Ginsenoside CK Inhibits the Early Stage of Adipogenesis via the AMPK, MAPK, and AKT Signaling Pathways
Abstract
:1. Introduction
2. Materials and Methods
2.1. Antibodies and Other Reagents
2.2. Cell Culture and Adipocyte Differentiation
2.3. Cell Viability Assay
2.4. Cytotoxicity Assay
2.5. Oil Red O Staining and Quantification
2.6. RNA Isolation and Quantitative Reverse Transcription (qRT)-PCR
2.7. Western Blot Analysis
2.8. Immunofluorescence Cell Staining
2.9. Determination of Intracellular ROS Generation
2.10. BODIPY Staining of Neutral Lipid Droplets (LDs)
2.11. Statistical Analysis
3. Results
3.1. CK Inhibits Lipid Accumulation during the Early Phase of 3T3-L1 Adipogenesis
3.2. CK Inhibits the Expression of Adipogenic Marker Genes in Mature 3T3-L1 Adipocytes
3.3. CK Inhibits ROS Production by Regulating the Expression of Anti-Oxidant Enzymes in Mature 3T3-L1 Adipocytes
3.4. CK Inhibits the Mitotic Clonal Expansion (MCE) Process in 3T3-L1 Pre-Adipocytes
3.5. CK Inhibits AKT/ERK/P38 Signaling in Differentiation of 3T3-L1 Cells
3.6. CK Inhibits Lipogenesis of 3T3-L1 Adipocytes via Suppression of PPAR-γ Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- De Lorenzo, A.; Romano, L.; Di Renzo, L.; Di Lorenzo, N.; Cenname, G.; Gualtieri, P. Obesity: A preventable, treatable, but relapsing disease. Nutrition 2020, 71, 110615. [Google Scholar] [CrossRef]
- Kopelman, P.G. Obesity as a medical problem. Nature 2000, 404, 635–643. [Google Scholar] [CrossRef] [PubMed]
- Ertunc, M.E.; Hotamisligil, G.S. Lipid signaling and lipotoxicity in metaflammation: Indications for metabolic disease pathogenesis and treatment. J. Lipid Res. 2016, 57, 2099–2114. [Google Scholar] [CrossRef]
- Kim, S.H.; Despres, J.P.; Koh, K.K. Obesity and cardiovascular disease: Friend or foe? Eur. Heart J. 2016, 37, 3560–3568. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, S.; Manabe, I.; Nagasaki, M.; Hosoya, Y.; Yamashita, H.; Fujita, H.; Ohsugi, M.; Tobe, K.; Kadowaki, T.; Nagai, R.; et al. Adipogenesis in obesity requires close interplay between differentiating adipocytes, stromal cells, and blood vessels. Diabetes 2007, 56, 1517–1526. [Google Scholar] [CrossRef] [PubMed]
- Haczeyni, F.; Bell-Anderson, K.S.; Farrell, G.C. Causes and mechanisms of adipocyte enlargement and adipose expansion. Obes. Rev. 2018, 19, 406–420. [Google Scholar] [CrossRef]
- Marseglia, L.; Manti, S.; D’Angelo, G.; Nicotera, A.; Parisi, E.; Di Rosa, G.; Gitto, E.; Arrigo, T. Oxidative stress in obesity: A critical component in human diseases. Int. J. Mol. Sci. 2014, 16, 378–400. [Google Scholar] [CrossRef]
- Masschelin, P.M.; Cox, A.R.; Chernis, N.; Hartig, S.M. The Impact of Oxidative Stress on Adipose Tissue Energy Balance. Front. Physiol. 2020, 10, 1638. [Google Scholar] [CrossRef]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive Oxygen Species in Metabolic and Inflammatory Signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef]
- Furukawa, S.; Fujita, T.; Shimabukuro, M.; Iwaki, M.; Yamada, Y.; Nakajima, Y.; Nakayama, O.; Makishima, M.; Matsuda, M.; Shimomura, I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Investig. 2004, 114, 1752–1761. [Google Scholar] [CrossRef]
