Effects of a Phytogenic Supplement Containing Olive By-Product and Green Tea Extracts on Growth Performance, Lipid Metabolism, and Hepatic Antioxidant Capacity in Largemouth Bass (Micropterus salmoides) Fed a High Soybean Meal Diet
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diets
2.2. Fish and Rearing Conditions
2.3. Sampling
2.4. Chemical Analysis
2.5. Hematological and Hepatic Biochemical Parameters Analysis
2.6. Hepatic Antioxidative Parameters Analysis
2.7. RNA Isolation, Reverse Transcription, and Real-Time PCR (RT-qPCR)
2.8. Western Blot
2.9. Hepatic Histopathological Examination
2.10. Statical Analysis
3. Results
3.1. Growth Performance, Morphometric Parameters, and Whole-Body Proximate Composition
3.2. Plasma Biochemical Parameters
3.3. Liver Function and Hepatic Antioxidant Capacity
3.4. Hepatic Lipid Metabolism
3.5. Hepatic Histopathological Examination
3.6. Western Blot for AKT-mTOR Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. FAO Yearbook Fishery and Aquaculture Statistics 2019; Food and agriculture organization of the United Nations: Rome, Italy, 2021; p. 16. [Google Scholar]
- Zhu, S.J.; Gao, W.H.; Wen, Z.Y.; Chi, S.Y.; Shi, Y.H.; Hu, W.; Tan, B.P. Partial substitution of fish meal by Clostridium autoethanogenum protein in the diets of juvenile largemouth bass (Micropterus salmoides). Aquac. Rep. 2022, 22, 100938. [Google Scholar] [CrossRef]
- Wang, L.; Wang, J.; Lu, K.L.; Song, K.; Mai, K.S.; Zhang, C.X.; Rahimnejad, S. Total replacement of fish meal with soybean meal in diets for bullfrog (Lithobates catesbeianus): Effects on growth performance and gut microbial composition. Aquaculture 2020, 524, 735236. [Google Scholar] [CrossRef]
- Walsh, S.; Davis, R.; Weldon, A.; Reis, J.; Stites, W.; Rhodes, M.; Ibarra-Castro, L.; Bruce, T.; Davis, D.A. Effects of fishmeal replacement, attractants, and taurine removal on juvenile and sub-adult Red Snapper (Lutjanus campechanus). Aquaculture 2021, 544, 737054. [Google Scholar] [CrossRef]
- Murashita, K.; Matsunari, H.; Furuita, H.; Rønnestad, I.; Oku, H.; Yamamoto, T. Effects of dietary soybean meal on the digestive physiology of red seabream Pagrus major. Aquaculture 2018, 493, 219–228. [Google Scholar] [CrossRef]
- Choi, D.G.; He, M.; Fang, H.; Wang, X.L.; Li, X.Q.; Leng, X.J. Replacement of fish meal with two fermented soybean meals in diets for rainbow trout (Oncorhynchus mykiss). Aquac. Nutr. 2020, 26, 37–46. [Google Scholar] [CrossRef]
- He, M.; Yu, Y.F.; Li, X.Q.; Poolsawat, L.; Yang, P.X.; Bian, Y.H.; Guo, Z.H.; Leng, X.J. An evaluation of replacing fish meal with fermented soybean meal in the diets of largemouth bass (Micropterus salmoides): Growth, nutrition utilization and intestinal histology. Aquac. Res. 2020, 51, 4302–4314. [Google Scholar] [CrossRef]
- Liang, X.F.; Hu, L.; Dong, Y.C.; Wu, X.F.; Qin, Y.C.; Zheng, Y.H.; Shi, D.D.; Xue, M.; Liang, X.F. Substitution of fish meal by fermented soybean meal affects the growth performance and flesh quality of Japanese seabass (Lateolabrax japonicus). Anim. Feed. Sci. Technol. 2017, 229, 1–12. [Google Scholar] [CrossRef]
