Protective Effect of Resveratrol on Kidney Disease and Hypertension Against Microplastics Exposure in Male Juvenile Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Protocol
2.2. Determination of Plasma SCFAs
2.3. Quantitative PCR
2.4. Gut Microbiota Metagenomics
2.5. Immunohistochemistry for 8OHdG Staining
2.6. Statistical Analysis
3. Results
3.1. Anthropometrics and Blood Pressure
3.2. Plasma SCFAs and SCFA Receptors
3.3. Gut Microbiota Composition
3.4. Oxidative Stress
3.5. RAS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lehner, R.; Weder, C.; Petri-Fink, A.; Rothen-Rutishauser, B. Emergence of Nanoplastic in the Environment and Possible Impact on Human Health. Environ. Sci. Technol. 2019, 53, 1748–1765. [Google Scholar] [CrossRef] [PubMed]
- Corcoran, P.L. Degradation of microplastics in the environment. In Handbook of Microplastics in the Environment; Rocha-Santos, T., Costa, M., Mouneyrac, C., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 1–12. [Google Scholar]
- Jha, V.; Garcia-Garcia, G.; Iseki, K.; Li, Z.; Naicker, S.; Plattner, B.; Saran, R.; Wang, A.Y.; Yang, C.W. Chronic kidney disease: Global dimension and perspectives. Lancet 2013, 382, 260–272. [Google Scholar] [CrossRef] [PubMed]
- Weir, M.R. Hypertension and the Kidney: Perspectives on the Relationship of Kidney Disease and Cardiovascular Disease. Clin. J. Am. Soc. Nephrol. 2009, 4, 2045–2050. [Google Scholar] [CrossRef] [PubMed]
- Luyckx, V.A.; Bertram, J.F.; Brenner, B.M.; Fall, C.; Hoy, W.E.; Ozanne, S.E.; Vikse, B.E. Effect of Fetal and Child Health on Kidney Development and Long-Term Risk of Hypertension and Kidney Disease. Lancet 2013, 382, 273–283. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.Y.; Sanders, A.P.; Saland, J.M.; Wright, R.O.; Arora, M. Environmental exposures and pediatric kidney function and disease: A systematic review. Environ. Res. 2017, 158, 625–648. [Google Scholar] [CrossRef]
- Massardo, S.; Verzola, D.; Alberti, S.; Caboni, C.; Santostefano, M.; Eugenio Verrina, E.; Angeletti, A.; Lugani, F.; Ghiggeri, G.M.; Bruschi, M.; et al. MicroRaman spectroscopy detects the presence of microplastics in human urine and kidney tissue. Environ. Int. 2024, 184, 108444. [Google Scholar] [CrossRef]
- Meng, X.; Zhang, J.; Wang, W.; Gonzalez-Gil, G.; Vrouwenvelder, J.S.; Li, Z. Effects of nano- and microplastics on kidney: Physicochemical properties, bioaccumulation, oxidative stress and immunoreaction. Chemosphere 2022, 288, 132631. [Google Scholar] [CrossRef]
- de Oliveira, R.B.; Pelepenko, L.E.; Masaro, D.A.; Lustosa, G.M.M.M.; de Oliveira, M.C.; Roza, N.A.V.; Marciano, M.A.; Dos Reis, L.M.; Kamel, S.; Louvet, L.; et al. Effects of microplastics on the kidneys: A narrative review. Kidney Int. 2024, 106, 400–407. [Google Scholar] [CrossRef]
- Frémont, L. Biological effects of resveratrol. Life Sci. 2000, 66, 663–673. [Google Scholar] [CrossRef]
- Hamza, S.M.; Dyck, J.R. Systemic and renal oxidative stress in the pathogenesis of hypertension: Modulation of long-term control of arterial blood pressure by resveratrol. Front. Physiol. 2014, 5, 292. [Google Scholar] [CrossRef]
- Xia, N.; Daiber, A.; Förstermann, U.; Li, H. Antioxidant effects of resveratrol in the cardiovascular system. Br. J. Pharmacol. 2017, 174, 1633–1646. [Google Scholar] [CrossRef] [PubMed]
