Alpinumisoflavone Impairs Mitochondrial Respiration via Oxidative Stress and MAPK/PI3K Regulation in Hepatocellular Carcinoma Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Chemicals
2.2. Cell Culture
2.3. Detection of Cell Viability Based on Metabolic Activity
2.4. Hanging-Drop Assay for Spheroid Formation
2.5. Detection of a Proliferation Marker via Immunofluorescence
2.6. Western Blotting
2.7. JC-1 Staining Assay
2.8. Mito-Stress Assay Using the Seahorse XF-24 Analyzer
2.9. Real-Time Polymerase Chain Reaction (RT-PCR) Analysis
2.10. Rhod-2 Staining Assay
2.11. Measurement of Apoptotic Cell Population
2.12. Statistical Analysis
3. Results
3.1. Alpinumisoflavone Suppresses the Viability of Huh7 and Hep3B Cells
3.2. Alpinumisoflavone Regulates the MAPK/PI3K Pathways in HCC Cells
3.3. Interactions in the MAPK Signaling Pathway Are Altered by Alpinumisoflavone
3.4. Alterations in the MMP Caused by Alpinumisoflavone Elicited Energy Metabolism Disruption in HCC Cells
3.5. Alpinumisoflavone Regulated Mitochondrial Respiratory Chain Complex I, III, and V Related Genes in Human HCC Cells
3.6. Alpinumisoflavone Disrupts the Mitochondrial Calcium Homeostasis in HCC Cells
3.7. Alpinumisoflavone Induces Mitochondrial Apoptosis in Hep3B and Huh7 Cells
3.8. Combined Effect of Alpinumisoflavone and Sorafenib in Hep3B and Huh7 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Ioannou, G.N. Epidemiology and risk-stratification of NAFLD-associated HCC. J. Hepatol. 2021, 75, 1476–1484. [Google Scholar] [CrossRef]
- Fu, H.; Huang, L.; Xu, C.; Zhang, J.; Li, D.; Ding, L.; Liu, L.; Dong, Y.; Wang, W.; Duan, Y. Highly biocompatible thermosensitive nanocomposite gel for combined therapy of hepatocellular carcinoma via the enhancement of mitochondria related apoptosis. Nanomedicine 2019, 21, 102062. [Google Scholar] [CrossRef]
- Mendez-Blanco, C.; Fondevila, F.; Garcia-Palomo, A.; Gonzalez-Gallego, J.; Mauriz, J.L. Sorafenib resistance in hepatocarcinoma: Role of hypoxia-inducible factors. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef]
- Deng, L.J.; Qi, M.; Li, N.; Lei, Y.H.; Zhang, D.M.; Chen, J.X. Natural products and their derivatives: Promising modulators of tumor immunotherapy. J. Leukoc. Biol. 2020, 108, 493–508. [Google Scholar] [CrossRef]
- Song, J.; Song, G.; Park, S.; Lim, W. Inhibitory Effects of 6,8-Diprenylorobol on Endometriosis Progression in Humans by Disrupting Calcium Homeostasis and Mitochondrial Function. Antioxidants 2022, 11, 171. [Google Scholar] [CrossRef]
- Yang, C.; Bae, H.; Song, G.; Lim, W. Quercetin Affects Spermatogenesis-Related Genes of Mouse Exposed to High-Cholesterol Diet. J. Anim. Reprod. Biotechnol. 2020, 35, 73–85. [Google Scholar] [CrossRef]
- Choi, J.; Yang, C.; Lim, W.; Song, G.; Choi, H. Antioxidant and apoptotic activity of cocoa bean husk extract on prostate cancer cells. Mol. Cell Toxicol. 2022, 18, 193–203. [Google Scholar] [CrossRef]
