Phosphatidylserine Counteracts the High Stocking Density-Induced Stress Response, Redox Imbalance and Immunosuppression in Fish Megalobrama ambylsephala
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Fish and Feeding Trial
2.2. Sample Collection
2.3. Analytical Procedures
2.3.1. Growth Performance and Feed Utilization Formula
2.3.2. Proximate Composition Analysis
2.3.3. Plasma Indicator Analysis
2.3.4. Hepatic Antioxidant Analysis
2.3.5. Real-Time Quantitative PCR
2.3.6. Western Blotting Assay
2.4. Statistical Analysis
3. Results
3.1. Growth Performance and Feed Utilization
3.2. Stress Response Indicators
3.3. Hepatic Injury and Non-Specific Immunity Indicators
3.4. Hepatic Antioxidant Indices
3.5. Expression Levels of Hepatic Antioxidant-Related Genes
3.6. Expression Levels of Hepatic Antioxidant-Related Proteins
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, Y.W.; Zhu, J.; Ge, X.p.; Sun, S.M.; Su, Y.L.; Li, B.; Hou, Y.R.; Ren, M.C. Effects of stocking density on the growth performance, digestive enzyme activities, antioxidant resistance, and intestinal microflora of blunt snout bream (Megalobrama amblycephala) juveniles. Aquac. Res. 2018, 50, 236–246. [Google Scholar] [CrossRef]
- Hu, Y.; Yang, T.; Liu, Y.; Li, F.; Xu, C.; Fang, F.; Feng, J. High Fish Stocking Density Weakens the Effects of Rice-Fish Co-culture on Water Eutrophication and Greenhouse Gas Emissions. Water Air Soil Pollut. 2022, 233, 222. [Google Scholar] [CrossRef]
- Yadata, G.W.; Ji, K.; Liang, H.; Ren, M.; Ge, X.; Yang, Q. Effects of dietary protein levels with various stocking density on growth performance, whole body composition, plasma parameters, nitrogen emission and gene expression related to TOR signaling of juvenile blunt snout bream (Megalobrama ambylcephala). Aquaculture 2020, 519, 734730. [Google Scholar] [CrossRef]
- Yu, H.; Yang, Q.; Liang, H.; Ren, M.; Ge, X.; Ji, K. Effects of stocking density and dietary phosphorus levels on the growth performance, antioxidant capacity, and nitrogen and phosphorus emissions of juvenile blunt snout bream (Megalobrama amblycephala). Aquac. Nutr. 2020, 27, 581–591. [Google Scholar] [CrossRef]
- Qi, C.; Xie, C.; Tang, R.; Qin, X.; Wang, D.; Li, D. Effect of Stocking Density on Growth, Physiological Responses, and Body Composition of Juvenile Blunt Snout Bream, Megalobrama amblycephala. J. World Aquac. Soc. 2016, 47, 358–368. [Google Scholar] [CrossRef]
- Lund, I.; Steenfeldt, S.J.; Herrmann, B.; Pedersen, P.B. Feed intake as explanation for density related growth differences of common sole Solea solea. Aquac. Res. 2013, 44, 367–377. [Google Scholar] [CrossRef]
- Schmitt, H. Phosphatidylserine A natural brain nutrient. Agro Food Ind. Hi-Tech 2009, 20, 16–18. [Google Scholar]
- Leventis, P.A.; Grinstein, S. The Distribution and Function of Phosphatidylserine in Cellular Membranes. Annu. Rev. Biophys. 2010, 39, 407–427. [Google Scholar] [CrossRef] [PubMed]
- Kidd, P.M. Attention deficit/hyperactivity disorder (ADHD) in children: Rationale for its integrative management. Altern. Med. Rev. 2000, 5, 402–428. [Google Scholar]
- Hellhammer, J.; Fries, E.; Buss, C.; Engert, V.; Tuch, A.; Rutenberg, D.; Hellhammer, D. Effects of soy lecithin phosphatidic acid and phosphatidylserine complex (PAS) on the endocrine and psychological responses to mental stress. Stress 2004, 7, 119–126. [Google Scholar] [CrossRef]
- Toita, R.; Fujita, S.; Kang, J.-H. Macrophage Uptake Behavior and Anti-inflammatory Response of Bovine Brain- or Soybean-derived Phosphatidylserine Liposomes. J. Oleo Sci. 2018, 67, 1131–1135. [Google Scholar] [CrossRef] [PubMed]
- Coates, C.J.; Kelly, S.M.; Nairn, J. Possible role of phosphatidylserine–hemocyanin interaction in the innate immune response of Limulus polyphemus. Dev. Comp. Immunol. 2011, 35, 155–163. [Google Scholar] [CrossRef] [PubMed]
- Ji, K.; Liang, H.; Chisomo-Kasiya, H.; Mokrani, A.; Ge, X.; Ren, M.; Liu, B. Effects of dietary tryptophan levels on growth performance, whole body composition and gene expression levels related to glycometabolism for juvenile blunt snout bream, Megalobrama amblycephala. Aquac. Nutr. 2018, 24, 1474–1483. [Google Scholar] [CrossRef]
- China Fishery Statistical Yearbook; Chinese Agricultural Press: Beijing, China, 2023.