- Li, C.; Zhang, B.; Liu, C.; Zhou, H.; Wang, X.; Mai, K.; He, G. Effects of dietary raw or Enterococcus faecium fermented soybean meal on growth, antioxidant status, intestinal microbiota, morphology, and inflammatory responses in turbot (Scophthalmus maximus L.). Fish Shellfish Immunol. 2020, 100, 261–271. [Google Scholar] [CrossRef]
- Green, T.J.; Smullen, R.; Barnes, A.C. Dietary soybean protein concentrate-induced intestinal disorder in marine farmed Atlantic salmon, Salmo salar is associated with alterations in gut microbiota. Vet. Microbiol. 2013, 166, 286–292. [Google Scholar] [CrossRef]
- Encarnação, P. 5-Functional feed additives in aquaculture feeds. Aquafeed Formul. 2016, 217–237. [Google Scholar] [CrossRef]
- Chakraborty, S.B.; Hancz, C. Application of phytochemicals as immunostimulant, antipathogenic and antistress agents in finfish culture. Rev. Aquac. 2011, 3, 103–119. [Google Scholar] [CrossRef]
- Chakraborty, S.B.; Horn, P.; Hancz, C. Application of phytochemicals as growth-promoters and endocrine modulators in fish culture. Rev. Aquac. 2014, 6, 1–19. [Google Scholar] [CrossRef]
- Acar, Ü.; Parrino, V.; Kesbiç, O.S.; Lo Paro, G.; Saoca, C.; Abbate, F.; Yılmaz, S.; Fazio, F. Effects of different levels of pomegranate seed oil on some blood parameters and disease resistance against Yersinia ruckeri in rainbow trout. Front. Physiol. 2018, 9, 596. [Google Scholar] [CrossRef] [PubMed]
- Parrino, V.; Kesbiç, O.S.; Acar, Ü.; Fazio, F. Hot pepper (sp.) oil and its effects on growth performance and blood parameters in rainbow trout (Oncorhynchus mykiss). Nat. Prod. Res. 2020, 34, 3226–3230. [Google Scholar] [CrossRef]
- Venditti, A.; Serrilli, A.M.; Rizza, L.; Frasca, G.; Cardile, V.; Bonina, F.P.; Bianco, A. Aromadendrine, a new component of the flavonoid pattern of Olea europaea L. and its anti-inflammatory activity. Nat. Prod. Res. 2013, 27, 340–349. [Google Scholar] [CrossRef]
- Musial, C.; Kuban-Jankowska, A.; Gorska-Ponikowska, M. Beneficial properties of green tea catechins. Int. J. Mol. Sci. 2020, 21, 1744. [Google Scholar] [CrossRef]
- Zemheri-Navruz, F.; Acar, Ü.; Yılmaz, S. Dietary supplementation of olive leaf extract enhances growth performance, digestive enzyme activity and growth related genes expression in common carp Cyprinus carpio. Gen. Comp. Endocrinol. 2020, 296, 113541. [Google Scholar] [CrossRef]
- Jahazi, M.A.; Hoseinifar, S.H.; Jafari, V.; Hajimoradloo, A.; Van Doan, H.; Paolucci, M. Dietary supplementation of polyphenols positively affects the innate immune response, oxidative status, and growth performance of common carp, Cyprinus carpio L. Aquaculture 2020, 517, 734709. [Google Scholar] [CrossRef]
- Baba, E.; Acar, Ü.; Yılmaz, S.; Zemheri, F.; Ergün, S. Dietary olive leaf (Olea europea L.) extract alters some immune gene expression levels and disease resistance to Yersinia ruckeri infection in rainbow trout Oncorhynchus mykiss. Fish Shellfish. Immunol. 2018, 79, 28–33. [Google Scholar] [CrossRef]
