Aqueous Extract of Pepino Leaves Ameliorates Palmitic Acid-Induced Hepatocellular Lipotoxicity via Inhibition of Endoplasmic Reticulum Stress and Apoptosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Aqueous Extract of Pepino Leaf (AEPL) Preparation
2.2. Palmitic Acid (PA) Preparation
2.3. Cell Line and Treatment
2.4. Cell Viability Test
2.5. Apoptosis Assay
2.6. Reactive Oxygen Species (ROS) Measurement
2.7. Fluorescence Microscopy
2.7.1. Nile Red Staining
2.7.2. DAPI (4′-6-diamidino-2-phenylindole) Staining
2.7.3. Immunofluorescence of HepG2 Cells
2.8. Mitochondria Isolation
2.9. Protein Extraction and Western Blot Analysis
2.10. Total RNA Extraction and Quantitative Real-Time PCR Analysis
2.11. HPLC/ESI-MS-MS Analysis of Aqueous Pepino Leaf Extract
2.12. Statistical Analysis
3. Results
3.1. AEPL Reduced PA-Induced Cytotoxicity in HepG2 Cells
3.2. AEPL Treatment Altered Lipid Accumulation and Reduced ROS in HepG2 Cell while PA Exposing
3.3. AEPL Alleviated PA-Induced Apoptosis in HepG2 Cells
3.4. AEPL Reduced ER Stress in PA-Treated HepG2 Cells
3.5. AEPL Promoted Nrf 2 Expression and Translocation into the Nucleus
3.6. Identification and Quantification of Phytochemical Constituents of AEPL by HPLC-ESI-MS/MS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| NAFLD | non-alcoholic fatty liver disease |
| PA | palmitic acid |
| ER | endoplasmic reticulum |
| UPR | unfolding protein response |
| GRP78 | glucose regulating protein 78 |
| IRE1α | inositol-requiring enzyme 1α |
| PERK | protein kinase R-like endoplasmic reticulum kinase |
| ATG6α | activating transcription factor 6α |
| SREBPs | sterol regulatory element-binding proteins |
| ACC | acetyl-CoA carboxylase |
| FAS | fatty acid synthase |
| C/EBPs | CCAAT/enhancer binding proteins |
| NASH | non-alcoholic steatohepatitis |
| PARP | poly (ADP-ribose) polymerase-1 |
| Nrf2 | nuclear factor erythroid 2–related factor 2 |
References
- Estadella, D.; da Penha Oller do Nascimento, C.M.; Oyama, L.M.; Ribeiro, E.B.; Damaso, A.R.; de Piano, A. Lipotoxicity: Effects of dietary saturated and transfatty acids. Mediat. Inflamm. 2013, 2013, 137579. [Google Scholar] [CrossRef] [Scilit]
- Guan, G.; Lei, L.; Lv, Q.; Gong, Y.; Yang, L. Curcumin attenuates palmitic acid-induced cell apoptosis by inhibiting endoplasmic reticulum stress in H9C2 cardiomyocytes. Hum. Exp. Toxicol. 2019, 38, 655–664. [Google Scholar] [CrossRef] [Scilit]
- Salvado, L.; Palomer, X.; Barroso, E.; Vazquez-Carrera, M. Targeting endoplasmic reticulum stress in insulin resistance. Trends Endocrinol. Metab. 2015, 26, 438–448. [Google Scholar] [CrossRef] [Scilit]
- Rosqvist, F.; Kullberg, J.; Stahlman, M.; Cedernaes, J.; Heurling, K.; Johansson, H.E.; Iggman, D.; Wilking, H.; Larsson, A.; Eriksson, O.; et al. Overeating Saturated Fat Promotes Fatty Liver and Ceramides Compared With Polyunsaturated Fat: A Randomized Trial. J. Clin. Endocrinol. Metab. 2019, 104, 6207–6219. [Google Scholar] [CrossRef] [Scilit]
- Cao, J.; Dai, D.L.; Yao, L.; Yu, H.H.; Ning, B.; Zhang, Q.; Chen, J.; Cheng, W.H.; Shen, W.; Yang, Z.X. Saturated fatty acid induction of endoplasmic reticulum stress and apoptosis in human liver cells via the PERK/ATF4/CHOP signaling pathway. Mol. Cell Biochem. 2012, 364, 115–129. [Google Scholar] [CrossRef] [Scilit]