- Frohnert, B.I.; Sinaiko, A.R.; Serrot, F.J.; Foncea, R.E.; Moran, A.; Ikramuddin, S.; Choudry, U.; Bernlohr, D.A. Increased adipose protein carbonylation in human obesity. Obesity 2011, 19, 1735–1741. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Ojeda, F.J.; Ruperez, A.I.; Gomez-Llorente, C.; Gil, A.; Aguilera, C.M. Cell Models and Their Application for Studying Adipogenic Differentiation in Relation to Obesity: A Review. Int. J. Mol. Sci. 2016, 17, 1040. [Google Scholar] [CrossRef] [PubMed]
- Morrison, S.; McGee, S.L. 3T3-L1 adipocytes display phenotypic characteristics of multiple adipocyte lineages. Adipocyte 2015, 4, 295–302. [Google Scholar] [CrossRef] [PubMed]
- Gregoire, F.M.; Smas, C.M.; Sul, H.S. Understanding adipocyte differentiation. Physiol. Rev. 1998, 78, 783–809. [Google Scholar] [CrossRef] [PubMed]
- Scott, R.E.; Florine, D.L.; Wille, J.J., Jr.; Yun, K. Coupling of growth arrest and differentiation at a distinct state in the G1 phase of the cell cycle: GD. Proc. Natl. Acad. Sci. USA 1982, 79, 845–849. [Google Scholar] [CrossRef] [PubMed]
- Ali, A.T.; Hochfeld, W.E.; Myburgh, R.; Pepper, M.S. Adipocyte and adipogenesis. Eur. J. Cell Biol. 2013, 92, 229–236. [Google Scholar] [CrossRef]
- Moseti, D.; Regassa, A.; Kim, W.K. Molecular Regulation of Adipogenesis and Potential Anti-Adipogenic Bioactive Molecules. Int. J. Mol. Sci. 2016, 17, 124. [Google Scholar] [CrossRef]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef]
- Hardie, D.G. AMPK and Raptor: Matching cell growth to energy supply. Mol. Cell 2008, 30, 263–265. [Google Scholar] [CrossRef] [PubMed]
- Xiao, B.; Sanders, M.J.; Underwood, E.; Heath, R.; Mayer, F.V.; Carmena, D.; Jing, C.; Walker, P.A.; Eccleston, J.F.; Haire, L.F.; et al. Structure of mammalian AMPK and its regulation by ADP. Nature 2011, 472, 230–233. [Google Scholar] [CrossRef] [Green Version]
- Carling, D. The AMP-activated protein kinase cascade--a unifying system for energy control. Trends Biochem. Sci. 2004, 29, 18–24. [Google Scholar] [CrossRef]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [PubMed]
- Jeon, S.M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.Y.; Lee, M.H.; Hsu, C.C.; Wei, C.L.; Tsai, Y.C. Methyl cinnamate inhibits adipocyte differentiation via activation of the CaMKK2-AMPK pathway in 3T3-L1 preadipocytes. J. Agric. Food Chem. 2012, 60, 955–963. [Google Scholar] [CrossRef] [PubMed]
- Huang, B.; Yuan, H.D.; Kim, D.Y.; Quan, H.Y.; Chung, S.H. Cinnamaldehyde prevents adipocyte differentiation and adipogenesis via regulation of peroxisome proliferator-activated receptor-gamma (PPARgamma) and AMP-activated protein kinase (AMPK) pathways. J. Agric. Food Chem. 2011, 59, 3666–3673. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ji, G.E. Ginseng and obesity. J. Ginseng Res. 2018, 42, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Lee, H.J. Ginsenoside Compound K: Insights into Recent Studies on Pharmacokinetics and Health-Promoting Activities. Biomolecules 2020, 10, 1028. [Google Scholar] [CrossRef]