- Bird, J.K.; Raederstorff, D.; Weber, P.; Steinert, R.E. Cardiovascular and Antiobesity Effects of Resveratrol Mediated through the Gut Microbiota. Adv. Nutr. 2017, 8, 839–849. [Google Scholar] [CrossRef]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Lin, I.C.; Yu, H.R.; Huang, L.T.; Hsu, C.N. Resveratrol prevents the combined maternal plus postweaning high-fat-diets-induced hypertension in male offspring. J. Nutr. Biochem. 2017, 48, 120–127. [Google Scholar] [CrossRef] [PubMed]
- Shiwakoti, S.; Ko, J.Y.; Gong, D.; Dhakal, B.; Lee, J.H.; Adhikari, R.; Gwak, Y.; Park, S.H.; Jun Choi, I.; Schini-Kerth, V.B.; et al. Effects of polystyrene nanoplastics on endothelium senescence and its underlying mechanism. Environ. Int. 2022, 164, 107248. [Google Scholar] [CrossRef]
- Zou, H.; Chen, Y.; Qu, H.; Sun, J.; Wang, T.; Ma, Y.; Yuan, Y.; Bian, J.; Liu, Z. Microplastics Exacerbate Cadmium-Induced Kidney Injury by Enhancing Oxidative Stress, Autophagy, Apoptosis, and Fibrosis. Int. J. Mol. Sci. 2022, 23, 14411. [Google Scholar] [CrossRef]
- Chen, H.E.; Lin, Y.J.; Lin, I.C.; Yu, H.R.; Sheen, J.M.; Tsai, C.C.; Huang, L.T.; Tain, Y.L. Resveratrol prevents combined prenatal NG-nitro-L-arginine-methyl ester (L-NAME) treatment plus postnatal high-fat diet induced programmed hypertension in adult rat offspring: Interplay between nutrient-sensing signals, oxidative stress and gut microbiota. J. Nutr. Biochem. 2019, 70, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef]
- Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Hsu, C.N. Resveratrol Butyrate Ester Supplementation Blunts the Development of Offspring Hypertension in a Maternal Di-2-ethylhexyl Phthalate Exposure Rat Model. Nutrients 2023, 15, 697. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
- Marrocco, I.; Altieri, F.; Peluso, I. Measurement and Clinical Significance of Biomarkers of Oxidative Stress in Humans. Oxid. Med. Cell Longev. 2017, 2017, 6501046. [Google Scholar] [CrossRef] [PubMed]
- Pluznick, J.L. Microbial short-chain fatty acids and blood pressure regulation. Curr. Hypertens. Rep. 2017, 19, 25. [Google Scholar] [CrossRef] [PubMed]
- Mousavi Ghahfarrokhi, S.S.; Mohamadzadeh, M.; Samadi, N.; Fazeli, M.R.; Khaki, S.; Khameneh, B.; Khameneh Bagheri, R. Management of Cardiovascular Diseases by Short-Chain Fatty Acid Postbiotics. Curr. Nutr. Rep. 2024, 13, 294–313. [Google Scholar] [CrossRef] [PubMed]
- Favero, C.; Giordano, L.; Mihaila, S.M.; Masereeuw, R.; Ortiz, A.; Sanchez-Niño, M.D. Postbiotics and Kidney Disease. Toxins 2022, 14, 623. [Google Scholar] [CrossRef]
- Pluznick, J. A novel SCFA receptor, the microbiota, and blood pressure regulation. Gut Microbes 2014, 5, 202–207. [Google Scholar] [CrossRef]
- Hsu, C.N.; Chang-Chien, G.P.; Lin, S.; Hou, C.Y.; Tain, Y.L. Targeting on Gut Microbial Metabolite Trimethylamine-N-Oxide and Short-Chain Fatty Acid to Prevent Maternal High-Fructose-Diet-Induced Developmental Programming of Hypertension in Adult Male Offspring. Mol. Nutr. Food Res. 2019, 63, e1900073. [Google Scholar] [CrossRef]
- Marques, F.Z.; Nelson, E.; Chu, P.Y.; Horlock, D.; Fiedler, A.; Ziemann, M.; Tan, J.K.; Kuruppu, S.; Rajapakse, N.W.; El-Osta, A.; et al. High-Fiber Diet and Acetate Supplementation Change the Gut Microbiota and Prevent the Development of Hypertension and Heart Failure in Hypertensive Mice. Circulation 2017, 135, 964–977. [Google Scholar] [CrossRef]