- Ogawa, Y.; Imajo, K.; Honda, Y.; Kessoku, T.; Tomeno, W.; Kato, S.; Fujita, K.; Yoneda, M.; Saito, S.; Saigusa, Y.; et al. Palmitate-induced lipotoxicity is crucial for the pathogenesis of nonalcoholic fatty liver disease in cooperation with gut-derived endotoxin. Sci. Rep. 2018, 8, 11365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lebeaupin, C.; Vallee, D.; Hazari, Y.; Hetz, C.; Chevet, E.; Bailly-Maitre, B. Endoplasmic reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. J. Hepatol. 2018, 69, 927–947. [Google Scholar] [CrossRef] [Scilit]
- Breckenridge, D.G.; Germain, M.; Mathai, J.P.; Nguyen, M.; Shore, G.C. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 2003, 22, 8608–8618. [Google Scholar] [CrossRef] [Scilit]
- Han, J.; Kaufman, R.J. The role of ER stress in lipid metabolism and lipotoxicity. J. Lipid. Res. 2016, 57, 1329–1338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, C.T.; Chyau, C.C.; Hsu, C.C.; Kuo, S.M.; Chuang, C.W.; Lin, H.H.; Chen, J.H. Pepino polyphenolic extract improved oxidative, inflammatory and glycative stress in the sciatic nerves of diabetic mice. Food Funct. 2016, 7, 1111–1121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.H.; Hsu, C.C.; Yin, M.C. Aqueous Extract from Pepino (Solanum muricatum Ait.) Attenuated Hyperlipidemia and Cardiac Oxidative Stress in Diabetic Mice. ISRN Obes. 2012, 2012, 490870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, J.Y.; Lin, H.H.; Hsu, C.C.; Chen, B.C.; Chen, J.H. Aqueous Extract of Pepino (Solanum muriactum Ait) Leaves Ameliorate Lipid Accumulation and Oxidative Stress in Alcoholic Fatty Liver Disease. Nutrients 2018, 10, 931. [Google Scholar] [CrossRef] [Scilit]
- Hsu, J.Y.; Lin, H.H.; Wang, Z.H.; Chen, J.H. Aqueous extract from Pepino (Solanum muricatum Ait.) leaves ameliorated insulin resistance, hyperlipidemia, and hyperglycemia in mice with metabolic syndrome. J. Food Biochem. 2020, 44, e13518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jadeja, R.; Devkar, R.V.; Nammi, S. Herbal medicines for the treatment of nonalcoholic steatohepatitis: Current scenario and future prospects. Evid. Based Complement Alternat. Med. 2014, 2014, 648308. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Rana, P.; Will, Y. Palmitate increases the susceptibility of cells to drug-induced toxicity: An in vitro method to identify drugs with potential contraindications in patients with metabolic disease. Toxicol. Sci. 2012, 129, 346–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mei, S.; Ni, H.M.; Manley, S.; Bockus, A.; Kassel, K.M.; Luyendyk, J.P.; Copple, B.L.; Ding, W.X. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. J. Pharmacol. Exp. Ther. 2011, 339, 487–498. [Google Scholar] [CrossRef] [Scilit]
- Boulares, A.H.; Yakovlev, A.G.; Ivanova, V.; Stoica, B.A.; Wang, G.; Iyer, S.; Smulson, M. Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells. J. Biol. Chem. 1999, 274, 22932–22940. [Google Scholar] [CrossRef] [Scilit]