- National Health Commission of the People’s Republic of China. 1 November 2010. Available online: www.nhc.gov.cn/sps/s7891/201010/3b5fec5548404e0b965ca9605854d0ba.shtml (accessed on 15 April 2022).
- He, C.F.; Li, X.F.; Jiang, G.Z.; Zhang, L.; Sun, M.; Ge, Y.P.; Chen, W.L.; Liu, W.B. Feed types affect the growth, nutrient utilization, digestive capabilities, and endocrine functions of Megalobrama amblycephala: A comparative study between pelleted and extruded feed. Fish Physiol. Biochem. 2022, 48, 1025–1038. [Google Scholar] [CrossRef] [PubMed]
- He, C.F.; Liu, W.B.; Shi, H.J.; Zhang, L.; Zhang, L.; Li, X.F. Utilization of pelleted and extruded feed by blunt snout bream Megalobrama amblycephala: Insights from growth performance, health status and feed cost. J. Anim. Physiol. Anim. Nutr. 2021, 105, 1203–1213. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analysis; AOAC International: Rockville, MD, USA, 2006; Available online: https://www.aoac.org (accessed on 20 December 2022).
- Winberg, S.; Lepage, O. Elevation of brain 5-HT activity, POMC expression, and plasma cortisol in socially subordinate rainbow trout. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1998, 274, R645–R654. [Google Scholar] [CrossRef] [PubMed]
- Asadi, F.; Hallajian, A.; Asadian, P.; Shahriari, A.; Pourkabir, M. Serum lipid, free fatty acid, and proteins in juvenile sturgeons: Acipenser persicus and Acipenser stellatus. Comp. Clin. Pathol. 2009, 18, 287–289. [Google Scholar] [CrossRef]
- Shuang, L.; Chen, S.-L.; Ren, C.; Su, X.-L.; Xu, X.-N.; Zheng, G.-D.; Zou, S.-M. Effects of hypoxia and reoxygenation on oxidative stress, histological structure, and apoptosis in a new hypoxia-tolerant variety of blunt snout bream (Megalobrama amblycephala). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2023, 278, 111358. [Google Scholar] [CrossRef] [PubMed]
- Li, X.-F.; Xu, C.; Tian, H.-Y.; Jiang, G.-Z.; Zhang, D.-D.; Liu, W.-B. Feeding rates affect stress and non-specific immune responses of juvenile blunt snout bream Megalobrama amblycephala subjected to hypoxia. Fish Shellfish Immunol. 2016, 49, 298–305. [Google Scholar] [CrossRef]
- Zwirner, J.; Dobos, G.; Götze, O. A novel ELISA for the assessment of classical pathway of complement activation in vivo by measurement of C4-C3 complexes. J. Immunol. Methods 1995, 186, 55–63. [Google Scholar] [CrossRef]
- Yuan, X.-Y.; Liu, W.-B.; Wang, C.-C.; Huang, Y.-Y.; Dai, Y.-J.; Cheng, H.-H.; Jiang, G.-Z. Evaluation of antioxidant capacity and immunomodulatory effects of cottonseed meal protein hydrolysate and its derivative peptides for hepatocytes of blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2020, 98, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.-N.; Li, X.-F.; Jiang, G.-Z.; Zhang, D.-D.; Tian, H.-Y.; Li, J.-Y.; Liu, W.-B. Effects of dietary fructooligosaccharide levels and feeding modes on growth, immune responses, antioxidant capability and disease resistance of blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2014, 41, 560–569. [Google Scholar] [CrossRef] [PubMed]
