Sodium Thiosulfate Improves Hypertension in Rats with Adenine-Induced Chronic Kidney Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Model and Care
2.2. Analysis of Plasma Hydrogen Sulfide and Thiosulfate Levels
2.3. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
2.4. Western Blot
2.5. Determination of Nitric Oxide Parameters
2.6. Statistical Analysis
3. Results
3.1. Body Weight and Blood Pressure of Male Offspring
3.2. H2S Pathway
3.3. NO Pathway
3.4. Renin-Angiotensin System
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kimura, H. The physiological role of hydrogen sulfide and beyond. Nitric Oxide 2014, 41, 4–10. [Google Scholar] [CrossRef] [PubMed]
- Feliers, D.; Lee, H.J.; Kasinath, B.S. Hydrogen sulfide in renal physiology and disease. Antioxid. Redox Signal. 2016, 25, 720–731. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lozano, R.; Naghavi, M.; Foreman, K.; Lim, S.; Shibuya, K.; Aboyans, V.; Abraham, J.; Adair, T.; Aggarwal, R.; Ahn, S.Y.; et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: A systematic analysis for the Global Burden of Disease Study 2010. Lancet 2012, 380, 2095–2128. [Google Scholar] [CrossRef]
- Scammahorn, J.J.; Nguyen, I.T.N.; Bos, E.M.; Van Goor, H.; Joles, J.A. Fighting oxidative stress with sulfur: Hydrogen sulfide in the renal and cardiovascular systems. Antioxidants 2021, 10, 373. [Google Scholar] [CrossRef]
- Wilcox, C.S. Oxidative stress and nitric oxide deficiency in the kidney: A critical link to hypertension? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 289, R913–R935. [Google Scholar] [CrossRef]
- Hsu, C.N.; Tain, Y.L. Gasotransmitters for the therapeutic prevention of hypertension and kidney disease. Int. J. Mol. Sci. 2021, 22, 7808. [Google Scholar] [CrossRef] [PubMed]
- Wen, Y.D.; Wang, H.; Zhu, Y.Z. The Drug developments of hydrogen sulfide on cardiovascular disease. Oxid. Med. Cell. Longev. 2018, 2018, 1–21. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.N.; Lin, Y.J.; Lu, P.C.; Tain, Y.L. Early supplementation of D-cysteine or L-cysteine prevents hypertension and kidney damage in spontaneously hypertensive rats exposed to high-salt intake. Mol. Nutr. Food Res. 2018, 62, 2. [Google Scholar] [CrossRef]
- Olson, K.R.; Deleon, E.R.; Gao, Y.; Hurley, K.; Sadauskas, V.; Batz, C.; Stoy, G.F. Thiosulfate: A readily accessible source of hydrogen sulfide in oxygen sensing. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 305, R592–R603. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, I.T.N.; Klooster, A.; Minnion, M.; Feelisch, M.; Verhaar, M.C.; van Goor, H.; Joles, J.A. Sodium thiosulfate improves renal function and oxygenation in L-NNA-induced hypertension in rats. Kidney Int. 2020, 98, 366–377. [Google Scholar] [CrossRef]
- Diwan, V.; Brown, L.; Gobe, G.C. Adenine-induced chronic kidney disease in rats. Nephrology 2018, 23, 5–11. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal adenine-induced chronic kidney disease programs hypertension in adult male rat offspring: Implications of nitric oxide and gut microbiome derived metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Garlic Oil Supplementation Prevents High-Fat Diet-Induced Hypertension in Adult Rat Offspring: Implications of H2S-Generating Pathway in the Gut and Kidneys. Mol. Nutr. Food Res. 2021, 65, e2001116. [Google Scholar] [CrossRef] [PubMed]
- Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef]
- Dugbartey, G.J. The smell of renal protection against chronic kidney disease: Hydrogen sulfide offers a potential stinky remedy. Pharm. Rep. 2018, 70, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.; Visram, F.; Liu, W.; Haig, A.; Jiang, J.; Mok, A.; Lian, D.; Wood, M.E.; Torregrossa, R.; Whiteman, M.; et al. GYY4137, a slow-releasing hydrogen sulfide donor, ameliorates renal damage associated with chronic obstructive uropathy. J. Urol. 2016, 196, 1778–1787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hsu, C.N.; Tain, Y.L. Preventing Developmental Origins of Cardiovascular Disease: Hydrogen Sulfide as a Potential Target? Antioxidants 2021, 10, 247. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal N-Acetylcysteine Therapy Prevents Hypertension in Spontaneously Hypertensive Rat Offspring: Implications of Hydrogen Sulfide-Generating Pathway and Gut Microbiota. Antioxidants 2020, 9, 856. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Polhemus, D.J.; Lefer, D.J. Evolution of Hydrogen Sulfide Therapeutics to Treat Cardiovascular Disease. Circ. Res. 2018, 123, 590–600. [Google Scholar] [CrossRef] [PubMed]
