Preventative Effects of Antioxidants against PM10 on Serum IgE Concentration, Mast Cell Counts, Inflammatory Cytokines, and Keratinocyte Differentiation Markers in DNCB-Induced Atopic Dermatitis Mouse Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. DNCB-Induced AD Mouse Model
2.2. SHE and Its Solvent Fractions
2.3. Sebocyte and ORS Keratinocyte Culture
2.4. Measurement of Reactive Oxygen Species (ROS)
2.5. Measurement of Serum IgE Concentration and Spleen Weight
2.6. Measuring Epidermal Thickness and Counting Mast Cells
2.7. Real-Time Polymerase Chain Reaction (PCR)
2.8. Enzyme-Linked Immunosorbent Assay (ELISA)
2.9. Immunofluorescence Staining
2.10. Statistical Analysis
3. Results
3.1. An Increase in the Production of Reactive Oxygen Species by PM10 in Cultured Sebocytes and ORS Keratinocytes Was Decreased by Antioxidants
3.2. Preventative Effects of Antioxidants against the Upregulation of Serum IgE Levels and Spleen Weights in the PM10-Treated, DNCB-Induced AD Mice
3.3. Preventative Effects of Antioxidants against Increased Epidermal Thickness and Mast Cell Counts in the PM10-Treated, DNCB-Induced AD Mice
3.4. Preventative Effects of Antioxidants on the Upregulation of Inflammatory Cytokines in the PM10-Treated, DNCB-Induced AD Mice
3.5. Preventative Effects of Antioxidants on the Upregulation of the Keratinocyte Differentiation Markers in the PM10-Treated, DNCB-Induced AD Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pöschl, U. Atmospheric aerosols: Composition, transformation, climate, and health effects. Angew. Chem. Int. Ed. Engl. 2005, 44, 7520–7540. [Google Scholar] [CrossRef] [PubMed]
- Dagouassat, M.; Lanone, S.; Boczkowski, J. Interaction of matrix metalloproteinases with pulmonary pollutants. Eur. Respir. J. 2012, 39, 1021–1032. [Google Scholar] [CrossRef] [PubMed]
- Dijkhoff, I.M.; Drasler, B.; Karakocak, B.B.; Petri-Fink, A.; Valacchi, G.; Eeman, M.; Rothen-Rutishauser, B. Impact of airborne particulate matter on skin: A systematic review from epidemiology to in vitro studies. Part. Fibre Toxicol. 2020, 17, 35. [Google Scholar] [CrossRef] [PubMed]
- Ishii, H.; Fujii, T.; Hogg, J.C.; Hayashi, S.; Mukae, H.; Vincent, R.; van Eeden, S.F. Contribution of IL-1 beta and TNF-alpha to the initiation of the peripheral lung response to atmospheric particulates (PM10). Am. J. Physiol. Lung Cell. Mol. Physiol. 2004, 287, L176–L183. [Google Scholar] [CrossRef] [Green Version]
- Fujii, T.; Hayashi, S.; Hogg, J.C.; Mukae, H.; Suwa, T.; Goto, Y.; Vincent, R.; van Eeden, S.F. Interaction of alveolar macrophages and airway epithelial cells following exposure to particulate matter produces mediators that stimulate the bone marrow. Am. J. Physiol. Lung Cell. Mol. Physiol. 2002, 27, 34–41. [Google Scholar] [CrossRef] [Green Version]
- Fujii, T.; Hayashi, S.; Hogg, J.C.; Vincent, R.; Van Eeden, S.F. Particulate matter induces cytokine expression in human bronchial epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2001, 25, 265–271. [Google Scholar] [CrossRef]
- Piao, M.J.; Ahn, M.J.; Kang, K.A.; Ryu, Y.S.; Hyun, Y.J.; Shilnikova, K.; Zhen, A.X.; Jeong, J.W.; Choi, Y.H.; Kang, H.K.; et al. Particulate matter 2.5 damages skin cells by inducing oxidative stress, subcellular organelle dysfunction, and apoptosis. Arch. Toxicol. 2018, 92, 2077–2091. [Google Scholar] [CrossRef] [Green Version]