- Hsu, C.N.; Yu, H.R.; Chan, J.Y.H.; Lee, W.C.; Wu, K.L.H.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Acetate Supplementation Reverses Blood Pressure Increase in Male Offspring Induced by Exposure to Minocycline during Pregnancy and Lactation. Int. J. Mol. Sci. 2022, 23, 7924. [Google Scholar] [CrossRef]
- Niu, H.; Liu, S.; Jiang, Y.; Hu, Y.; Li, Y.; He, L.; Xing, M.; Li, X.; Wu, L.; Chen, Z.; et al. Are Microplastics Toxic? A Review from Eco-Toxicity to Effects on the Gut Microbiota. Metabolites 2023, 13, 739. [Google Scholar] [CrossRef]
- Fusco, W.; Lorenzo, M.B.; Cintoni, M.; Porcari, S.; Rinninella, E.; Kaitsas, F.; Lener, E.; Mele, M.C.; Gasbarrini, A.; Collado, M.C.; et al. Short-Chain Fatty-Acid-Producing Bacteria: Key Components of the Human Gut Microbiota. Nutrients 2023, 15, 2211. [Google Scholar] [CrossRef]
- Lee, M.D.; Pedroso, A.A.; Maurer, J.J. Bacterial composition of a competitive exclusion product and its correlation with product efficacy at reducing Salmonella in poultry. Front. Physiol. 2023, 13, 1043383. [Google Scholar] [CrossRef] [PubMed]
- Cui, S.; Guo, S.; Zhao, Q.; Li, Y.; Ma, Y.; Yu, Y. Alterations of microbiota and metabolites in the feces of calves with diarrhea associated with rotavirus and coronavirus infections. Front. Microbiol. 2023, 14, 1159637. [Google Scholar] [CrossRef] [PubMed]
- Rong, L.; Zhao, L.; Zhao, L.; Cheng, Z.; Yao, Y.; Yuan, C.; Wang, L.; Sun, H. LDPE microplastics affect soil microbial communities and nitrogen cycling. Sci. Total Environ. 2021, 773, 145640. [Google Scholar] [CrossRef] [PubMed]
- Al-Fakhrany, O.M.; Elekhnawy, E. Next-generation probiotics: The upcoming biotherapeutics. Mol. Biol. Rep. 2024, 51, 505. [Google Scholar] [CrossRef]
- Halimulati, M.; Wang, R.; Aihemaitijiang, S.; Huang, X.; Ye, C.; Zhang, Z.; Li, L.; Zhu, W.; Zhang, Z.; He, L. Anti-Hyperuricemic Effect of Anserine Based on the Gut-Kidney Axis: Integrated Analysis of Metagenomics and Metabolomics. Nutrients 2023, 15, 969. [Google Scholar] [CrossRef]
- Hou, C.Y.; Chen, Y.W.; Hazeena, S.H.; Tain, Y.L.; Hsieh, C.W.; Chen, D.Q.; Liu, R.Y.; Shih, M.K. Cardiovascular risk of dietary trimethylamine oxide precursors and the therapeutic potential of resveratrol and its derivatives. FEBS Open Bio 2024, 14, 358–379. [Google Scholar] [CrossRef]
- Zhu, Y.; Liu, Y.; Wu, C.; Li, H.; Du, H.; Yu, H.; Huang, C.; Chen, Y.; Wang, W.; Zhu, Q.; et al. Enterococcus faecalis contributes to hypertension and renal injury in Sprague-Dawley rats by disturbing lipid metabolism. J. Hypertens. 2021, 39, 1112–1124. [Google Scholar] [CrossRef]
- Uppakarn, K.; Bangpanwimon, K.; Hongpattarakere, T.; Wanitsuwan, W. Comparison of the human gut microbiota between normal control subjects and patients with colonic polyps and colorectal cancer. Res. Sq. 2021. [Google Scholar] [CrossRef]
- Te Riet, L.; van Esch, J.H.; Roks, A.J.; van den Meiracker, A.H.; Danser, A.H. Hypertension: Renin-Angiotensin-aldosterone system alterations. Circ. Res. 2015, 116, 960–975. [Google Scholar] [CrossRef]
- Van Abeelen, A.F.; Veenendaal, M.V.; Painter, R.C.; De Rooij, S.R.; Thangaratinam, S.; Van Der Post, J.A.; Bossuyt, P.M.; Elias, S.G.; Uiterwaal, C.S.; Grobbee, D.E.; et al. The fetal origins of hypertension: A systematic review and meta-analysis of the evidence from animal experiments of maternal undernutrition. J. Hypertens. 2012, 30, 2255–2267. [Google Scholar] [CrossRef]