- Sheikhzadeh, N.; Nofouzi, K.; Delazar, A.; Oushani, A.K. Immunomodulatory effects of decaffeinated green tea (Camellia sinensis) on the immune system of rainbow trout (Oncorhynchus mykiss). Fish Shellfish. Immunol. 2011, 31, 1268–1269. [Google Scholar] [CrossRef]
- Liang, X.; Chen, P.; Wu, X.; Xing, S.; Morais, S.; He, M.; Gu, X.; Xue, M. Effects of High Starch and Supplementation of an Olive Extract on the Growth Performance, Hepatic Antioxidant Capacity and Lipid Metabolism of Largemouth Bass (Micropterus salmoides). Antioxidants 2022, 11, 577. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Wang, J.; Guan, Y.; Xing, S.; Liang, X.; Xue, M.; Wang, J.; Chang, Y.; Leclercq, E. Cottonseed protein concentrate as fishmeal alternative for largemouth bass (Micropterus salmoides) supplemented a yeast-based paraprobiotic: Effects on growth performance, gut health and microbiome. Aquaculture 2022, 551, 737898. [Google Scholar] [CrossRef]
- Yin, P.; Xie, S.; Zhuang, Z.; He, X.; Tang, X.; Tian, L.; Liu, Y.; Niu, J. Dietary supplementation of bile acid attenuate adverse effects of high-fat diet on growth performance, antioxidant ability, lipid accumulation and intestinal health in juvenile largemouth bass (Micropterus salmoides). Aquaculture 2021, 531, 735864. [Google Scholar] [CrossRef]
- Gong, Y.; Yang, F.; Hu, J.; Liu, C.; Liu, H.; Han, D.; Jin, J.; Yang, Y.; Zhu, X.; Yi, J. Effects of dietary yeast hydrolysate on the growth, antioxidant response, immune response and disease resistance of largemouth bass (Micropterus salmoides). Fish Shellfish. Immunol. 2019, 94, 548–557. [Google Scholar] [CrossRef]
- Yang, P.; Yang, W.; He, M.; Li, X.; Leng, X.J. Dietary synbiotics improved the growth, feed utilization and intestinal structure of largemouth bass (Micropterus salmoides) juvenile. Aquac. Nutr. 2020, 26, 590–600. [Google Scholar] [CrossRef]
- Yu, L.; Yu, H.; Liang, X.; Li, N.; Wang, X.; Li, F.; Wu, X.; Zheng, Y.; Xue, M. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass (Micropterus salmoides). Fish Shellfish. Immunol. 2018, 72, 220–229. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Ye, H.; Xu, M.; Liu, Q.; Sun, Z.; Zou, C.; Chen, L.; Su, N.; Ye, C. Effects of replacing fish meal with soybean meal on growth performance, feed utilization and physiological status of juvenile obscure puffer, Takifugu obscurus. Comp. Biochem. Physiol. Part C: Toxicol. Pharmacol. 2019, 216, 75–81. [Google Scholar] [CrossRef]
- Zhou, F.; Song, W.; Shao, Q.; Peng, X.; Xiao, J.; Hua, Y.; Owari, B.N.; Zhang, T.; Ng, W.K. Partial replacement of fish meal by fermented soybean meal in diets for black sea bream, Acanthopagrus schlegelii, juveniles. J. World Aquac. Soc. 2011, 42, 184–197. [Google Scholar] [CrossRef]
- Lin, S.; Luo, L. Effects of different levels of soybean meal inclusion in replacement for fish meal on growth, digestive enzymes and transaminase activities in practical diets for juvenile tilapia, Oreochromis niloticus × O. aureus. Anim. Feed. Sci. Technol. 2011, 168, 80–87. [Google Scholar] [CrossRef]