- Lademann, J.; Schaefer, H.; Otberg, N.; Teichmann, A.; Blume-Peytavi, U.; Sterry, W. Penetration of microparticles into human skin. Hautarzt 2004, 55, 1117–1119. [Google Scholar] [CrossRef]
- Vierkötter, A.; Schikowski, T.; Ranft, U.; Sugiri, D.; Matsui, M.; Krämer, U.; Krutmann, J. Airborne particle exposure and extrinsic skin aging. J. Investig. Dermatol. 2010, 130, 2719–2726. [Google Scholar] [CrossRef] [Green Version]
- Mills, N.L.; Miller, M.R.; Lucking, A.J.; Beveridge, J.; Flint, L.; Boere, A.J.; Fokkens, P.H.; Boon, N.A.; Sandstrom, T.; Blomberg, A.; et al. Combustion-derived nanoparticulate induces the adverse vascular effects of diesel exhaust inhalation. Eur. Heart J. 2011, 32, 2660–2671. [Google Scholar] [CrossRef]
- Kim, J.; Kim, E.H.; Oh, I.; Jung, K.; Han, Y.; Cheong, H.K.; Ahn, K. Symptoms of atopic dermatitis are influenced by outdoor air pollution. J. Allergy Clin. Immunol. 2013, 132, 495–498. [Google Scholar] [CrossRef] [PubMed]
- Bae, Y.J.; Park, K.Y.; Han, H.S.; Kim, Y.S.; Hong, J.Y.; Han, T.Y.; Seo, S.J. Effects of Particulate Matter in a Mouse Model of Oxazolone-Induced Atopic Dermatitis. Ann. Dermatol. 2020, 32, 496–507. [Google Scholar] [CrossRef]
- Oh, S.J.; Yoon, D.; Park, J.H.; Lee, J.H. Effects of Particulate Matter on Healthy Skin: A Comparative Study between High- and Low-Particulate Matter Periods. Ann. Dermatol. 2021, 33, 263–270. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Seok, J.K.; Kwak, J.Y.; Suh, H.J.; Kim, Y.M.; Boo, Y.C. Anti-inflammatory effects of pomegranate peel extract in THP-1 cells exposed to particulate matter PM10. Evid. Based Complement. Alternat. Med. 2016, 2016, 836080. [Google Scholar] [CrossRef] [Green Version]
- Uysal, U.; Seremet, S.; Lamping, J.W.; Adams, J.M.; Liu, D.Y.; Swerdlow, R.H.; Aires, D.J. Consumption of polyphenol plants may slow aging and associated diseases. Curr. Pharm. Des. 2013, 19, 6094–6111. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.I.; Kim, H.J.; Boo, Y.C. Effect of green tea and (–)-epigallocatechin gallate on ethanolinduced toxicity in HepG2 cells. Phytother. Res. 2008, 22, 669–674. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Seok, J.K.; Boo, Y.C. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10. Evid. Based Complement. Alternat. Med. 2018, 2018, 8248323. [Google Scholar] [CrossRef] [Green Version]
- Kim, A.R.; Shin, T.S.; Lee, M.S.; Park, J.Y.; Park, K.E.; Yoon, N.Y.; Kim, J.S.; Choi, J.S.; Jang, B.C.; Byun, D.S.; et al. Isolation and identification of phlorotannins from Ecklonia stolonifera with antioxidant and anti-inflammatory properties. J. Agric. Food Chem. 2009, 57, 3483–3489. [Google Scholar] [CrossRef]
- Ha, J.W.; Song, H.; Hong, S.S.; Boo, Y.C. Marine Alga Ecklonia cava Extract and Dieckol Attenuate Prostaglandin E 2 Production in HaCaT Keratinocytes Exposed to Airborne Particulate Matter. Antioxidants 2019, 8, 190. [Google Scholar] [CrossRef] [Green Version]
- Chidambara, M.K.N.; Jayaprakasha, G.K.; Singh, R.P. Studies on antioxidant activity of pomegranate (Punica granatum) peel extract using in vivo models. J. Agric. Food Chem. 2002, 50, 81–86. [Google Scholar] [CrossRef]