- Wang, B.; Dong, J.; Xu, J.; Qiu, Z.; Yao, F. Ginsenoside CK inhibits obese insulin resistance by activating PPARgamma to interfere with macrophage activation. Microb. Pathog. 2021, 157, 105002. [Google Scholar] [CrossRef]
- Huang, Y.C.; Lin, C.Y.; Huang, S.F.; Lin, H.C.; Chang, W.L.; Chang, T.C. Effect and mechanism of ginsenosides CK and Rg1 on stimulation of glucose uptake in 3T3-L1 adipocytes. J. Agric. Food Chem. 2010, 58, 6039–6047. [Google Scholar] [CrossRef]
- Park, D.; Yoon, M. Compound K, a novel ginsenoside metabolite, inhibits adipocyte differentiation in 3T3-L1 cells: Involvement of angiogenesis and MMPs. Biochem. Biophys. Res. Commun. 2012, 422, 263–267. [Google Scholar] [CrossRef] [PubMed]
- Ntambi, J.M.; Young-Cheul, K. Adipocyte differentiation and gene expression. J. Nutr. 2000, 130, 3122S–3126S. [Google Scholar] [CrossRef] [PubMed]
- Oh, J.M.; Kim, E.; Chun, S. Ginsenoside Compound K Induces Ros-Mediated Apoptosis and Autophagic Inhibition in Human Neuroblastoma Cells In Vitro and In Vivo. Int. J. Mol. Sci. 2019, 20, 4279. [Google Scholar] [CrossRef]
- Qiu, B.; Simon, M.C. BODIPY 493/503 Staining of Neutral Lipid Droplets for Microscopy and Quantification by Flow Cytometry. Bio-Protocol 2016, 6, e1912. [Google Scholar] [CrossRef] [PubMed]
- Walther, T.C.; Farese, R.V., Jr. Lipid droplets and cellular lipid metabolism. Annu. Rev. Biochem. 2012, 81, 687–714. [Google Scholar] [CrossRef] [PubMed]
- Mallela, S.K.; Patel, D.M.; Ducasa, G.M.; Merscher, S.; Fornoni, A.; Al-Ali, H. Detection and Quantification of Lipid Droplets in Differentiated Human Podocytes. Methods Mol. Biol. 2019, 1996, 199–206. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Zhang, X.; Liu, P. Lipid droplet proteins and metabolic diseases. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 1968–1983. [Google Scholar] [CrossRef] [PubMed]
- Chung, Y.C.; Hyun, C.G. Inhibitory Effects of Pinostilbene on Adipogenesis in 3T3-L1 Adipocytes: A Study of Possible Mechanisms. Int. J. Mol. Sci. 2021, 22, 13446. [Google Scholar] [CrossRef]
- Chang, E.; Kim, C.Y. Natural Products and Obesity: A Focus on the Regulation of Mitotic Clonal Expansion during Adipogenesis. Molecules 2019, 24, 1157. [Google Scholar] [CrossRef]
- Kim, B.Y.; Kang, S.M.; Kang, J.H.; Kim, K.K.; Kim, B.; Kim, S.J.; Kim, Y.H.; Kim, J.H.; Kim, J.H.; Nam, G.E.; et al. Committee of Clinical Practice Guidelines, Korean Society for the Study of Obesity (KSSO). Current Long-Term Pharmacotherapies for the Management of Obesity. J. Obes. Metab. Syndr. 2020, 29, 99–109. [Google Scholar] [CrossRef]
- Zhang, L.; Virgous, C.; Si, H. Ginseng and obesity: Observations and understanding in cultured cells, animals and humans. J. Nutr. Biochem. 2017, 44, 1–10. [Google Scholar] [CrossRef]
- Lee, J.E.; Schmidt, H.; Lai, B.; Ge, K. Transcriptional and Epigenomic Regulation of Adipogenesis. Mol. Cell Biol. 2019, 39, e00601-18. [Google Scholar] [CrossRef]
- Kim, J.B.; Wright, H.M.; Wright, M.; Spiegelman, B.M. ADD1/SREBP1 activates PPARgamma through the production of endogenous ligand. Proc. Natl. Acad. Sci. USA 1998, 95, 4333–4337. [Google Scholar] [CrossRef]