- Mukaigasa, K.; Tsujita, T.; Nguyen, V.T.; Li, L.; Yagi, H.; Fuse, Y.; Nakajima-Takagi, Y.; Kato, K.; Yamamoto, M.; Kobayashi, M. Nrf2 activation attenuates genetic endoplasmic reticulum stress induced by a mutation in the phosphomannomutase 2 gene in zebrafish. Proc. Natl. Acad. Sci. USA 2018, 115, 2758–2763. [Google Scholar] [CrossRef] [Scilit]
- Cullinan, S.B.; Diehl, J.A. PERK-dependent activation of Nrf2 contributes to redox homeostasis and cell survival following endoplasmic reticulum stress. J. Biol. Chem. 2004, 279, 20108–20117. [Google Scholar] [CrossRef] [Scilit]
- Martucci, M.E.; De Vos, R.C.; Carollo, C.A.; Gobbo-Neto, L. Metabolomics as a potential chemotaxonomical tool: Application in the genus Vernonia schreb. PLoS ONE 2014, 9, e93149. [Google Scholar] [CrossRef] [Scilit]
- Elsadig Karar, M.; Kuhnert, N. UPLC-ESI-Q-TOF-MS/MS Characterization of Phenolics from Crataegus monogyna and Crataegus laevigata (Hawthorn) Leaves, Fruits and their Herbal Derived Drops (Crataegutt Tropfen). J. Chem. Biol. Ther. 2016, 1. [Google Scholar] [CrossRef]
- Pitura, K.; Arntfield, S.D. Characteristics of flavonol glycosides in bean (Phaseolus vulgaris L.) seed coats. Food Chem. 2019, 272, 26–32. [Google Scholar] [CrossRef] [Scilit]
- Sobral, F.; Calhelha, R.C.; Barros, L.; Dueñas, M.; Tomás, A.; Santos-Buelga, C.; Vilas-Boas, M.; Ferreira, I.C. Flavonoid Composition and Antitumor Activity of Bee Bread Collected in Northeast Portugal. Molecules 2017, 22, 248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nawrot-Hadzik, I.; Granica, S.; Abel, R.; Czapor-Irzabek, H.; Matkowski, A. Analysis of Antioxidant Polyphenols in Loquat Leaves using HPLC-based Activity Profiling. Nat. Prod. Commun. 2017, 12, 163–166. [Google Scholar] [CrossRef] [Scilit]
- Sriseadka, T.; Wongpornchai, S.; Rayanakorn, M. Quantification of flavonoids in black rice by liquid chromatography-negative electrospray ionization tandem mass spectrometry. J. Agric. Food Chem. 2012, 60, 11723–11732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carazzone, C.; Mascherpa, D.; Gazzani, G.; Papetti, A. Identification of phenolic constituents in red chicory salads (Cichorium intybus) by high-performance liquid chromatography with diode array detection and electrospray ionisation tandem mass spectrometry. Food Chem. 2013, 138, 1062–1071. [Google Scholar] [CrossRef] [Scilit]
- Park, S.K.; Ha, J.S.; Kim, J.M.; Kang, J.Y.; Lee du, S.; Guo, T.J.; Lee, U.; Kim, D.O.; Heo, H.J. Antiamnesic Effect of Broccoli (Brassica oleracea var. italica) Leaves on Amyloid Beta (Abeta)1-42-Induced Learning and Memory Impairment. J. Agric. Food Chem. 2016, 64, 3353–3361. [Google Scholar] [CrossRef] [Scilit]
- Eguchi, A.; Wree, A.; Feldstein, A.E. Biomarkers of liver cell death. J. Hepatol. 2014, 60, 1063–1074. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Ruiz, I.; Solis-Munoz, P.; Fernandez-Moreira, D.; Munoz-Yague, T.; Solis-Herruzo, J.A. In vitro treatment of HepG2 cells with saturated fatty acids reproduces mitochondrial dysfunction found in nonalcoholic steatohepatitis. Dis. Model Mech. 2015, 8, 183–191. [Google Scholar] [CrossRef] [Scilit]