- Ong, S.K.L.; Shanmugam, M.K.; Fan, L.; Fraser, S.E.; Arfuso, F.; Ahn, K.S.; Sethi, G.; Bishayee, A. Focus on Formononetin: Anticancer Potential and Molecular Targets. Cancers 2019, 11, 611. [Google Scholar] [CrossRef]
- Li, S.; Li, J.; Dai, W.; Zhang, Q.; Feng, J.; Wu, L.; Liu, T.; Yu, Q.; Xu, S.; Wang, W.; et al. Genistein suppresses aerobic glycolysis and induces hepatocellular carcinoma cell death. Br. J. Cancer 2017, 117, 1518–1528. [Google Scholar] [CrossRef]
- Abdel-Hamid, N.M.; Zakaria, S.; Nawaya, R.A.; Eldomany, R.A.; El-Shishtawy, M.M. Daidzein and chicory extract arrest the cell cycle via inhibition of cyclin D/CDK4 and cyclin A/CDK2 gene expression in hepatocellular carcinoma. Recent Pat. Anticancer Drug Discov. 2022. ahead of print. [Google Scholar] [CrossRef]
- Jo, M.J.; Jo, Y.H.; Lee, Y.J.; Park, C.W.; Kim, J.S.; Hong, J.T.; Chung, Y.B.; Lee, M.K.; Shin, D.H. Physicochemical, Pharmacokinetic, and Toxicity Evaluation of Methoxy Poly(ethylene glycol)-b-Poly(d,l-Lactide) Polymeric Micelles Encapsulating Alpinumisoflavone Extracted from Unripe Cudrania tricuspidata Fruit. Pharmaceutics 2019, 11, 366. [Google Scholar] [CrossRef]
- Ateba, S.B.; Mvondo, M.A.; Djiogue, S.; Zingue, S.; Krenn, L.; Njamen, D. A Pharmacological Overview of Alpinumisoflavone, a Natural Prenylated Isoflavonoid. Front. Pharmacol. 2019, 10, 952. [Google Scholar] [CrossRef]
- Mvondo, M.A.; Njamen, D.; Kretzschmar, G.; Imma Bader, M.; Tanee Fomum, S.; Wandji, J.; Vollmer, G. Alpinumisoflavone and abyssinone V 4’-methylether derived from Erythrina lysistemon (Fabaceae) promote HDL-cholesterol synthesis and prevent cholesterol gallstone formation in ovariectomized rats. J. Pharm. Pharmacol. 2015, 67, 990–996. [Google Scholar] [CrossRef]
- Zhang, B.; Fan, X.; Wang, Z.; Zhu, W.; Li, J. Alpinumisoflavone radiosensitizes esophageal squamous cell carcinoma through inducing apoptosis and cell cycle arrest. Biomed. Pharmacother. 2017, 95, 199–206. [Google Scholar] [CrossRef]
- Wang, T.; Jiang, Y.; Chu, L.; Wu, T.; You, J. Erratum: Alpinumisoflavone suppresses tumour growth and metastasis of clear-cell renal cell carcinoma. Am. J. Cancer Res. 2019, 9, 455–457. [Google Scholar]
- Hong, T.; Ham, J.; Song, G.; Lim, W. Alpinumisoflavone Disrupts Endoplasmic Reticulum and Mitochondria Leading to Apoptosis in Human Ovarian Cancer. Pharmaceutics 2022, 14, 564. [Google Scholar] [CrossRef]
- Song, J.; Ham, J.; Hong, T.; Song, G.; Lim, W. Fraxetin Suppresses Cell Proliferation and Induces Apoptosis through Mitochondria Dysfunction in Human Hepatocellular Carcinoma Cell Lines Huh7 and Hep3B. Pharmaceutics 2021, 13, 112. [Google Scholar] [CrossRef]
- Park, W.; Park, S.; Lim, W.; Song, G. Bifenthrin reduces pregnancy potential via induction of oxidative stress in porcine trophectoderm and uterine luminal epithelial cells. Sci. Total Environ. 2021, 784, 147143. [Google Scholar] [CrossRef]