- Rajabiesterabadi, H.; Ghelichi, A.; Jorjani, S.; Hoseini, S.M.; Akrami, R. Dietary olive (Olea europaea) leaf extract suppresses oxidative stress and modulates intestinal expression of antioxidant-and tight junction-related genes in common carp (Cyprinus carpio). Aquaculture 2020, 520, 734676. [Google Scholar] [CrossRef]
- Nootash, S.; Sheikhzadeh, N.; Baradaran, B.; Oushani, A.K.; Moghadam, M.R.M.; Nofouzi, K.; Monfaredan, A.; Aghebati, L.; Zare, F.; Shabanzadeh, S. Green tea (Camellia sinensis) administration induces expression of immune relevant genes and biochemical parameters in rainbow trout (Oncorhynchus mykiss). Fish Shellfish. Immunol. 2013, 35, 1916–1923. [Google Scholar] [CrossRef] [PubMed]
- Hoseinifar, S.H.; Shakouri, M.; Yousefi, S.; Van Doan, H.; Shafiei, S.; Yousefi, M.; Mazandarani, M.; Mozanzadeh, M.T.; Tulino, M.G.; Faggio, C. Humoral and skin mucosal immune parameters, intestinal immune related genes expression and antioxidant defense in rainbow trout (Oncorhynchus mykiss) fed olive (Olea europea L.) waste. Fish Shellfish. Immunol. 2020, 100, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Sokooti, R.; Chelemal Dezfoulnejad, M.; Javaheri baboli, M. Effects of olive leaf extract (Olea europaea Leecino) on growth, haematological parameters, immune system and carcass composition in common carp (Cyprinus carpio). Aquac. Res. 2021, 52, 2415–2423. [Google Scholar] [CrossRef]
- Laplante, M.; Sabatini, D.M. mTOR signaling at a glance. J. Cell Sci. 2009, 122, 3589–3594. [Google Scholar] [CrossRef]
- Navé, B.T.; Ouwens, D.M.; Withers, D.J.; Alessi, D.R.; Shepherd, P.R. Mammalian target of rapamycin is a direct target for protein kinase B: Identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem. J. 1999, 344, 427–431. [Google Scholar] [CrossRef]
- Hay, N.; Sonenberg, N. Upstream and downstream of mTOR. Genes Dev. 2004, 18, 1926–1945. [Google Scholar] [CrossRef]
- Xu, D.; He, G.; Mai, K.; Zhou, H.; Xu, W.; Song, F. Postprandial nutrient-sensing and metabolic responses after partial dietary fishmeal replacement by soyabean meal in turbot (Scophthalmus maximus L.). Br. J. Nutr. 2016, 115, 379–388. [Google Scholar] [CrossRef]
- Wang, Q.; He, G.; Mai, K.; Xu, W.; Zhou, H. Fishmeal replacement by mixed plant proteins and maggot meal on growth performance, target of rapamycin signalling and metabolism in juvenile turbot (S cophthalmus maximus L.). Aquac. Nutr. 2016, 22, 752–758. [Google Scholar] [CrossRef]
- Molinaro, A.; Wahlström, A.; Marschall, H.-U. Role of bile acids in metabolic control. Trends Endocrinol. Metab. 2018, 29, 31–41. [Google Scholar] [CrossRef]
- Romano, N.; Fischer, H.; Rubio-Benito, M.M.; Overtuf, K.; Sinha, A.K.; Kumar, V. Different dietary combinations of high/low starch and fat with or without bile acid supplementation on growth, liver histopathology, gene expression and fatty acid composition of largemouth bass, Micropterus salmoides. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2022, 266, 111157. [Google Scholar] [CrossRef] [PubMed]