- Suhaili, S.H.; Karimian, H.; Stellato, M.; Lee, T.H.; Aguilar, M.I. Mitochondrial outer membrane permeabilization: A focus on the role of mitochondrial membrane structural organization. Biophys. Rev. 2017, 9, 443–457. [Google Scholar] [CrossRef] [Scilit]
- Marsden, V.S.; O’Connor, L.; O’Reilly, L.A.; Silke, J.; Metcalf, D.; Ekert, P.G.; Huang, D.C.; Cecconi, F.; Kuida, K.; Tomaselli, K.J.; et al. Apoptosis initiated by Bcl-2-regulated caspase activation independently of the cytochrome c/Apaf-1/caspase-9 apoptosome. Nature 2002, 419, 634–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- D’Amours, D.; Sallmann, F.R.; Dixit, V.M.; Poirier, G.G. Gain-of-function of poly(ADP-ribose) polymerase-1 upon cleavage by apoptotic proteases: Implications for apoptosis. J. Cell Sci. 2001, 114, 3771–3778. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Wang, D.; Topczewski, F.; Pagliassotti, M.J. Saturated fatty acids induce endoplasmic reticulum stress and apoptosis independently of ceramide in liver cells. Am. J. Physiol. Endocrinol. Metab. 2006, 291, E275–E281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Lv, Y.; Zhao, N.; Guan, G.; Wang, J. Protein kinase R-like ER kinase and its role in endoplasmic reticulum stress-decided cell fate. Cell Death Dis. 2015, 6, e1822. [Google Scholar] [CrossRef] [Scilit]
- Bobrovnikova-Marjon, E.; Hatzivassiliou, G.; Grigoriadou, C.; Romero, M.; Cavener, D.R.; Thompson, C.B.; Diehl, J.A. PERK-dependent regulation of lipogenesis during mouse mammary gland development and adipocyte differentiation. Proc. Natl. Acad. Sci. USA 2008, 105, 16314–16319. [Google Scholar] [CrossRef] [Scilit]
- Ning, J.; Hong, T.; Ward, A.; Pi, J.; Liu, Z.; Liu, H.-Y.; Cao, W. Constitutive Role for IRE1α-XBP1 Signaling Pathway in the Insulin-Mediated Hepatic Lipogenic Program. Endocrinology 2011, 152, 2247–2255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Higgins, M.E.; Ioannou, Y.A. Apoptosis-induced release of mature sterol regulatory element-binding proteins activates sterol-responsive genes. J. Lipid. Res. 2001, 42, 1939–1946. [Google Scholar] [CrossRef] [Scilit]
- Warfel, J.D.; Bermudez, E.M.; Mendoza, T.M.; Ghosh, S.; Zhang, J.; Elks, C.M.; Mynatt, R.; Vandanmagsar, B. Mitochondrial fat oxidation is essential for lipid-induced inflammation in skeletal muscle in mice. Sci. Rep. 2016, 6, 37941. [Google Scholar] [CrossRef] [Scilit]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [Scilit]
- Ly, L.D.; Xu, S.; Choi, S.K.; Ha, C.M.; Thoudam, T.; Cha, S.K.; Wiederkehr, A.; Wollheim, C.B.; Lee, I.K.; Park, K.S. Oxidative stress and calcium dysregulation by palmitate in type 2 diabetes. Exp. Mol. Med. 2017, 49, e291. [Google Scholar] [CrossRef] [Scilit]
- Haynes, C.M.; Titus, E.A.; Cooper, A.A. Degradation of misfolded proteins prevents ER-derived oxidative stress and cell death. Mol. Cell 2004, 15, 767–776. [Google Scholar] [CrossRef] [Scilit]
- Egnatchik, R.A.; Leamy, A.K.; Jacobson, D.A.; Shiota, M.; Young, J.D. ER calcium release promotes mitochondrial dysfunction and hepatic cell lipotoxicity in response to palmitate overload. Mol. Metab. 2014, 3, 544–553. [Google Scholar] [CrossRef] [Scilit]