- Cicone, J.S.; Petronis, J.B.; Embert, C.D.; Spector, D.A. Successful treatment of calciphylaxis with intravenous sodium thiosulfate. Am. J. Kidney Dis. 2004, 43, 1104–1108. [Google Scholar] [CrossRef]
- Zhang, X.; Yu, Y.; Lei, H.; Cai, Y.; Shen, J.; Zhu, P.; He, Q.; Zhao, M. The Nrf-2/HO-1 Signaling Axis: A Ray of Hope in Cardiovascular Diseases. Cardiol. Res. Pract. 2020, 2020, 5695723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, K.S.; Kim, J.; Kwak, S.N.; Lee, K.S.; Lee, D.K.; Ha, K.S.; Won, M.H.; Jeoung, D.; Lee, H.; Kwon, Y.G.; et al. Functional role of NF-κB in expression of human endothelial nitric oxide synthase. Biochem. Biophys. Res. Commun. 2014, 448, 101–107. [Google Scholar] [CrossRef] [PubMed]
- Siragy, H.M.; Carey, R.M. Role of the intrarenal renin-angiotensin-aldosterone system in chronic kidney disease. Am. J. Nephrol. 2010, 31, 541–550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Forrester, S.J.; Booz, G.W.; Sigmund, C.D.; Coffman, T.M.; Kawai, T.; Rizzo, V.; Scalia, R.; Eguchi, S. Angiotensin II Signal Transduction: An Update on Mechanisms of Physiology and Pathophysiology. Physiol. Rev. 2018, 98, 1627–1738. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.; Liu, Y.-H.; Goh, H.S.; Wang, J.J.X.; Yong, Q.-C.; Wang, R.; Bian, J.-S. Hydrogen Sulfide Inhibits Plasma Renin Activity. J. Am. Soc. Nephrol. 2010, 21, 993–1002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, T.; Zhuo, L.; Wang, Y.; Jun, M.; Li, G.; Wang, L.; Hong, D. Systematic review of sodium thiosulfate in treating calciphylaxis in chronic kidney disease patients. Nephrology 2018, 23, 669–675. [Google Scholar] [CrossRef]
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
Cbs | atgctgcagaaaggcttcat | gtggaaaccagtcggtgtct |
Cth | cgcacaaattgtccacaaac | gctctgtccttctcaggcac |
Mpst | ggctcagtaaacatcccattc | tgtccttcacagggtcttcc |
Dao | ccctttctggaaaagcacag | ctcctctcaccacctcttcg |
Ren | aacattaccagggcaactttcact | acccccttcatggtgatctg |
Ace | caccggcaaggtctgctt | cttggcatagtttcgtgaggaa |
Ace2 | acccttcttacatcagccctactg | tgtccaaaacctaccccacatat |
Agtr1a | gctgggcaacgagtttgtct | cagtccttcagctggatcttca |
Agtr1b | caatctggctgtggctgactt | tgcacatcacaggtccaaaga |
Mas | catctctcctctcggctttgtg | cctcatccggaagcaaagg |
Rn18s | gccgcggtaattccagctcca | cccgcccgctcccaagatc |
Groups | ND | CKD | ND + STS | CKD + STS |
---|---|---|---|---|
Body weight (BW) (g) | 374 ± 6 | 292 ± 7 * | 377 ± 7 | 270 ± 12 * |
Left kidney weight (g) | 1.89 ± 0.09 | 3.54 ± 0.23 * | 1.8 ± 0.07 | 2.94 ± 0.17 * |
Left kidney weight/100 g BW | 0.5 ± 0.006 | 1.21 ± 0.060 * | 0.48 ± 0.019 | 1.09 ± 0.037 * |
Systolic BP (mmHg) | 129 ± 1 | 145 ± 2 * | 132 ± 1 | 138 ± 1 # |
Diastolic BP (mmHg) | 86 ± 2 | 101 ± 3 * | 90 ± 3 | 92 ± 2 # |
Mean arterial pressure (mmHg) | 100 ± 1 | 115 ± 2 * | 104 ± 2 | 107 ± 1 # |
Groups | ND | CKD | ND + STS | CKD + STS |
---|---|---|---|---|
l-Citrulline (μM) | 117.3 ± 7 | 101.3 ± 5.3 * | 83.8 ± 6.8 * | 99.1 ± 3.9 * |
l-Arginine (μM) | 333.2 ± 15.5 | 236.8 ± 11.2 * | 231.7 ± 28.4 * | 190.1 ± 17.8 *# |
Asymmetric dimethylarginine (μM) | 1.51 ± 0.17 | 1.96 ± 0.12 * | 1.01 ± 0.18 | 1.21 ± 0.09 # |
Symmetric dimethylarginine (μM) | 1.18 ± 0.07 | 1.21 ± 0.13 | 0.81 ± 0.09 * | 1.07 ± 0.18 |
l-Arginine-to-ADMA ratio (μM/μM) | 242 ± 30 | 125 ± 11 * | 254 ± 29 | 167 ± 23 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, C.-N.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Yang, H.-W.; Tain, Y.-L. Sodium Thiosulfate Improves Hypertension in Rats with Adenine-Induced Chronic Kidney Disease. Antioxidants 2022, 11, 147. https://doi.org/10.3390/antiox11010147
Hsu C-N, Hou C-Y, Chang-Chien G-P, Lin S, Yang H-W, Tain Y-L. Sodium Thiosulfate Improves Hypertension in Rats with Adenine-Induced Chronic Kidney Disease. Antioxidants. 2022; 11(1):147. https://doi.org/10.3390/antiox11010147
Chicago/Turabian StyleHsu, Chien-Ning, Chih-Yao Hou, Guo-Ping Chang-Chien, Sufan Lin, Hung-Wei Yang, and You-Lin Tain. 2022. "Sodium Thiosulfate Improves Hypertension in Rats with Adenine-Induced Chronic Kidney Disease" Antioxidants 11, no. 1: 147. https://doi.org/10.3390/antiox11010147
APA StyleHsu, C.-N., Hou, C.-Y., Chang-Chien, G.-P., Lin, S., Yang, H.-W., & Tain, Y.-L. (2022). Sodium Thiosulfate Improves Hypertension in Rats with Adenine-Induced Chronic Kidney Disease. Antioxidants, 11(1), 147. https://doi.org/10.3390/antiox11010147