- Kortner, T.M.; Gu, J.; Krogdahl, Å.; Bakke, A.M. Transcriptional regulation of cholesterol and bile acid metabolism after dietary soyabean meal treatment in Atlantic salmon (Salmo salar L.). Br. J. Nutr. 2013, 109, 593–604. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.; Xing, S.; Chen, P.; Wu, X.; Gu, X.; Luo, L.; Liang, X.; Xue, M. Plant protein diet-induced hypoimmunity by affecting the spiral valve intestinal microbiota and bile acid enterohepatic circulation in Amur sturgeon (Acipenser schrenckii). Fish Shellfish. Immunol. 2020, 106, 421–430. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Liang, X.F.; Fang, L.; Yuan, X.; Zhou, Y.; Zhang, J.; Li, B. Effects of dietary non-protein energy source levels on growth performance, body composition and lipid metabolism in herbivorous grass carp (C tenopharyngodon idella Val.). Aquac. Res. 2015, 46, 1197–1208. [Google Scholar] [CrossRef]
- Yu, H.; Zhang, L.; Chen, P.; Liang, X.; Cao, A.; Han, J.; Wu, X.; Zheng, Y.; Qin, Y.; Xue, M. Dietary bile acids enhance growth, and alleviate hepatic fibrosis induced by a high starch diet via AKT/FOXO1 and cAMP/AMPK/SREBP1 pathway in Micropterus salmoides. Front. Physiol. 2019, 10, 1430. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Liu, X.; Wang, Z.; Wang, K. Effect of partial fish meal replacement by soybean meal on the growth performance and biochemical indices of juvenile Japanese flounder Paralichthys olivaceus. Aquac. Int. 2011, 19, 143–153. [Google Scholar] [CrossRef]
- Silva-Carrillo, Y.; Hernández, C.; Hardy, R.W.; González-Rodríguez, B.; Castillo-Vargasmachuca, S. The effect of substituting fish meal with soybean meal on growth, feed efficiency, body composition and blood chemistry in juvenile spotted rose snapper Lutjanus guttatus (Steindachner, 1869). Aquaculture 2012, 364, 180–185. [Google Scholar] [CrossRef]
- Jump, D.B. Fatty acid regulation of hepatic lipid metabolism. Curr. Opin. Clin. Nutr. Metab. Care 2011, 14, 115. [Google Scholar] [CrossRef]
- Fazio, F.; Habib, S.S.; Naz, S.; Filiciotto, F.; Cicero, N.; Rehman, H.U.; Saddozai, S.; Rind, K.H.; Rind, N.A.; Shar, A.H. Effect of fortified feed with olive leaves extract on the haematological and biochemical parameters of Oreochromis niloticus (Nile tilapia). Nat. Prod. Res. 2022, 36, 1575–1580. [Google Scholar] [CrossRef]
- Schreiber, R.; Xie, H.; Schweiger, M. Of mice and men: The physiological role of adipose triglyceride lipase (ATGL). Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 2019, 1864, 880–899. [Google Scholar] [CrossRef]
- Gaidhu, M.P.; Anthony, N.M.; Patel, P.; Hawke, T.J.; Ceddia, R.B. Dysregulation of lipolysis and lipid metabolism in visceral and subcutaneous adipocytes by high-fat diet: Role of ATGL, HSL, and AMPK. Am. J. Physiol. -Cell Physiol. 2010, 298, C961–C971. [Google Scholar] [CrossRef] [PubMed]
- Qian, Y.-C.; Wang, X.; Ren, J.; Wang, J.; Limbu, S.M.; Li, R.-X.; Zhou, W.-H.; Qiao, F.; Zhang, M.-L.; Du, Z.-Y. Different effects of two dietary levels of tea polyphenols on the lipid deposition, immunity and antioxidant capacity of juvenile GIFT tilapia (Oreochromis niloticus) fed a high-fat diet. Aquaculture 2021, 542, 736896. [Google Scholar] [CrossRef]