- Hong, T.; Ham, J.; Song, J.; Song, G.; Lim, W. Brassinin Inhibits Proliferation in Human Liver Cancer Cells via Mitochondrial Dysfunction. Cells 2021, 10, 332. [Google Scholar] [CrossRef]
- Bae, H.; Yang, C.; Lee, J.Y.; Park, S.; Bazer, F.W.; Song, G.; Lim, W. Melatonin improves uterine-conceptus interaction via regulation of SIRT1 during early pregnancy. J. Pineal Res. 2020, 69, e12670. [Google Scholar] [CrossRef]
- Park, S.; Lim, W.; Bazer, F.W.; Whang, K.Y.; Song, G. Quercetin inhibits proliferation of endometriosis regulating cyclin D1 and its target microRNAs in vitro and in vivo. J. Nutr. Biochem. 2019, 63, 87–100. [Google Scholar] [CrossRef]
- Park, J.; An, G.; Lim, W.; Song, G. Dinitramine induces implantation failure by cell cycle arrest and mitochondrial dysfunction in porcine trophectoderm and luminal epithelial cells. J. Hazard. Mater. 2022, 435, 128927. [Google Scholar] [CrossRef]
- Lee, J.H.; Ku, J.L.; Park, Y.J.; Lee, K.U.; Kim, W.H.; Park, J.G. Establishment and characterization of four human hepatocellular carcinoma cell lines containing hepatitis B virus DNA. World J. Gastroenterol. 1999, 5, 289–295. [Google Scholar] [CrossRef]
- Kawamoto, M.; Yamaji, T.; Saito, K.; Shirasago, Y.; Satomura, K.; Endo, T.; Fukasawa, M.; Hanada, K.; Osada, N. Identification of Characteristic Genomic Markers in Human Hepatoma HuH-7 and Huh7.5.1-8 Cell Lines. Front. Genet. 2020, 11, 546106. [Google Scholar] [CrossRef]
- Lee, Y.R.; Park, S.Y. P53 expression in hepatocellular carcinoma: Influence on the radiotherapeutic response of the hepatocellular carcinoma. Clin. Mol. Hepatol. 2015, 21, 230–231. [Google Scholar] [CrossRef]
- Saini, K.S.; Loi, S.; de Azambuja, E.; Metzger-Filho, O.; Saini, M.L.; Ignatiadis, M.; Dancey, J.E.; Piccart-Gebhart, M.J. Targeting the PI3K/AKT/mTOR and Raf/MEK/ERK pathways in the treatment of breast cancer. Cancer Treat. Rev. 2013, 39, 935–946. [Google Scholar] [CrossRef]
- Song, J.-G.; Liu, L. Naringenin alleviates bone cancer pain in rats via down-regulating spinal P2 × 7R/PI3K/AKT signaling: Involving suppression in spinal inflammation. Mol. Cell. Toxicol. 2021, 17, 475–484. [Google Scholar] [CrossRef]
- Li, T.; Shi, H.; Zhao, Y. Acetaldehyde induces tau phosphorylation via activation of p38 MAPK/JNK and ROS production. Mol. Cell. Toxicol. 2022, 18, 311–320. [Google Scholar] [CrossRef]
- Moon, H.; Ro, S.W. MAPK/ERK Signaling Pathway in Hepatocellular Carcinoma. Cancers 2021, 13, 3026. [Google Scholar] [CrossRef]
- DuShane, J.K.; Maginnis, M.S. Human DNA Virus Exploitation of the MAPK-ERK Cascade. Int. J. Mol. Sci. 2019, 20, 3427. [Google Scholar] [CrossRef] [PubMed]
- Jindal, A.; Thadi, A.; Shailubhai, K. Hepatocellular Carcinoma: Etiology and Current and Future Drugs. J. Clin. Exp. Hepatol. 2019, 9, 221–232. [Google Scholar] [CrossRef] [PubMed]