- LYGREN, B.; WAAGBØ, R. Nutritional impacts on the chemiluminescent response of Atlantic salmon (Salmo salar L.) head kidney phagocytes, in vitro. Fish Shellfish Immunol. 1999, 9, 445–456. [Google Scholar] [CrossRef]
- Satoh, K. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta Int. J. Clin. Chem. 1978, 90, 37–43. [Google Scholar] [CrossRef]
- Zhang, L.; Zheng, X.-C.; Huang, Y.-Y.; Ge, Y.-P.; Sun, M.; Chen, W.-L.; Liu, W.-B.; Li, X.-F. Carbonyl cyanide 3-chlorophenylhydrazone induced the imbalance of mitochondrial homeostasis in the liver of Megalobrama amblycephala: A dynamic study. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2021, 244, 109003. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Liu, B.; Ge, X.; Li, Z.; Yang, X.; Zhou, Z.; Zhao, F. Emodin attenuates CY-induced oxidative injury in PBLs of the blunt snout bream (Megalobrama amblycephala) though the Nrf2-Keap1 signaling pathway. Aquaculture 2021, 545, 737201. [Google Scholar] [CrossRef]
- Mokrani, A.; Ren, M.; Liang, H.; Yang, Q.; Ji, K.; Kasiya, H.C.; Ge, X. Effect of the total replacement of fishmeal with plant proteins and supplemental essential amino acids in the extruded diet on antioxidants genes, enzyme activities, and immune response in juvenile blunt snout bream. Aquac. Int. 2020, 28, 555–568. [Google Scholar] [CrossRef]
- Liu, Z.-S.; Zhang, L.; Chen, W.-L.; He, C.-F.; Qian, X.-Y.; Liu, W.-B.; Li, X.-F. Insights into the interaction between stocking density and feeding rate in fish Megalobrama ambylcephala based on growth performance, innate immunity, antioxidant activity, and the GH-IGF1 axis. Aquaculture 2024, 580, 740355. [Google Scholar] [CrossRef]
- Barton, B.A. Stress in fishes: A diversity of responses with particular reference to changes in circulating corticosteroids. Integr. Comp. Biol. 2002, 42, 517–525. [Google Scholar] [CrossRef]
- Martínez-Porchas, M.; Martínez-Córdova, L.R.; Ramos-Enriquez, R. Cortisol and glucose: Reliable indicators of fish stress? Pan-Am. J. Aquat. Sci. 2009, 4, 158–178. [Google Scholar]
- Grutter, A.; Pankhurst, N. The effects of capture, handling, confinement and ectoparasite load on plasma levels of cortisol, glucose and lactate in the coral reef fish Hemigymnus melapterus. J. Fish Biol. 2000, 57, 391–401. [Google Scholar] [CrossRef]
- Conde-Sieira, M.; Chivite, M.; Míguez, J.M.; Soengas, J.L. Stress effects on the mechanisms regulating appetite in teleost fish. Front. Endocrinol. 2018, 9, 416277. [Google Scholar] [CrossRef]
- Pawlak, P.; Burren, A.; Seitz, A.; Pietsch, C. Effects of different acute stressors on the regulation of appetite genes in the carp (Cyprinus carpio L.) brain. R. Soc. Open Sci. 2023, 10, 230040. [Google Scholar] [CrossRef]
- Ma, X.; Li, X.; Wang, W.; Zhang, M.; Yang, B.; Miao, Z. Phosphatidylserine, inflammation, and central nervous system diseases. Front. Aging Neurosci. 2022, 14, 975176. [Google Scholar] [CrossRef]