- Yuan, X.C.; Chen, F.; Yue, D.D.; Xie, S.Q.; Huang, S.J.; Jin, S.Z.; Chen, H.T.; Yang, Y.O. Tea polyphenols act as a natural antihyperglycemic feed additive candidate in grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2021, 27, 2712–2725. [Google Scholar] [CrossRef]
- Ji, R.; Li, Y.; Li, X.; Xiang, X.; Li, Y.; Zhu, S.; Yang, B.; Zhang, Y.; Mai, K.; Ai, Q. Effects of dietary tea polyphenols on growth, biochemical and antioxidant responses, fatty acid composition and expression of lipid metabolism related genes of large yellow croaker (Larimichthys crocea). Aquac. Res. 2018, 49, 1210–1218. [Google Scholar] [CrossRef]
- Cho, S.H.; Lee, S.-M.; Park, B.H.; Ji, S.-C.; Lee, J.; Bae, J.; Oh, S.-Y. Effect of dietary inclusion of various sources of green tea on growth, body composition and blood chemistry of the juvenile olive flounder, Paralichthys olivaceus. Fish Physiol. Biochem. 2007, 33, 49–57. [Google Scholar] [CrossRef]
- Hwang, J.-H.; Lee, S.-W.; Rha, S.-J.; Yoon, H.-S.; Park, E.-S.; Han, K.-H.; Kim, S.-J. Dietary green tea extract improves growth performance, body composition, and stress recovery in the juvenile black rockfish, Sebastes schlegeli. Aquac. Int. 2013, 21, 525–538. [Google Scholar] [CrossRef]
- Yeh, Y.-T.; Cho, Y.-Y.; Hsieh, S.-C.; Chiang, A.-N. Chinese olive extract ameliorates hepatic lipid accumulation in vitro and in vivo by regulating lipid metabolism. Sci. Rep. 2018, 8, 1057. [Google Scholar] [CrossRef]
- Montell, L.T.; Cortés-Castell, E.; Veciana-Galindo, C.; Sirvent-Segura, E.; Gil-Guillén, F.; Rizo-Baeza, M. Influence of olive polyphenols on glucose and cholesterol levels in medaka fish. J. Negat. No Posit. Results 2020, 5, 478–490. [Google Scholar]
- Nagao, T.; Hase, T.; Tokimitsu, I. A green tea extract high in catechins reduces body fat and cardiovascular risks in humans. Obesity 2007, 15, 1473–1483. [Google Scholar] [CrossRef]
- Wolfram, S.; Wang, Y.; Thielecke, F. Anti-obesity effects of green tea: From bedside to bench. Mol. Nutr. Food Res. 2006, 50, 176–187. [Google Scholar] [CrossRef]
- Tan, X.; Sun, Z.; Ye, C. Dietary Lycium barbarum extract administration improved growth, meat quality and lipid metabolism in hybrid grouper (Epinephelus lanceolatus♂× E. fuscoguttatus♀) fed high lipid diets. Aquaculture 2019, 504, 190–198. [Google Scholar] [CrossRef]
- Rufino-Palomares, E.E.; Pérez-Jiménez, A.; García-Salguero, L.; Mokhtari, K.; Reyes-Zurita, F.J.; Peragón-Sánchez, J.; Lupiáñez, J.A. Nutraceutical Role of Polyphenols and Triterpenes Present in the Extracts of Fruits and Leaves of Olea europaea as Antioxidants, Anti-Infectives and Anticancer Agents on Healthy Growth. Molecules 2022, 27, 2341. [Google Scholar] [CrossRef] [PubMed]
- Bai, S.; Katya, K.; Yun, H. Additives in aquafeed: An overview. Feed. Feed. Pract. Aquac. 2015, 171–202. [Google Scholar] [CrossRef]
- Amro, B.; Aburjai, T.; Al-Khalil, S. Antioxidative and radical scavenging effects of olive cake extract. Fitoterapia 2002, 73, 456–461. [Google Scholar] [CrossRef] [PubMed]
- Ahmadi, A.; Bagheri, D.; Hoseinifar, S.H.; Morshedi, V.; Paolucci, M. Beneficial role of polyphenols as feed additives on growth performances, immune response and antioxidant status of Lates Calcarifer (Bloch, 1790) juveniles. Aquaculture 2022, 552, 737955. [Google Scholar] [CrossRef]