- Alos, H.C.; Billones, J.B.; Vasquez, R.D.; Castillo, A.L. Antiangiogenesis Potential of Alpinumisoflavone as an Inhibitor of Matrix Metalloproteinase-9 (MMP-9) and Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2). Curr. Enzym. Inhib. 2019, 15, 159–178. [Google Scholar] [CrossRef]
- Zhu, A.X.; Kang, Y.K.; Yen, C.J.; Finn, R.S.; Galle, P.R.; Llovet, J.M.; Assenat, E.; Brandi, G.; Pracht, M.; Lim, H.Y.; et al. Ramucirumab after sorafenib in patients with advanced hepatocellular carcinoma and increased alpha-fetoprotein concentrations (REACH-2): A randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 2019, 20, 282–296. [Google Scholar] [CrossRef]
- Chen, X.; Ma, W.; Yao, Y.; Zhang, Q.; Li, J.; Wu, X.; Mei, C.; Jiang, X.; Chen, Y.; Wang, G.; et al. Serum deprivation-response protein induces apoptosis in hepatocellular carcinoma through ASK1-JNK/p38 MAPK pathways. Cell Death Dis. 2021, 12, 425. [Google Scholar] [CrossRef] [PubMed]
- Honma, Y.; Shimizu, S.; Takehara, T.; Harada, M. Sorafenib enhances proteasome inhibitor-induced cell death via inactivation of Akt and stress-activated protein kinases. J. Gastroenterol. 2014, 49, 517–526. [Google Scholar] [CrossRef]
- Wallace, D.C.; Fan, W.; Procaccio, V. Mitochondrial energetics and therapeutics. Annu. Rev. Pathol. 2010, 5, 297–348. [Google Scholar] [CrossRef]
- Rui, L. Energy metabolism in the liver. Compr. Physiol. 2014, 4, 177–197. [Google Scholar] [CrossRef]
- Fernandez-Vizarra, E.; Zeviani, M. Mitochondrial disorders of the OXPHOS system. FEBS Lett. 2021, 595, 1062–1106. [Google Scholar] [CrossRef]
- Palorini, R.; Simonetto, T.; Cirulli, C.; Chiaradonna, F. Mitochondrial complex I inhibitors and forced oxidative phosphorylation synergize in inducing cancer cell death. Int. J. Cell Biol. 2013, 2013, 243876. [Google Scholar] [CrossRef]
- Zhang, B.; Chu, W.; Wei, P.; Liu, Y.; Wei, T. Xanthohumol induces generation of reactive oxygen species and triggers apoptosis through inhibition of mitochondrial electron transfer chain complex I. Free Radic. Biol. Med. 2015, 89, 486–497. [Google Scholar] [CrossRef] [PubMed]
- Lai, R.K.; Xu, I.M.; Chiu, D.K.; Tse, A.P.; Wei, L.L.; Law, C.T.; Lee, D.; Wong, C.M.; Wong, M.P.; Ng, I.O.; et al. NDUFA4L2 Fine-tunes Oxidative Stress in Hepatocellular Carcinoma. Clin. Cancer Res. 2016, 22, 3105–3117. [Google Scholar] [CrossRef] [PubMed]
- Song, M.; Wu, H.; Wu, S.; Ge, T.; Wang, G.; Zhou, Y.; Sheng, S.; Jiang, J. Antibiotic drug levofloxacin inhibits proliferation and induces apoptosis of lung cancer cells through inducing mitochondrial dysfunction and oxidative damage. Biomed. Pharmacother. 2016, 84, 1137–1143. [Google Scholar] [CrossRef] [PubMed]
