, X.; et al. Low oxygen concentrations improve yak oocyte maturation and enhance the developmental competence of preimplantation embryos. Theriogenology 2020, 156, 46–58. [Google Scholar] [CrossRef]
- Liao, B.; Qi, X.; Yun, C.; Qiao, J.; Pang, Y. Effects of Androgen Excess-Related Metabolic Disturbances on Granulosa Cell Function and Follicular Development. Front. Endocrinol. 2022, 13, 815968. [Google Scholar] [CrossRef] [PubMed]
- Faizal, A.M.; Elias, M.H.; Jin, N.M.; Abu, M.A.; Syafruddin, S.E.; Zainuddin, A.A.; Suzuki, N.; Karim, A.K.A. Unravelling the role of HAS2; GREM1; and PTGS2 gene expression in cumulus cells: Implications for human oocyte development competency—A systematic review and integrated bioinformatic analysis. Front. Endocrinol. 2024, 15, 1274376. [Google Scholar] [CrossRef] [PubMed]
- Santos, J.D.; Batista, R.I.; Magalhaes, L.C.; Paula, A.R., Jr.; Souza, S.S.; Salamone, D.F.; Bhat, M.H.; Teixeira, D.I.; Freitas, V.J.; Melo, L.M. Overexpression of hyaluronan synthase 2 and gonadotropin receptors in cumulus cells of goats subjected to one-shot eCG/FSH hormonal treatment for ovarian stimulation. Anim. Reprod. Sci. 2016, 170, 15–24. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Wang, L.; Liu, B.; Xie, W.; Chen, Y.G. Activin/Smad2 and Wnt/beta-catenin up-regulate HAS2 and ALDH3A2 to facilitate mesendoderm differentiation of human embryonic stem cells. J. Biol. Chem. 2018, 293, 18444–18453. [Google Scholar] [CrossRef] [PubMed]
- Kierans, S.J.; Taylor, C.T. Regulation of glycolysis by the hypoxia-inducible factor (HIF): Implications for cellular physiology. J. Physiol. 2021, 599, 23–37. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wu, X. The effects of mitochondrial dysfunction on energy metabolism switch by HIF-1alpha signalling in granulosa cells of polycystic ovary syndrome. Endokrynol. Pol. 2020, 71, 134–145. [Google Scholar] [CrossRef]
- Lan, D.; Xiong, X.; Huang, C.; Mipam, T.D.; Li, J. Toward Understanding the Genetic Basis of Yak Ovary Reproduction: A Characterization and Comparative Analyses of Estrus Ovary Transcriptiome in Yak and Cattle. PLoS ONE 2016, 11, e0152675. [Google Scholar] [CrossRef]
Gene | Primer Sequences 5′–3′ | Tm/°C | Accession Number |
---|---|---|---|
HIF-1α | F: TGAAGGCACAGATGAATTGCTT R: GTTCAAACTGAGTTAATCCCATGT | 56 | KU353607.1 |
Atg5 | F: AGTTGCTCCTGAAGATGGGG R: TCTGTTGGTTGCGGGATGAT | 59 | NM_001034579.2 |
Beclin-1 | F: GAAACCAGGAGAGACCCAGG R: GTGGACATCATCCTGGCTGG | 58 | NM_001033627.2 |
LC3 | F: CCGACTTATCCGAGAGCAGC R: TGAGCTGTAAGCGCCTTCTT | 56 | NM_001001169.1 |
CYP11A1 | F: CCTCTACTGCCTCCTGAA R: ATCTCGTACAAGTGCCATT | 57 | NM_176644.2 |
CYP17A1 | F: GCCCAAGACCAAGCACTC R: GGAACCCAAACGAAAGGA | 60 | NM_174304.2 |
CYP19A1 | F: GATTTCGCCACTGAGTTGATT R: TCTGGATTTCCCTTATTATTGC | 56 | NM_174305.1 |
HAS2 | F: ACTCATTCCCGTATCCGTTTG R: TTCTTCCGCCTGCCACATT | 56 | NM_174079.3 |
PTGS2 | F: TTCTCGTGAAGCCCTATGA R: GAGGCAGTGTTGATGATTTT | 58 | NM_174445.2 |
PTX3 | F: GCTATCGGTCCATAATGCTTGT R: CTTTCTTTGAATCCCAGGTGC | 57 | NM_001076259.2 |
TNFAIP6 | F: CAAAGGAGTGTGGTGGTGTGTT R: TTCAACATAGTCAGCCAAGCAA | 56 | NM_001007813.2 |
β-Actin | F: GCGGCATTCACGAAACTA R: TGATCTTCATTGTGCTGGGT | 56 | DQ838049.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, X.; Wang, M.; Wang, J.; Han, X.; Yang, X.; Zhang, H.; Zhong, D.; Qiu, S.; Yu, S.; Wang, L.; et al. Hypoxia-Inducible Factor 1α Affects Yak Oocyte Maturation and Early Embryonic Development by Regulating Autophagy. Antioxidants 2024, 13, 840. https://doi.org/10.3390/antiox13070840
Ma X, Wang M, Wang J, Han X, Yang X, Zhang H, Zhong D, Qiu S, Yu S, Wang L, et al. Hypoxia-Inducible Factor 1α Affects Yak Oocyte Maturation and Early Embryonic Development by Regulating Autophagy. Antioxidants. 2024; 13(7):840. https://doi.org/10.3390/antiox13070840
Chicago/Turabian StyleMa, Xin, Meng Wang, Jinglei Wang, Xiaohong Han, Xiaoqing Yang, Hui Zhang, Donglan Zhong, Shantong Qiu, Sijiu Yu, Libin Wang, and et al. 2024. "Hypoxia-Inducible Factor 1α Affects Yak Oocyte Maturation and Early Embryonic Development by Regulating Autophagy" Antioxidants 13, no. 7: 840. https://doi.org/10.3390/antiox13070840
APA StyleMa, X., Wang, M., Wang, J., Han, X., Yang, X., Zhang, H., Zhong, D., Qiu, S., Yu, S., Wang, L., & Pan, Y. (2024). Hypoxia-Inducible Factor 1α Affects Yak Oocyte Maturation and Early Embryonic Development by Regulating Autophagy. Antioxidants, 13(7), 840. https://doi.org/10.3390/antiox13070840