- Venusova, E.; Kolesarova, A.; Horky, P.; Slama, P. Physiological and Immune Functions of Punicalagin. Nutrients 2021, 13, 2150. [Google Scholar] [CrossRef] [PubMed]
- Seok, J.K.; Lee, J.W.; Kim, Y.M.; Boo, Y.C. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10. Skin Pharmacol. Physiol. 2018, 31, 134–143. [Google Scholar] [CrossRef] [PubMed]
- Ratz-Łyko, A.; Arct, J. Resveratrol as an active ingredient for cosmetic and dermatological applications: A review. J. Cosmet. Laser Ther. 2019, 21, 84–90. [Google Scholar] [CrossRef] [PubMed]
- Stojanović, S.; Sprinz, H.; Brede, O. Efficiency and mechanism of the antioxidant action of trans-resveratrol and its analogues in the radical liposome oxidation. Arch. Biochem. Biophys. 2001, 391, 79–89. [Google Scholar] [CrossRef]
- Shin, J.W.; Lee, H.S.; Na, J.I.; Huh, C.H.; Park, K.C.; Choi, H.R. Resveratrol Inhibits Particulate Matter-Induced Inflammatory Responses in Human Keratinocytes. Int. J. Mol. Sci. 2020, 21, 3446. [Google Scholar] [CrossRef]
- Ha, J.W.; Boo, Y.C. Siegesbeckiae Herba Extract and Chlorogenic Acid Ameliorate the Death of HaCaT Keratinocytes Exposed to Airborne Particulate Matter by Mitigating Oxidative Stress. Antioxidants 2021, 10, 1762. [Google Scholar] [CrossRef]
- Quan, P.; Jiao, B.; Shang, R.; Liu, C.; Fang, L. Alternative therapy of rheumatoid arthritis with a novel transdermal patch containing Siegesbeckiae Herba extract. J. Ethnopharmacol. 2021, 265, 113294. [Google Scholar] [CrossRef]
- Wang, Q.; Liang, Y.Y.; Li, K.W.; Li, Y.; Niu, F.J.; Zhou, S.J.; Wei, H.C.; Zhou, C.Z. Herba Siegesbeckiae: A review on its traditional uses, chemical constituents, pharmacological activities and clinical studies. J. Ethnopharmacol. 2022, 275, 114117. [Google Scholar] [CrossRef]
- Kim, D.W.; Jung, D.H.; Sung, J.; Min, I.S.; Lee, S.J. Tart Cherry Extract Containing Chlorogenic Acid, Quercetin, and Kaempferol Inhibits the Mitochondrial Apoptotic Cell Death Elicited by Airborne PM 10 in Human Epidermal Keratinocytes. Antioxidants 2021, 10, 443. [Google Scholar] [CrossRef]
- Teng, W.L.; Huang, P.H.; Wang, H.C.; Tseng, C.H.; Yen, F.L. Pterostilbene Attenuates Particulate Matter-Induced Oxidative Stress, Inflammation and Aging in Keratinocytes. Antioxidants 2021, 10, 1552. [Google Scholar] [CrossRef] [PubMed]
- Zobiri, O.; Zucchi, H.; Dimitrov, A.; Marrot, L. Repeated Exposures to UVA1 and PM-Associated Pollutants Trigger Epidermal Barrier Dysfunction in Skin Epithelialization Model. J. Investig. Dermatol. 2022, 21, S0022-202X. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Na, H.W.; Jang, Y.; Kim, S.J.; Kee, N.G.; Shin, D.Y.; Choi, H.; Kim, H.J.; Seo, Y.R. Integrative analysis to explore the biological association between environmental skin diseases and ambient particulate matter. Sci. Rep. 2022, 12, 9750. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Li, X.B.; Chu, X.J.; Cao, N.W.; Wu, H.; Huang, R.G.; Li, B.Z.; Ye, D.Q. Ambient air pollutants increase the risk of immunoglobulin E-mediated allergic diseases: A systematic review and meta-analysis. Environ. Sci. Pollut. Res. Int. 2022, 20, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Woo, Y.R.; Park, S.Y.; Choi, K.; Hong, E.S.; Kim, S.; Kim, H.S. Air pollution and atopic dermatitis (AD): The impact of particulate matter (PM(10)) on an AD mouse-model. Int. J. Mol. Sci. 2020, 21, 6079. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Dong, Y.; Ni, C.; Kan, H.; Yan, S. Fine particulate matter (PM2.5) is a risk factor for dermatitis by promoting the expression of thymic stromal lymphopoietin (TSLP) in keratinocytes. Indian J. Dermatol. 2020, 65, 92–96. [Google Scholar]