- Hasanpour, S.; Salati, A.P.; Falahatkar, B.; Azarm, H.M. Effects of dietary green tea (Camellia sinensis L.) supplementation on growth performance, lipid metabolism, and antioxidant status in a sturgeon hybrid of Sterlet (Huso huso♂× Acipenser ruthenus♀) fed oxidized fish oil. Fish Physiol. Biochem. 2017, 43, 1315–1323. [Google Scholar] [CrossRef]
Ingredients | HFM | HSB | HSB+P |
---|---|---|---|
Fishmeal a | 400 | 300 | 300 |
Soybean meal b | 155.7 | 309.7 | 309.7 |
Cottonseed protein concentrate | 50 | 50 | 50 |
Corn gluten meal | 80 | 80 | 80 |
Enzymolysis fishmeal soluble | 30 | 30 | 30 |
Wheat flour | 76.6 | 77.6 | 76.6 |
Cassava starch | 50 | 50 | 50 |
Fish oil | 19.2 | 24.2 | 24.2 |
Soybean oil | 60 | 60 | 60 |
Premix c | 14 | 14 | 14 |
Microcrystalline cellulose | 60 | 0 | 0.5 |
Choline chloride | 2 | 2 | 2 |
L-Lysine HCL | 2 | 2 | 2 |
L-Taurine | 0.5 | 0.5 | 0.5 |
Phytogenic supplement d | 0 | 0 | 0.5 |
Total | 1000 | 1000 | 1000 |
Analyzed chemical composition (%, in as is basis) | |||
Crude protein (DM) | 50.24 | 51.56 | 50.72 |
Crude lipid (DM) | 10.89 | 10.15 | 10.52 |
Ash | 8.50 | 8.33 | 7.90 |
Gross energy (MJ/kg) | 20.96 | 21.29 | 21.79 |
Gene | Primers | Sequence5′-3′ | Target Size (bp) | E-Value (%) | TM (°C) |
---|---|---|---|---|---|
ACC1 | F * | ATCCCTCTTTGCCACTGTTG | 121 | 102.2 | 57.5 |
R * | GAGGTGATGTTGCTCGCATA | ||||
ATGL | F | CCATGATGCTCCCCTACACT | 176 | 99.1 | 58.0 |
R | GGCAGATACACTTCGGGAAA | ||||
CPT1α | F | CATGGAAAGCCAGCCTTTAG | 128 | 98.8 | 60.0 |
R | GAGCACCAGACACGCTAACA | ||||
EF1α | F | TGCTGCTGGTGTTGGTGAGTT | 147 | 102.8 | 60.4 |
R | TTCTGGCTGTAAGGGGGCTC | ||||
FASN | F | TGTGGTGCTGAACTCTCTGG | 121 | 102.1 | 57.5 |
R | CATGCCTAGTGGGGAGTTGT | ||||
HSL | F | ATCAGAGCTGGAGCACCCTA | 122 | 99.3 | 60.0 |
R | GCAGAGGAGAGCAGAAAGGA | ||||
PPARα | F | CCACCGCAATGGTCGATATG | 144 | 104.3 | 59.0 |
R | TGCTGTTGATGGACTGGGAAA |
HFM | HSB | HSB+P | |
---|---|---|---|
Growth performance # | |||
IBW (g) | 48.34 ± 0.01 | ||
FBW (g) | 124.18 ± 5.31 a | 122.34 ± 3.82 a | 142.29± 5.95 b |
SR (%) | 100 ± 0.00 | 100 ± 0.00 | 100 ± 0.00 |
SGR (%/d) | 1.34 ± 0.06 a | 1.31 ± 0.04 a | 1.55 ± 0.06 b |
WGR (%) | 159.61 ± 11.01 a | 155.09 ± 7.89 a | 198.85 ± 12.30 b |
FCR | 1.27 ± 0.01 | 1.31 ± 0.05 | 1.22 ± 0.02 |
FR (%bw/d) | 1.37 ± 0.04 | 1.38 ± 0.01 | 1.38 ± 0.03 |
PRE (%) | 27.86 ± 0.93 ab | 25.23 ± 1.09 a | 29.02 ± 0.49 b |
Morphometric parameters * | |||
CF | 1.69 ± 0.02 | 1.75 ± 0.02 | 1.71 ± 0.04 |
HSI (%) | 1.74 ± 0.28 | 1.61 ± 0.58 | 1.59 ± 0.34 |
VSI (%) | 8.53 ± 0.25 | 8.27 ± 0.23 | 8.05 ± 0.22 |
VAI (%) | 3.63 ± 0.19 | 3.25 ± 0.11 | 3.16 ± 0.18 |
HFM | HSB | HSB+P | |
---|---|---|---|
Moisture (%) | 68.36 ± 0.49 | 68.80 ± 0.56 | 68.40 ± 0.57 |
Crude protein (%) | 17.03 ± 0.26 | 16.55 ± 0.28 | 17.03 ± 0.07 |
Crude lipid (%) | 8.51 ± 0.21 | 8.21 ± 0.27 | 8.03 ± 0.31 |
Ash (%) | 3.77 ± 0.17 | 3.98 ± 0.12 | 3.91 ± 0.10 |
Gross Energy (MJ/kg) | 8.22 ± 0.18 | 8.02 ± 0.19 | 8.11 ± 0.28 |
HFM | HSB | HSB+P | |