- Calzada, E.; Onguka, O.; Claypool, S.M. Phosphatidylethanolamine metabolism in health and disease. Int. Rev. Cell Mol. Biol. 2016, 321, 29–88. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.Z.; Yang, H.L.; Ma, R.L.; Song, K.; Li, J.S. Effect of Lactococcus lactis and Enterococcus faecium on growth performance, digestive enzymes and immune response of grouper Epinephelus coioides. Aquac. Nutr. 2012, 18, 281–289. [Google Scholar] [CrossRef]
- Wang, B.; Wang, Y.; Jia, T.; Feng, J.; Qu, C.; Wu, X.; Yang, X.; Zhang, Q. Changes in physiological responses and immunity of blunt snout bream Megalobrama amblycephala from transport stress. Fish Physiol. Biochem. 2022, 48, 1183–1192. [Google Scholar] [CrossRef]
- Xia, S.L.; Li, X.F.; Abasubong, K.P.; Xu, C.; Shi, H.J.; Liu, W.B.; Zhang, D.D. Effects of dietary glucose and starch levels on the growth, apparent digestibility, and skin-associated mucosal non-specific immune parameters in juvenile blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2018, 79, 193–201. [Google Scholar] [CrossRef]
- Li, X.-F.; Liu, W.-B.; Lu, K.-L.; Xu, W.-N.; Wang, Y. Dietary carbohydrate/lipid ratios affect stress, oxidative status and non-specific immune responses of fingerling blunt snout bream, Megalobrama amblycephala. Fish Shellfish Immunol. 2012, 33, 316–323. [Google Scholar] [CrossRef]
- Chaung, H.-C.; Chang, C.-D.; Chen, P.-H.; Chang, C.-J.; Liu, S.-H.; Chen, C.-C. Docosahexaenoic acid and phosphatidylserine improves the antioxidant activities in vitro and in vivo and cognitive functions of the developing brain. Food Chem. 2013, 138, 342–347. [Google Scholar] [CrossRef]
- Fusi, J.; Bianchi, S.; Daniele, S.; Pellegrini, S.; Martini, C.; Galetta, F.; Giovannini, L.; Franzoni, F. An in vitro comparative study of the antioxidant activity and SIRT1 modulation of natural compounds. Biomed. Pharmacother. 2018, 101, 805–819. [Google Scholar] [CrossRef]
- Chung, J.-Y.; Chen, H.; Zirkin, B. Sirt1 and Nrf2: Regulation of Leydig cell oxidant/antioxidant intracellular environment and steroid formation†. Biol. Reprod. 2021, 105, 1307–1316. [Google Scholar] [CrossRef]
- Li, W.; Kong, A.N. Molecular mechanisms of Nrf2-mediated antioxidant response. Mol. Carcinog. 2009, 48, 91–104. [Google Scholar] [CrossRef]
- Chew, L.Y.; Zhang, H.; He, J.; Yu, F. The Nrf2-Keap1 pathway is activated by steroid hormone signaling to govern neuronal remodeling. Cell Rep. 2021, 36, 109466. [Google Scholar] [CrossRef]
Ingredients (%) | Diets (Phosphatidylserine Level, mg/kg) | |
---|---|---|
0 | 50 | |
Fish meal | 5.00 | 5.00 |
Soybean meal | 18.00 | 18.00 |
Rapeseed meal | 20.00 | 20.00 |
Cottonseed meal | 15.00 | 15.00 |
Fish oil | 2.16 | 2.16 |
Soybean oil | 2.16 | 2.16 |
Wheat flour | 24.00 | 24.00 |
Wheat bran | 4.50 | 4.50 |
Cellulose | 5.99 | 5.99 |
Ca(H2PO4)2 | 1.80 | 1.80 |
Salt | 0.40 | 0.40 |
Phosphatidylserine 1 | 0.00 | 50.00 |
Premix 2 | 1.00 | 1.00 |
Proximate composition (%) | ||
Moisture | 8.98 | 8.87 |
Crude protein | 30.49 | 30.51 |
Crude lipid | 5.94 | 5.99 |
Ash | 6.62 | 6.58 |