- Park, S.Y.; An, K.S.; Lee, B.; Kang, J.H.; Jung, H.J.; Kim, M.W.; Ryu, H.Y.; Shim, K.S.; Nam, K.T.; Yoon, Y.S.; et al. Establishment of particulate matter-induced lung injury model in mouse. Lab. Anim. Res. 2021, 37, 20. [Google Scholar] [CrossRef]
- Cohen, M.D.; Prophete, C.; Horton, L.; Sisco, M.; Park, S.H.; Lee, H.W.; Zelikoff, J.; Chen, L.C. Impact on rats from acute intratracheal inhalation exposures to WTC dusts. Inhal. Toxicol. 2020, 32, 218–230. [Google Scholar] [CrossRef]
- Jin, Y.; Zhu, M.; Guo, Y.; Foreman, D.; Feng, F.; Duan, G.; Wu, W.; Zhang, W. Fine particulate matter (PM(2.5)) enhances FcεRI-mediated signaling and mast cell function. Cell. Signal. 2019, 57, 102–109. [Google Scholar] [CrossRef]
- Kataoka, H.; Tanaka, K.; Tazuya-Murayama, K.; Yamashita, T.; Nishikawa, J.I. Cytotoxic effects of water-soluble extracts of coarse and fine atmospheric particulate matter on mast cell lines. Biol. Pharm. Bull. 2021, 44, 57–62. [Google Scholar] [CrossRef]
- Wang, Y.; Tang, N.; Mao, M.; Zhou, Y.; Wu, Y.; Li, J.; Zhang, W.; Peng, C.; Chen, X.; Li, J. Fine particulate matter (PM2.5) promotes IgE-mediated mast cell activation through ROS/Gadd45b/JNK axis. J. Dermatol. Sci. 2021, 102, 47–57. [Google Scholar] [CrossRef] [PubMed]
- Ye, C.; Gu, H.; Li, M.; Chen, R.; Xiao, X.; Zou, Y. Air Pollution and Weather Conditions Are Associated with Daily Outpatient Visits of Atopic Dermatitis in Shanghai, China. Dermatology 2022, 21, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Yang, S.I.; Lim, H.; Lee, S.Y.; Park, M.J.; Song, K.B.; Choi, E.J.; Oh, H.Y.; Kim, H.C.; Shin, Y.J.; et al. Prenatal PM 2.5 affects atopic dermatitis depending on maternal anxiety and gender: COCOA study. Clin. Transl. Allergy. 2021, 11, e12070. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.M.; Kim, J.; Ha, S.C.; Ahn, K. Effects of Exposure to Indoor Fine Particulate Matter on Atopic Dermatitis in Children. Int. J. Environ. Res. Public Health 2021, 18, 11509. [Google Scholar] [CrossRef] [PubMed]
- Park, T.H.; Park, S.; Cho, M.K.; Kim, S. Associations of particulate matter with atopic dermatitis and chronic inflammatory skin diseases in South Korea. Clin. Exp. Dermatol. 2022, 47, 325–334. [Google Scholar] [CrossRef]
- Nakhjirgan, P.; Mahmoodi, M.; Kashani, H.; Firooz, A.; Nabizadeh, R.; Kermani, M.; Yunesian, M. Air pollution and exacerbation of skin itching and sleep disturbance in Iranian atopic dermatitis patients. J. Environ. Health Sci. Eng. 2019, 17, 811–816. [Google Scholar] [CrossRef]
- He, Y.; Shi, C.R.; Guang, Q.; Luo, Z.C.; Xi, Q.; Han, L. Effects of air pollutants on outpatient visits for atopic dermatitis in Lanzhou. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 2021, 43, 521–530. [Google Scholar]