- Arita, Y.; Kihara, S.; Ouchi, N.; Takahashi, M.; Maeda, K.; Miyagawa, J.; Hotta, K.; Shimomura, I.; Nakamura, T.; Miyaoka, K.; et al. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem. Biophys. Res. Commun. 1999, 257, 79–83. [Google Scholar] [CrossRef]
- Lindsay, R.S.; Funahashi, T.; Hanson, R.L.; Matsuzawa, Y.; Tanaka, S.; Tataranni, P.A.; Knowler, W.C.; Krakoff, J. Adiponectin and development of type 2 diabetes in the Pima Indian population. Lancet 2002, 360, 57–58. [Google Scholar] [CrossRef]
- Lindsay, R.S.; Funahashi, T.; Krakoff, J.; Matsuzawa, Y.; Tanaka, S.; Kobes, S.; Bennett, P.H.; Tataranni, P.A.; Knowler, W.C.; Hanson, R.L. Genome-wide linkage analysis of serum adiponectin in the Pima Indian population. Diabetes 2003, 52, 2419–2425. [Google Scholar] [CrossRef] [PubMed]
- Hotta, K.; Funahashi, T.; Bodkin, N.L.; Ortmeyer, H.K.; Arita, Y.; Hansen, B.C.; Matsuzawa, Y. Circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type 2 diabetes in rhesus monkeys. Diabetes 2001, 50, 1126–1133. [Google Scholar] [CrossRef]
- Weyer, C.; Funahashi, T.; Tanaka, S.; Hotta, K.; Matsuzawa, Y.; Pratley, R.E.; Tataranni, P.A. Hypoadiponectinemia in obesity and type 2 diabetes: Close association with insulin resistance and hyperinsulinemia. J. Clin. Endocrinol. Metab. 2001, 86, 1930–1935. [Google Scholar] [CrossRef]
- Fu, Y.; Luo, N.; Klein, R.L.; Garvey, W.T. Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. J. Lipid Res. 2005, 46, 1369–1379. [Google Scholar] [CrossRef]
- Fruebis, J.; Tsao, T.S.; Javorschi, S.; Ebbets-Reed, D.; Erickson, M.R.; Yen, F.T.; Bihain, B.E.; Lodish, H.F. Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc. Natl. Acad. Sci. USA 2001, 98, 2005–2010. [Google Scholar] [CrossRef] [PubMed]
- Yamauchi, T.; Kamon, J.; Waki, H.; Terauchi, Y.; Kubota, N.; Hara, K.; Mori, Y.; Ide, T.; Murakami, K.; Tsuboyama-Kasaoka, N.; et al. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat. Med. 2001, 7, 941–946. [Google Scholar] [CrossRef] [PubMed]
- Berg, A.H.; Combs, T.P.; Du, X.; Brownlee, M.; Scherer, P.E. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat. Med. 2001, 7, 947–953. [Google Scholar] [CrossRef] [PubMed]
- Sulston, R.J.; Learman, B.S.; Zhang, B.; Scheller, E.L.; Parlee, S.D.; Simon, B.R.; Mori, H.; Bree, A.J.; Wallace, R.J.; Krishnan, V.; et al. Increased Circulating Adiponectin in Response to Thiazolidinediones: Investigating the Role of Bone Marrow Adipose Tissue. Front. Endocrinol. 2016, 7, 128. [Google Scholar] [CrossRef] [PubMed]
- Brownlee, M. Biochemistry and molecular cell biology of diabetic complications. Nature 2001, 414, 813–820. [Google Scholar] [CrossRef] [PubMed]
- Sena, L.A.; Chandel, N.S. Physiological roles of mitochondrial reactive oxygen species. Mol. Cell 2012, 48, 158–167. [Google Scholar] [CrossRef] [PubMed]
- Rani, V.; Deep, G.; Singh, R.K.; Palle, K.; Yadav, U.C. Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci. 2016, 148, 183–193. [Google Scholar] [CrossRef]
- Liu, G.S.; Chan, E.C.; Higuchi, M.; Dusting, G.J.; Jiang, F. Redox mechanisms in regulation of adipocyte differentiation: Beyond a general stress response. Cells 2012, 1, 976–993. [Google Scholar] [CrossRef]