- Dai, X.; Yan, X.; Wintergerst, K.A.; Cai, L.; Keller, B.B.; Tan, Y. Nrf2: Redox and Metabolic Regulator of Stem Cell State and Function. Trends Mol. Med. 2020, 26, 185–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.H.; Lee, B.C.; Kim, J.H.; Sim, G.S.; Lee, D.H.; Lee, K.E.; Yun, Y.P.; Pyo, H.B. The isolation and antioxidative effects of vitexin from Acer palmatum. Arch. Pharmacal Res. 2005, 28, 195–202. [Google Scholar] [CrossRef] [Scilit]
- Zhou, B.; Jiang, Z.; Li, X.; Zhang, X. Kaempferol’s Protective Effect on Ethanol-Induced Mouse Primary Hepatocytes Injury Involved in the Synchronous Inhibition of SP1, Hsp70 and CYP2E1. Am. J. Chin. Med. 2018, 46, 1093–1110. [Google Scholar] [CrossRef] [Scilit]
- Devi, V.G.; Rooban, B.N.; Sasikala, V.; Sahasranamam, V.; Abraham, A. Isorhamnetin-3-glucoside alleviates oxidative stress and opacification in selenite cataract in vitro. Toxicol. Vitro 2010, 24, 1662–1669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khlifi, R.; Dhaouefi, Z.; Toumia, I.B.; Lahmar, A.; Sioud, F.; Bouhajeb, R.; Bellalah, A.; Chekir-Ghedira, L. Erica multiflora extract rich in quercetin-3-O-glucoside and kaempferol-3-O-glucoside alleviates high fat and fructose diet-induced fatty liver disease by modulating metabolic and inflammatory pathways in Wistar rats. J. Nutr. Biochem. 2020, 86, 108490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Tang, C.; Zhang, H. Hepatoprotective effects of kaempferol 3-O-rutinoside and kaempferol 3-O-glucoside from Carthamus tinctorius L. on CCl4-induced oxidative liver injury in mice. J. Food Drug Anal. 2015, 23, 310–317. [Google Scholar] [CrossRef] [Scilit]
- Varshney, R.; Varshney, R.; Mishra, R.; Gupta, S.; Sircar, D.; Roy, P. Kaempferol alleviates palmitic acid-induced lipid stores, endoplasmic reticulum stress and pancreatic beta-cell dysfunction through AMPK/mTOR-mediated lipophagy. J. Nutr. Biochem. 2018, 57, 212–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabinovitch, R.C.; Samborska, B.; Faubert, B.; Ma, E.H.; Gravel, S.P.; Andrzejewski, S.; Raissi, T.C.; Pause, A.; St-Pierre, J.; Jones, R.G. AMPK Maintains Cellular Metabolic Homeostasis through Regulation of Mitochondrial Reactive Oxygen Species. Cell Rep. 2017, 21, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Krenkel, O.; Tacke, F. Liver macrophages in tissue homeostasis and disease. Nat. Rev. Immunol. 2017, 17, 306–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.Y.; Tsai, T.H. Enterohepatic Circulation and Pharmacokinetics of Genistin and Genistein in Rats. ACS Omega 2019, 4, 18428–18433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsukawa, N.; Matsumoto, M.; Hara, H. High biliary excretion levels of quercetin metabolites after administration of a quercetin glycoside in conscious bile duct cannulated rats. Biosci. Biotechnol. Biochem. 2009, 73, 1863–1865. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Accession No. | Sequence |
|---|---|---|
| SOD1 | NM_000454 | Forward: 5′- TAGCGAGTTATGGCGACGAA -3′ |
| Reverse: 5′- AGTCTCCAACATGCCTCTCTT -3′ | ||
| GPX3 | NM_002084 | Forward: 5′- AGAAGTCGAAGATGGACTGCC -3′ |
| Reverse: 5′- CTGGTCGGACATACTTGAGGG -3′ | ||
| ACTB | NM_001101 | Forward: 5′- CTGGAACGGTGAAGGTGACA -3′ |