- Kwack, M.H.; Ha, N.G.; Lee, W.J. Dieckol Inhibits the Effects of Particulate Matter 10 on Sebocytes, Outer Root Sheath Cells, and Cutibacterium Acnes-Pretreated Mice. Ann. Dermatol. 2022, 34, 182–190. [Google Scholar] [CrossRef]
- Kwack, M.H.; Ha, N.G.; Lee, W.J. Effects of <10-μm Particulate Matter on Cultured Human Sebocytes and Outer Root Sheath Cells and Usefulness of Siegesbeckia Herba Extract. Ann. Dermatol. 2022, 34, 163–172. [Google Scholar] [CrossRef]
- Herath, K.H.I.N.M.; Kim, H.J.; Mihindukulasooriya, S.P.; Kim, A.; Kim, H.J.; Jeon, Y.J.; Jee, Y. Sargassum horneri extract containing mojabanchromanol attenuates the particulate matter exacerbated allergic asthma through reduction of Th2 and Th17 response in mice. Environ. Pollut. 2020, 265, 114094. [Google Scholar] [CrossRef]
- Hwang, Y.H.; Kim, S.J.; Kim, H.; Yee, S.T. The Protective Effects of 2,3,5,4’-Tetrahydroxystilbene-2-O-beta-d-Glucoside in the OVA-Induced Asthma Mice Model. Int. J. Mol. Sci. 2018, 19, 4013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, S.M.; Kang, M.C.; Jin, M.; Lee, T.H.; Lim, B.O.; Kim, S.Y. Fermented blueberry and black rice containing Lactobacillus plantarum MG4221: A novel functional food for particulate matter (PM(2.5))/dinitrochlorobenzene (DNCB)-induced atopic dermatitis. Food Funct. 2021, 12, 3611–3623. [Google Scholar] [CrossRef]
Gene | Oligonucleotide Primers | |
---|---|---|
Forward | Reverse | |
mouse GAPDH | AACTTTGGCATTGTGGAAGG | ACACATTGGGGGTAGGAACA |
mouse IL-1β | Mm-IL-1β-1-SG (QuantiTect Primer, Qiagen) | |
mouse IL-4 | ACAGGAGAAGGGACGCCAT | GAAGCCGTACAGACGAGCTCA |
mouse IL-6 | ACCACTTCACAAGTCGGAGG | TGCAAGTGCATCATCGTTGTTC |
mouse IL-17α | ATCCCTCAAAGCTCAGCGTGTC | GGGTCTTCATTGCGGTGGAGAG |
mouse IL-25 | CGGAGGAGTGGCTGAAGTGGAG | ATGGGTACCTTCCTCGCCATG |
mouse IL-31 | TCGGTCATCATAGCACATCTGGAG | GCACAGTCCCTTTGGAGTTAAGTC |
mouse TSLP | CGGATGGGGCTAACTTACA | TCCTCGATTTGCTCGAACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwack, M.H.; Bang, J.S.; Lee, W.J. Preventative Effects of Antioxidants against PM10 on Serum IgE Concentration, Mast Cell Counts, Inflammatory Cytokines, and Keratinocyte Differentiation Markers in DNCB-Induced Atopic Dermatitis Mouse Model. Antioxidants 2022, 11, 1334. https://doi.org/10.3390/antiox11071334
Kwack MH, Bang JS, Lee WJ. Preventative Effects of Antioxidants against PM10 on Serum IgE Concentration, Mast Cell Counts, Inflammatory Cytokines, and Keratinocyte Differentiation Markers in DNCB-Induced Atopic Dermatitis Mouse Model. Antioxidants. 2022; 11(7):1334. https://doi.org/10.3390/antiox11071334
Chicago/Turabian StyleKwack, Mi Hee, Jin Seon Bang, and Weon Ju Lee. 2022. "Preventative Effects of Antioxidants against PM10 on Serum IgE Concentration, Mast Cell Counts, Inflammatory Cytokines, and Keratinocyte Differentiation Markers in DNCB-Induced Atopic Dermatitis Mouse Model" Antioxidants 11, no. 7: 1334. https://doi.org/10.3390/antiox11071334
APA StyleKwack, M. H., Bang, J. S., & Lee, W. J. (2022). Preventative Effects of Antioxidants against PM10 on Serum IgE Concentration, Mast Cell Counts, Inflammatory Cytokines, and Keratinocyte Differentiation Markers in DNCB-Induced Atopic Dermatitis Mouse Model. Antioxidants, 11(7), 1334. https://doi.org/10.3390/antiox11071334