- Lee, H.; Lee, Y.J.; Choi, H.; Ko, E.H.; Kim, J.W. Reactive oxygen species facilitate adipocyte differentiation by accelerating mitotic clonal expansion. J. Biol. Chem. 2009, 284, 10601–10609. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Zhang, Y.; Lu, W.; Liu, K. Mitochondrial reactive oxygen species regulate adipocyte differentiation of mesenchymal stem cells in hematopoietic stress induced by arabinosylcytosine. PLoS ONE 2015, 10, e0120629. [Google Scholar] [CrossRef]
- Tun, S.; Spainhower, C.J.; Cottrill, C.L.; Lakhani, H.V.; Pillai, S.S.; Dilip, A.; Chaudhry, H.; Shapiro, J.I.; Sodhi, K. Therapeutic Efficacy of Antioxidants in Ameliorating Obesity Phenotype and Associated Comorbidities. Front. Pharmacol. 2020, 11, 1234. [Google Scholar] [CrossRef]
- Calzadilla, P.; Sapochnik, D.; Cosentino, S.; Diz, V.; Dicelio, L.; Calvo, J.C.; Guerra, L.N. N-acetylcysteine reduces markers of differentiation in 3T3-L1 adipocytes. Int. J. Mol. Sci. 2011, 12, 6936–6951. [Google Scholar] [CrossRef] [Green Version]
- Zaragoza, A.; Diez-Fernandez, C.; Alvarez, A.M.; Andres, D.; Cascales, M. Effect of N-acetylcysteine and deferoxamine on endogenous antioxidant defense system gene expression in a rat hepatocyte model of cocaine cytotoxicity. Biochim. Biophys. Acta 2000, 1496, 183–195. [Google Scholar] [CrossRef]
- de Andrade, K.Q.; Moura, F.A.; dos Santos, J.M.; de Araujo, O.R.; de Farias Santos, J.C.; Goulart, M.O. Oxidative Stress and Inflammation in Hepatic Diseases: Therapeutic Possibilities of N-Acetylcysteine. Int. J. Mol. Sci. 2015, 16, 30269–30308. [Google Scholar] [CrossRef] [PubMed]
- Finkel, T. Signal transduction by reactive oxygen species. J. Cell Biol. 2011, 194, 7–15. [Google Scholar] [CrossRef] [PubMed]
- Miao, L.; St Clair, D.K. Regulation of superoxide dismutase genes: Implications in disease. Free Radic. Biol. Med. 2009, 47, 344–356. [Google Scholar] [CrossRef] [PubMed]
- Perriotte-Olson, C.; Adi, N.; Manickam, D.S.; Westwood, R.A.; Desouza, C.V.; Natarajan, G.; Crook, A.; Kabanov, A.V.; Saraswathi, V. Nanoformulated copper/zinc superoxide dismutase reduces adipose inflammation in obesity. Obesity 2016, 24, 148–156. [Google Scholar] [CrossRef]
- Cui, R.; Gao, M.; Qu, S.; Liu, D. Overexpression of superoxide dismutase 3 gene blocks high-fat diet-induced obesity, fatty liver and insulin resistance. Gene Ther. 2014, 21, 840–848. [Google Scholar] [CrossRef] [PubMed]
- Leiva, M.; Matesanz, N.; Pulgarin-Alfaro, M.; Nikolic, I.; Sabio, G. Uncovering the Role of p38 Family Members in Adipose Tissue Physiology. Front. Endocrinol. 2020, 11, 572089. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Sakamoto, K. (-)-Epigallocatechin gallate suppresses adipocyte differentiation through the MEK/ERK and PI3K/Akt pathways. Cell Biol. Int. 2012, 36, 147–153. [Google Scholar] [CrossRef]
- Prusty, D.; Park, B.H.; Davis, K.E.; Farmer, S.R. Activation of MEK/ERK signaling promotes adipogenesis by enhancing peroxisome proliferator-activated receptor gamma (PPARgamma) and C/EBPalpha gene expression during the differentiation of 3T3-L1 preadipocytes. J. Biol. Chem. 2002, 277, 46226–46232. [Google Scholar] [CrossRef] [PubMed]