Gross energy (MJ/kg) | 18.32 | 18.34 |
Gene Name | Forward and Reverse Primers (5′-3′) | Accession Number or Reference |
---|---|---|
sirt1 | CAAACGACTCGGAGCCTCAC | MT518159.1 |
GGTCTCGTCTTCCGAACTGG | ||
nrf2 | CTTTGATGGATGCCTTCGGC | [31] |
TCTGGGTAACGGGTGAATGC | ||
keap1 | TGAGGAGATCGGCTGCACTG | [31] |
TGGCAATGGGACAAGCTGAA | ||
mnsod | TGTTGGAGGCCATTAAGCGT | KF195932.1 |
AAAGGGTCTTGGTTAGCGCA | ||
cuznsod | CACGCTCAACTTTGGCACAT | KF479046.1 |
TGTCAACAGGGAGACCATGC | ||
cat | CCGGGGGATATCAGTTGGGT | KF378714.1 |
TCCAAACCACTGAACTCGGG | ||
gpx | GAACGCCCACCCTCTGTTTG | [32] |
CGATGTCATTCCGGTTCACG | ||
ef1a | CTTCTCAGGCTGACTGTGC | X77689.1 |
CCGCTAGCATTACCCTCC |
IW (g) | FW (g) | SR (%) | WGR (%) | SGR (%/d) | FI (g) | FCR | PER | NRE (%) | ERE (%) | HSI (%) | CF | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
ND | 19.73 ± 0.64 | 82.39 ± 3.04 | 96.67 ± 3.33 | 317.49 ± 7.41 | 1.70 ± 0.02 | 114.81 ± 7.52 | 1.84 ± 0.16 | 1.81 ± 0.15 | 38.33 ± 4.09 | 20.26 ± 2.67 | 1.23 ± 0.04 | 1.96 ± 0.03 |
NDPS | 19.67 ± 0.41 | 94.44 ± 2.86 | 90.00 ± 5.77 | 380.01 ± 4.68 | 1.87 ± 0.01 | 128.06 ± 5.10 | 1.71 ± 0.13 | 1.92 ± 0.01 | 44.21 ± 2.53 | 22.07 ± 2.33 | 1.22 ± 0.02 | 2.09 ± 0.05 |
HD | 19.60 ± 0.00 | 69.19 ± 1.65 | 91.67 ± 3.33 | 253.01 ± 8.42 | 1.50 ± 0.03 | 92.38 ± 1.25 | 1.87 ± 0.04 | 1.76 ± 0.04 | 32.73 ± 1.34 | 19.10 ± 1.82 | 1.26 ± 0.05 | 1.96 ± 0.06 |
HDPS | 19.93 ± 0.26 | 70.27 ± 4.79 | 91.67 ± 6.01 | 253.23 ± 28.54 | 1.49 ± 0.09 | 97.91 ± 7.67 | 1.96 ± 0.11 | 1.68 ± 0.09 | 32.60 ± 3.24 | 16.48 ± 1.50 | 1.26 ± 0.04 | 1.97 ± 0.03 |
Two-way ANOVA | ||||||||||||
SD | ns | *** | ns | *** | *** | ** | ns | ns | * | ns | ns | ns |
PS | ns | ns | ns | ns | ns | ns | ns | ns | ns | ns | ns | ns |
Interaction | ns | ns | ns | ns | ns | ns | ns | ns | ns | ns | ns | ns |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, Y.; Liu, Z.; Zhang, L.; Liu, W.; Li, H.; Li, X. Phosphatidylserine Counteracts the High Stocking Density-Induced Stress Response, Redox Imbalance and Immunosuppression in Fish Megalobrama ambylsephala. Antioxidants 2024, 13, 644. https://doi.org/10.3390/antiox13060644
Jiang Y, Liu Z, Zhang L, Liu W, Li H, Li X. Phosphatidylserine Counteracts the High Stocking Density-Induced Stress Response, Redox Imbalance and Immunosuppression in Fish Megalobrama ambylsephala. Antioxidants. 2024; 13(6):644. https://doi.org/10.3390/antiox13060644
Chicago/Turabian StyleJiang, Yangyang, Zishang Liu, Ling Zhang, Wenbin Liu, Haiyang Li, and Xiangfei Li. 2024. "Phosphatidylserine Counteracts the High Stocking Density-Induced Stress Response, Redox Imbalance and Immunosuppression in Fish Megalobrama ambylsephala" Antioxidants 13, no. 6: 644. https://doi.org/10.3390/antiox13060644
APA StyleJiang, Y., Liu, Z., Zhang, L., Liu, W., Li, H., & Li, X. (2024). Phosphatidylserine Counteracts the High Stocking Density-Induced Stress Response, Redox Imbalance and Immunosuppression in Fish Megalobrama ambylsephala. Antioxidants, 13(6), 644. https://doi.org/10.3390/antiox13060644