| Reverse: 5′- AAGGGACTTCCTGTAACAATGCA -3′ |
| Peak | tR (min) | λmax (nm) | [M+H]+ | [M-H]− | MS2 (% Base Peak) | Compound | Content (mg/g Extract) c |
|---|---|---|---|---|---|---|---|
| 1 | 12.77 | 222sh, 256, 352 | - | 595 a | 300(100), 301(8), 271(6) | Quercetin-3-O-hexose-O-pentoside [20] | 2.75 ± 0.04 |
| 2 | 13.22 | 216, 268, 326 | 433 | 431 | 311(100), 283(19), 341(7) | Vitexin [21] | 3.15 ± 0.05 |
| 3 | 14.29 | 266, 330 | 581 | 579 | 284(100), 285(74), 255(6) | Kaempferol 3-O-xylosylglucoside [22] | 8.59 ± 0.15 |
| 4 | 14.69 | 214, 270, 358sh | 611 | 609 | 315(100), 314(79) | Isorhamnetin-O-pentosyl hexoside [23] | 19.44 ± 0.45 |
| 5 | 15.19 | 242, 346 | 449 | 447 | 287(100) | Kaempferol-3-O-glucoside [24] | 28.70 ± 0.16 |
| 6 | 15.93 | 224, 252, 350 | 479 | 477 | 314(100), 285(20), 271(15), 243(13) | Isorhamnetin-3-O-glucoside [25] | 9.98 ± 0.06 |
| 7 | 16.88 | 222, 266, 342 | 535 | 533 | 284(100), 285(99), 255(19) | Kaempferol-3-O-malonylhexoside [20] | 20.71 ± 0.70 |
| 8 | 17.37 | 222, 254, 352 | 565 | 519 | 317(100), 107(7) | Isorhamnetin-7-O-(6”-O-malonyl)-glucoside [26] | 12.44 ± 0.73 |
| 9 | 18.02 | 238, 308 | 327 | 651 b | 239(100), 281(39), 227(7) | Unknown | 8.68 ± 0.70 |
| 10 | 18.92 | 220, 292, 316 | 258 | 283 | 241(100), 195(29), 223(11), 163(7) | Unknown | 12.60 ± 0.59 |
| 11 | 24.38 | 222 | 351 | 327 | 211(100), 229(45), 171(35), 183(12) | oxo-dihydroxy-octadecenoic acid [27] | 0.56 ± 0.01 |
| 12 | 26.18 | 224 | 353 | 329 | 211(100), 171(66), 229(65), 139(29) | trihydroxy-octadecenoic acid [27] | 0.27 ± 0.01 |
| 13 | 26.38 | 224 | 351 | 327 | 171(100), 201(17), 137(14), 119(13) | oxo-dihydroxy-octadecenoic acid isomer [27] | 0.56 ± 0.05 |
| 14 | 28.92 | 224 | 353 | 329 | 201(100), 171(89), 127(27), 139(18) | trihydroxy-octadecenoic acid isomer [27] | 0.08 ± 0.03 |
| 15 | 36.01 | 232, 274, 312 | 255 | 345 | 151(100) | 7-Methoxyflavanone (IS) | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, J.-Y.; Lin, H.-H.; Chyau, C.-C.; Wang, Z.-H.; Chen, J.-H. Aqueous Extract of Pepino Leaves Ameliorates Palmitic Acid-Induced Hepatocellular Lipotoxicity via Inhibition of Endoplasmic Reticulum Stress and Apoptosis. Antioxidants 2021, 10, 903. https://doi.org/10.3390/antiox10060903
Hsu J-Y, Lin H-H, Chyau C-C, Wang Z-H, Chen J-H. Aqueous Extract of Pepino Leaves Ameliorates Palmitic Acid-Induced Hepatocellular Lipotoxicity via Inhibition of Endoplasmic Reticulum Stress and Apoptosis. Antioxidants. 2021; 10(6):903. https://doi.org/10.3390/antiox10060903
Chicago/Turabian StyleHsu, Jen-Ying, Hui-Hsuan Lin, Charng-Cherng Chyau, Zhi-Hong Wang, and Jing-Hsien Chen. 2021. "Aqueous Extract of Pepino Leaves Ameliorates Palmitic Acid-Induced Hepatocellular Lipotoxicity via Inhibition of Endoplasmic Reticulum Stress and Apoptosis" Antioxidants 10, no. 6: 903. https://doi.org/10.3390/antiox10060903
APA StyleHsu, J.-Y., Lin, H.-H., Chyau, C.-C., Wang, Z.-H., & Chen, J.-H. (2021). Aqueous Extract of Pepino Leaves Ameliorates Palmitic Acid-Induced Hepatocellular Lipotoxicity via Inhibition of Endoplasmic Reticulum Stress and Apoptosis. Antioxidants, 10(6), 903. https://doi.org/10.3390/antiox10060903