- Belmonte, N.; Phillips, B.W.; Massiera, F.; Villageois, P.; Wdziekonski, B.; Saint-Marc, P.; Nichols, J.; Aubert, J.; Saeki, K.; Yuo, A.; et al. Activation of extracellular signal-regulated kinases and CREB/ATF-1 mediate the expression of CCAAT/enhancer binding proteins beta and -delta in preadipocytes. Mol. Endocrinol. 2001, 15, 2037–2049. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engelman, J.A.; Lisanti, M.P.; Scherer, P.E. Specific inhibitors of p38 mitogen-activated protein kinase block 3T3-L1 adipogenesis. J. Biol. Chem. 1998, 273, 32111–32120. [Google Scholar] [CrossRef] [PubMed]
- Aouadi, M.; Jager, J.; Laurent, K.; Gonzalez, T.; Cormont, M.; Binetruy, B.; Le Marchand-Brustel, Y.; Tanti, J.F.; Bost, F. p38MAP Kinase activity is required for human primary adipocyte differentiation. FEBS Lett. 2007, 581, 5591–5596. [Google Scholar] [CrossRef] [PubMed]
- Magun, R.; Burgering, B.M.; Coffer, P.J.; Pardasani, D.; Lin, Y.; Chabot, J.; Sorisky, A. Expression of a constitutively activated form of protein kinase B (c-Akt) in 3T3-L1 preadipose cells causes spontaneous differentiation. Endocrinology 1996, 137, 3590–3593. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; Reuss, L.; Wang, Y. Potential of Natural Products in the Inhibition of Adipogenesis through Regulation of PPARgamma Expression and/or Its Transcriptional Activity. Molecules 2016, 21, 1278. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
Gapdh | NM_001411845.1 | CTCGTGGAGTCTACTGGTGT | GTCATCATACTTGGCAGGTT |
Ppar-γ | U01664.1 | CAGCCTTTAACGAAATGACCA | TGTGGAGTAGAAATGCTGGA |
C/ebpα | NM_001287523.1 | AAACAACGCAACGTGGAGA | GCGGTCATTGTCACTGGTC |
Fabp4 | NM_001409513.1 | TGATGATCATGTTAGGTTTGGC | TGGAAACTTGTCTCCAGTGAA |
Srebp1 | AF374266.1 | CTGGTCTACCATAAGCTGCAC | GACTGGTCTTCACTCTCAATG |
Adipoq | NM_009605.5 | GGAGAGAAAGGAGATGCAGGT | CTTTCCTGCCAGGGGTTC |
Catalase | M62897.1 | TCC GGG ATC TTT TTA ACG CCA TTG | TCG AGC ACG GTA GGG ACA GTT CAC |
Gpx | NM_001329527.1 | GGGCAAGGTGCTGCTCATTG | AGAGCGGGTGAGCCTTCTCA |
GR | BC057325.1 | CACGACCATGATTCCAGATG | CAGCATAGACGCCTTTGACA |
SOD2 | NM_013671.3 | GGGTTGGCTTGGTTTCAATA | AGGTAGTAAGCGTGCTCCCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oh, J.-M.; Chun, S. Ginsenoside CK Inhibits the Early Stage of Adipogenesis via the AMPK, MAPK, and AKT Signaling Pathways. Antioxidants 2022, 11, 1890. https://doi.org/10.3390/antiox11101890
Oh J-M, Chun S. Ginsenoside CK Inhibits the Early Stage of Adipogenesis via the AMPK, MAPK, and AKT Signaling Pathways. Antioxidants. 2022; 11(10):1890. https://doi.org/10.3390/antiox11101890
Chicago/Turabian StyleOh, Jung-Mi, and Sungkun Chun. 2022. "Ginsenoside CK Inhibits the Early Stage of Adipogenesis via the AMPK, MAPK, and AKT Signaling Pathways" Antioxidants 11, no. 10: 1890. https://doi.org/10.3390/antiox11101890
APA StyleOh, J.-M., & Chun, S. (2022). Ginsenoside CK Inhibits the Early Stage of Adipogenesis via the AMPK, MAPK, and AKT Signaling Pathways. Antioxidants, 11(10), 1890. https://doi.org/10.3390/antiox11101890