- Heslop, K.A.; Rovini, A.; Hunt, E.G.; Fang, D.; Morris, M.E.; Christie, C.F.; Gooz, M.B.; DeHart, D.N.; Dang, Y.; Lemasters, J.J.; et al. JNK activation and translocation to mitochondria mediates mitochondrial dysfunction and cell death induced by VDAC opening and sorafenib in hepatocarcinoma cells. Biochem. Pharmacol. 2020, 171, 113728. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Liu, Z.; Bunker, E.; Ramirez, A.; Lee, S.; Peng, Y.; Tan, A.C.; Eckhardt, S.G.; Chapnick, D.A.; Liu, X. Sorafenib targets the mitochondrial electron transport chain complexes and ATP synthase to activate the PINK1-Parkin pathway and modulate cellular drug response. J. Biol. Chem. 2017, 292, 15105–15120. [Google Scholar] [CrossRef]
- Bergeaud, M.; Mathieu, L.; Guillaume, A.; Moll, U.M.; Mignotte, B.; Le Floch, N.; Vayssiere, J.L.; Rincheval, V. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F(1)F0-ATP synthase. Cell Cycle 2013, 12, 2781–2793. [Google Scholar] [CrossRef]
- Matoba, S.; Kang, J.G.; Patino, W.D.; Wragg, A.; Boehm, M.; Gavrilova, O.; Hurley, P.J.; Bunz, F.; Hwang, P.M. p53 regulates mitochondrial respiration. Science 2006, 312, 1650–1653. [Google Scholar] [CrossRef]
- Omar, H.A.; Tolba, M.F.; Hung, J.H.; Al-Tel, T.H. OSU-2S/Sorafenib Synergistic Antitumor Combination against Hepatocellular Carcinoma: The Role of PKCdelta/p53. Front. Pharmacol. 2016, 7, 463. [Google Scholar] [CrossRef]
- Yang, C.; Song, J.; Hwang, S.; Choi, J.; Song, G.; Lim, W. Apigenin enhances apoptosis induction by 5-fluorouracil through regulation of thymidylate synthase in colorectal cancer cells. Redox Biol. 2021, 47, 102144. [Google Scholar] [CrossRef]
- Shin, S.B.; Woo, S.U.; Chin, Y.W.; Jang, Y.J.; Yim, H. Sensitivity of TP53-Mutated Cancer Cells to the Phytoestrogen Genistein Is Associated with Direct Inhibition of Plk1 Activity. J. Cell Physiol. 2017, 232, 2818–2828. [Google Scholar] [CrossRef]
- Blandino, G.; Valenti, F.; Sacconi, A.; Di Agostino, S. Wild type- and mutant p53 proteins in mitochondrial dysfunction: Emerging insights in cancer disease. Semin. Cell Dev. Biol. 2020, 98, 105–117. [Google Scholar] [CrossRef] [PubMed]
- Lemasters, J.J.; Theruvath, T.P.; Zhong, Z.; Nieminen, A.L. Mitochondrial calcium and the permeability transition in cell death. Biochim. Biophys. Acta 2009, 1787, 1395–1401. [Google Scholar] [CrossRef]
- Modica, T.M.E.; Dituri, F.; Mancarella, S.; Pisano, C.; Fabregat, I.; Giannelli, G. Calcium Regulates HCC Proliferation as well as EGFR Recycling/Degradation and Could Be a New Therapeutic Target in HCC. Cancers 2019, 11, 1588. [Google Scholar] [CrossRef] [PubMed]
- Rouleau, L.; Antony, A.N.; Bisetto, S.; Newberg, A.; Doria, C.; Levine, M.; Monti, D.A.; Hoek, J.B. Synergistic effects of ascorbate and sorafenib in hepatocellular carcinoma: New insights into ascorbate cytotoxicity. Free Radic. Biol. Med. 2016, 95, 308–322. [Google Scholar] [CrossRef] [PubMed]
Antibody | Catalog No. | Source |
---|---|---|
p-ERK1/2 (Thr202/Tyr204) | 9101 | Cell Signaling Technology |
P70S6K (Thr421/Ser424) | 9204 | Cell Signaling Technology |
p-S6 (Ser235/236) | 2211 | Cell Signaling Technology |
p-JNK (Thr183/Tyr185) | 4668 | Cell Signaling Technology |
p-P38(Thr180/Tyr182) | 4511 | Cell Signaling Technology |