---|---|---|---|
Glu (mmol/L) | 4.90 ± 0.35 ab | 4.66 ± 0.31 a | 5.93 ± 0.44 b |
TC (mmol/L) | 8.79 ± 0.33 | 8.37 ± 0.81 | 7.06 ± 0.47 |
TG (mmol/L) | 6.69 ± 0.52 a | 10.11 ± 1.05 b | 6.35 ± 0.59 a |
LDL-C (mmol/L) | 0.99 ± 0.04 b | 1.31 ± 0.07 c | 0.72 ± 0.05 a |
HDL-C (mmol/L) | 2.86 ± 0.15 b | 2.20 ± 0.18 a | 2.71 ± 0.21 ab |
LDL-C/TC (%) | 11.36 ± 0.63 a | 16.46 ± 1.46 b | 10.62 ± 1.10 a |
HDL-C/TC (%) | 32.83 ± 2.12 | 27.67 ± 3.65 | 40.00 ± 4.47 |
TBA (μmol/L) | 5.26 ± 0.14 | 6.03 ± 0.46 | 5.26 ± 0.20 |
TP (g/L) | 22.78 ± 1.60 | 27.60 ± 1.73 | 24.63 ± 1.39 |
HFM | HSB | HSB+P | |
---|---|---|---|
AKP (U/g prot) | 229.90 ± 24.34 | 181.00 ± 28.46 | 245.77 ± 30.86 |
AST (U/g prot) | 21.62 ± 0.88 | 26.16 ± 3.91 | 24.79 ± 2.25 |
ALT(U/g prot) | 136.15 ± 14.72 | 113.54 ± 21.47 | 136.88 ± 12.58 |
TBA (μmol/g prot) | 2.96 ± 0.44 a | 5.96 ± 1.22 b | 2.68 ± 0.09 a |
TP (g prot/L) | 62.92 ± 2.55 | 57.00 ± 2.95 | 57.99 ± 1.92 |
HFM | HSB | HSB+P | |
---|---|---|---|
ROS (IU/mg prot) | 35.17 ± 1.63 a | 42.79 ± 2.79 b | 34.87 ± 1.34 a |
T-AOC (mmol/mg prot) | 106.89 ± 3.38 a | 127.06 ± 3.03 b | 105.55 ± 3.11 a |
T-SOD (U/mg prot) | 888.46 ± 24.77 | 866.97 ± 21.56 | 848.30 ± 18.86 |
CAT (U/mg prot) | 13.95 ± 0.88 a | 24.01 ± 1.06 b | 15.71 ± 1.25 a |
GSH-Px (U/mg prot) | 35.32 ± 1.22 b | 24.43 ± 1.56 a | 41.14 ± 1.24 c |
MDA (nmol/mg prot) | 0.76 ± 0.12 | 0.89 ± 0.12 | 0.80 ± 0.11 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Xue, M.; Morais, S.; He, M.; Wang, H.; Wang, J.; Pastor, J.J.; Gonçalves, R.A.; Liang, X. Effects of a Phytogenic Supplement Containing Olive By-Product and Green Tea Extracts on Growth Performance, Lipid Metabolism, and Hepatic Antioxidant Capacity in Largemouth Bass (Micropterus salmoides) Fed a High Soybean Meal Diet. Antioxidants 2022, 11, 2415. https://doi.org/10.3390/antiox11122415
Liu J, Xue M, Morais S, He M, Wang H, Wang J, Pastor JJ, Gonçalves RA, Liang X. Effects of a Phytogenic Supplement Containing Olive By-Product and Green Tea Extracts on Growth Performance, Lipid Metabolism, and Hepatic Antioxidant Capacity in Largemouth Bass (Micropterus salmoides) Fed a High Soybean Meal Diet. Antioxidants. 2022; 11(12):2415. https://doi.org/10.3390/antiox11122415
Chicago/Turabian StyleLiu, Jiacheng, Min Xue, Sofia Morais, Maolong He, Hao Wang, Jie Wang, Jose J. Pastor, Rui A. Gonçalves, and Xiaofang Liang. 2022. "Effects of a Phytogenic Supplement Containing Olive By-Product and Green Tea Extracts on Growth Performance, Lipid Metabolism, and Hepatic Antioxidant Capacity in Largemouth Bass (Micropterus salmoides) Fed a High Soybean Meal Diet" Antioxidants 11, no. 12: 2415. https://doi.org/10.3390/antiox11122415
APA StyleLiu, J., Xue, M., Morais, S., He, M., Wang, H., Wang, J., Pastor, J. J., Gonçalves, R. A., & Liang, X. (2022). Effects of a Phytogenic Supplement Containing Olive By-Product and Green Tea Extracts on Growth Performance, Lipid Metabolism, and Hepatic Antioxidant Capacity in Largemouth Bass (Micropterus salmoides) Fed a High Soybean Meal Diet. Antioxidants, 11(12), 2415. https://doi.org/10.3390/antiox11122415