- Cucciolla, V.; Borriello, A.; Oliva, A.; Galletti, P.; Zappia, V.; Della Ragione, F. Resveratrol: From basic science to the clinic. Cell Cycle 2007, 6, 2495–2510. [Google Scholar] [CrossRef] [PubMed]
- Ponzo, V.; Soldati, L.; Bo, S. Resveratrol: A supplementation for men or for mice? J. Transl. Med. 2014, 12, 158. [Google Scholar] [CrossRef] [PubMed]
- Tome-Carneiro, J.; Larrosa, M.; Gonzalez-Sarrias, A.; Tomas-Barberan, F.A.; Garcia-Conesa, M.T.; Espin, J.C. Resveratrol and Clinical Trials: The Crossroad from In Vitro Studies to Human Evidence. Curr. Pharm. Des. 2013, 19, 6064–6093. [Google Scholar] [CrossRef]
- Calabrese, E.J.; Mattson, M.P.; Calabrese, V. Resveratrol commonly displays hormesis: Occurrence and biomedical significance. Hum. Exp. Toxicol. 2010, 29, 980–1015. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Tain, Y.L. Preventive Aspects of Early Resveratrol Supplementation in Cardiovascular and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2021, 22, 4210. [Google Scholar] [CrossRef]
- Shaito, A.; Posadino, A.M.; Younes, N.; Hasan, H.; Halabi, S.; Alhababi, D.; Al-Mohannadi, A.; Abdel-Rahman, W.M.; Eid, A.H.; Nasrallah, G.K.; et al. Potential Adverse Effects of Resveratrol: A Literature Review. Int. J. Mol. Sci. 2020, 21, 2084. [Google Scholar] [CrossRef]
Gene | Sense | Antisense |
---|---|---|
GPR41 | TCTTCACCACCGTCTATCTCAC | CACAAGTCCTGCCACCCTC |
GPR43 | CTGCCTGGGATCGTCTGTG | CATACCCTCGGCCTTCTGG |
GPR109A | CGGTGGTCTACTATTTCTCC | CCCCTGGAATACTTCTGATT |
Olfr78 | GAGGAAGCTCACTTTTGGTTTGG | CAGCTTCAATGTCCTTGTCACAG |
Renin | AACATTACCAGGGCAACTTTCACT | ACCCCCTTCATGGTGATCTG |
PRR | GAGGCAGTGACCCTCAACAT | CCCTCCTCACACAACAAGGT |
ACE1 | CACCGGCAAGGTCTGCTT | CTTGGCATAGTTTCGTGAGGAA |
AT1R | GCTGGGCAACGAGTTTGTCT | CAGTCCTTCAGCTGGATCTTCA |
R18S | GCCGCGGTAATTCCAGCTCCA | CCCGCCCGCTCCCAAGATC |
Group | CN | MPL | MPH | MPHR |
---|---|---|---|---|
Acetic acid (μM) | 1181 ± 66 | 951 ± 52 * | 1045 ± 70 | 1316 ± 66 #$ |
Propionic acid (μM) | 5.6 ± 0.4 | 5.6 ± 0.5 | 5.7 ± 0.3 | 6.3 ± 0.4 |
Isobutyric acid (μM) | 3.2 ± 0.2 | 3.3 ± 0.1 | 3.6 ± 0.3 | 3 ± 0.1 |
Butyric acid (μM) | 16.1 ± 1.7 | 16.6 ± 1.5 | 15.1 ± 1.4 | 15.5 ± 1 |
Isovaleric acid (μM) | 5.7 ± 0.4 | 5.1 ± 0.7 | 4.4 ± 0.3 * | 5 ± 0.3 |
Valeric acid (μM) | 7.9 ± 0.9 | 9 ± 0.5 | 7.2 ± 0.8 | 7.9 ± 0.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Chang-Chien, G.-P.; Lin, S.-F.; Hou, C.-Y.; Hsu, C.-N. Protective Effect of Resveratrol on Kidney Disease and Hypertension Against Microplastics Exposure in Male Juvenile Rats. Antioxidants 2024, 13, 1457. https://doi.org/10.3390/antiox13121457
Tain Y-L, Chang-Chien G-P, Lin S-F, Hou C-Y, Hsu C-N. Protective Effect of Resveratrol on Kidney Disease and Hypertension Against Microplastics Exposure in Male Juvenile Rats. Antioxidants. 2024; 13(12):1457. https://doi.org/10.3390/antiox13121457
Chicago/Turabian StyleTain, You-Lin, Guo-Ping Chang-Chien, Shu-Fen Lin, Chih-Yao Hou, and Chien-Ning Hsu. 2024. "Protective Effect of Resveratrol on Kidney Disease and Hypertension Against Microplastics Exposure in Male Juvenile Rats" Antioxidants 13, no. 12: 1457. https://doi.org/10.3390/antiox13121457
APA StyleTain, Y.-L., Chang-Chien, G.-P., Lin, S.-F., Hou, C.-Y., & Hsu, C.-N. (2024). Protective Effect of Resveratrol on Kidney Disease and Hypertension Against Microplastics Exposure in Male Juvenile Rats. Antioxidants, 13(12), 1457. https://doi.org/10.3390/antiox13121457