p-P90RSK(Thr573) | 9346 | Cell Signaling Technology |
t-ERK1/2 | 4695 | Cell Signaling Technology |
t-P70S6K | 9202 | Cell Signaling Technology |
t-S6 | 2217 | Cell Signaling Technology |
t-JNK | 9252 | Cell Signaling Technology |
t-P38 | 9212 | Cell Signaling Technology |
BAK | 12105 | Cell Signaling Technology |
Bcl-xL | 2764 | Cell Signaling Technology |
TUBA | Sc-32293 | Santa Cruz Biotechnology |
Gene Symbol | GenBank Accession No. | Forward Primer (5′→3′) | Reverse Primer (3′→5′) |
---|---|---|---|
NDUFS3 | NM_004551.3 | CTTTCCTCAGGGATCACACC | GAAGCGCAGAGACAACAGG |
NDUFS4 | NM_001318051.2 | TACTGAGGCAGACGTTGTGG | TCTTGAGTCTGGTCCTGTGC |
NUDFS5 | NM_001184979.2 | TGAACAGCCCTACAAGATGG | GCCCGAGTATAACCGATTCC |
NDUFS8 | NM_002496.4 | CGCTATGACATCGACATGACC | TGTACAGCAGCTCCTCATGG |
MT-ND1 | NC_012920.1 | TAGCAGAGACCAACCGAACC | GGCGTATTCGATGTTGAAGC |
MT-ND2 | NC_012920.1 | CCGGACAATGAACCATAACC | CTGGGACTCAGAAGTGAAAGG |
MT-ND3 | NC_012920.1 | AATCCACCCCTTACGAGTGC | GCTCATGGTAGGGGTAAAAGG |
MT-ND4L | NC_012920.1 | TCGCTCACACCTCATATCC | CGGCAAAGACTAGTATGGC |
MT-ND5 | NC_012920.1 | CGCTATCACCACTCTGTTCG | GGAATGCTAGGTGTGGTTGG |
UQCRQ | NM_014402.5 | GGAACCTCTCATCTGCTTCG | AGCTGGATTCTTCCTCTTGG |
UQCRFS1 | NM_006003.3 | GCTTCTGCTGATGTGTTGG | CCTGCTCAATTTCCTTCTGG |
MT-CYB | NC_012920.1 | ACTACAACCCTTCGCTGACG | AGAAGAGCGATGGTGAGAGC |
ATP5FIB | NM_001686.4 | TCCTGTTGGTCCTGGACTT | ATGAACTCTGGAGCCTCAGC |
ATP5FIC | NM_001001973.3 | TGCTATTCTTCCTCCATTGC | TGTCACCAATTCCAACAAGC |
ATP5MC3 | NM_001002258.5 | TTCGACCAGTGCAATCAGC | CCAATACCAGCACCAGAACC |
ATP5ME | NM_007100.4 | TGTTCCTCGGTGTGGCCTA | CTGCTGCTATCCTCCTCTCC |
ATP5PD | NM_001003785.2 | CTGAGAATCCACCAGCTATCG | TGGCCTTTGAGAGAGACACC |
ATP5PO | NM_001697.3 | ATCCCTATGTGAAGCGTTCC | AACGACTCCTTGGGTATTGC |
GAPDH | NM_001206359.1 | CAATGACCCCTTCATTGACC | ATCACCCCATTTGATGTTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, H.; Ham, J.; Song, J.; Song, G.; Lim, W. Alpinumisoflavone Impairs Mitochondrial Respiration via Oxidative Stress and MAPK/PI3K Regulation in Hepatocellular Carcinoma Cells. Antioxidants 2022, 11, 1929. https://doi.org/10.3390/antiox11101929
Jang H, Ham J, Song J, Song G, Lim W. Alpinumisoflavone Impairs Mitochondrial Respiration via Oxidative Stress and MAPK/PI3K Regulation in Hepatocellular Carcinoma Cells. Antioxidants. 2022; 11(10):1929. https://doi.org/10.3390/antiox11101929
Chicago/Turabian StyleJang, Hyewon, Jiyeon Ham, Jisoo Song, Gwonhwa Song, and Whasun Lim. 2022. "Alpinumisoflavone Impairs Mitochondrial Respiration via Oxidative Stress and MAPK/PI3K Regulation in Hepatocellular Carcinoma Cells" Antioxidants 11, no. 10: 1929. https://doi.org/10.3390/antiox11101929
APA StyleJang, H., Ham, J., Song, J., Song, G., & Lim, W. (2022). Alpinumisoflavone Impairs Mitochondrial Respiration via Oxidative Stress and MAPK/PI3K Regulation in Hepatocellular Carcinoma Cells. Antioxidants, 11(10), 1929. https://doi.org/10.3390/antiox11101929