Sustainable Strategies for Sunburn Mitigation in Gala Apple Orchards: Effects on Yield, Fruit Quality, and Plant Physiology

Abstract

Fruit sunburn is a major abiotic stress limiting apple production worldwide, with losses potentially reaching 50% due to climate change-driven heat events. This study aimed to evaluate sustainable strategies to mitigate or reduce sunburn on ‘Gala Galaxy Selecta’ apple trees. Field trials conducted in summer 2021 compared eight treatments: silicon-based application (Eckosil^®), foliar fertilization with algae extracts, macro- and micronutrients, and amino acids, increased irrigation (+35% ET_c), mineral particle films (Surround^®, Vegepron Sun^®, Agrowhite^®, Sunstop^®), and an untreated control. Randomized block designs with replicates were used. Agronomic parameters, including particle film coverage, trunk cross-sectional area, yield, and fruit quality (color, sunburn incidence, firmness, soluble solids content, dry matter, starch), were measured at harvest. Physiological responses, such as net photosynthesis, maximum quantum yield of Photosystem II, specific leaf area, fruit surface temperature, photoprotective pigments, antioxidants, and heat shock protein gene expression, were also assessed. Foliar fertilization, Agrowhite^®, and water reinforcement produced the highest yield per trunk cross-sectional area, with increased soluble solids content and enhanced red pigmentation. Surround^® minimized sunburn incidence but reduced photosynthetic activity, as did Vegepron Sun^®. Agrowhite^® balanced sunburn protection with maintenance of fruit quality and physiological function. These findings provide practical guidance for growers to select effective treatments, balancing sunburn mitigation, fruit quality, and tree physiological performance, while offering researchers insights into integrating agronomic and physiological strategies for climate-resilient apple production.

1. Introduction

Subtropical, arid, and Mediterranean-type regions are characterized by summers with clear skies and intense sunlight, which pose a significant risk of sunburn damage to fruits [1,2], as observed in Portugal. Sunburn is a major problem for ‘Gala’ apple (Malus domestica Borkh.) producers, causing physiological damage to fruits due to excessive solar radiation [3]. Depending on climatic conditions, cultivar, and orchard management practices, the incidence of sunburn on fruits can vary considerably, ranging from 10% to 50% of the total yield, leading to significant economic losses [4]. This damage can lead to disease susceptibility, fruit depreciation, yield loss, and postharvest storage issues, representing a substantial economic burden for apple growers worldwide [5].

Three types of sunburn are typically recognized in apples. Necrotic sunburn results from thermal cell death in the fruit epidermis, occurring at fruit temperatures around 52 °C and producing necrotic spots on sun-exposed surfaces [6]. Dark sunburn, the most common type, appears when fruit surface temperature reaches 46–49 °C in sunlight, leading to yellow, bronze, or brownish patches [7]. Photo-oxidative sunburn arises from sudden exposure of unacclimated fruits to intense sunlight, generating white spots and affecting fruits during activities such as manual thinning, selective harvesting, or branch displacement due to high fruit load [8].

Meteorological conditions, geographic location, and soil type influence sunburn incidence [9]. Fruit susceptibility also depends on epidermal thickness, pubescence, accumulation of antioxidant compounds, and photo-protective pigments [5,10]. Other factors include nutritional status, vegetation cover, fruit size, and soil moisture content [11], as well as cultivar and rootstock selection [12]. Water stress further exacerbates sunburn by increasing fruit temperature and reducing evaporative cooling [12], although the primary drivers remain high solar radiation and temperature [13].

Sunburn affects both external appearance and internal quality of ‘Gala’ apples, altering firmness, sugar-to-acid ratio, and skin color through anthocyanin degradation, along with biochemical changes that compromise flavor and texture [5,14]. Commercially, sunburn leads to fruit rejection, downgrading, and increased postharvest disorders, such as sunscald, lenticel breakdown, bitter pit, and watercore, reducing storability and shelf life [11,15].

Prevention strategies include cultural, chemical, and physical approaches. Reflective particle films, such as kaolin or calcium carbonate sprays, increase fruit surface reflectance, reducing temperature and sunburn incidence [16,17,18,19]. Shade netting lowers canopy temperature and radiation load, although color development must be considered [20,21]. Evaporative cooling systems, including misting and micro-sprinklers, are effective during heat waves [22,23]. Canopy management that preserves leaf shading and balanced mineral nutrition, especially calcium supply, enhances epidermal stability and tolerance against sunburn [7,11].

Despite these strategies, there is limited comparative data on the relative effectiveness of different approaches in reducing sunburn while maintaining fruit quality and productivity. Accordingly, this study aims to evaluate the integration of multiple treatments in ‘Gala’ apple orchards, including reflective particle films, foliar nutrition, increased irrigation, and silicon applications, assessing both their efficacy in mitigating sunburn and any potential negative effects on fruit physiology and quality. The findings provide practical guidance for orchard management under increasingly frequent heat stress events.

2. Materials and Methods

2.1. Experimental Site

To evaluate the effect of different treatments on reducing sunburn in ‘Gala’ apples, an experimental trial was conducted during the 2021 growing season in an 18-year-old commercial orchard at Estação Nacional de Fruticultura Vieira Natividade (INIAV, IP/ENFVN) in Alcobaça, Portugal (39° 32′ 56.4″ N, 8° 57′ 25.2″ W). The orchard consisted of ‘Gala’ apple trees, clone ‘Galaxy Selecta’, grafted onto EMLA9 rootstock, trained in a central leader system, NE-SW orientated, and, with a spacing of 4.5 × 1.2 m. Two pollinator cultivars, ‘Granny Smith’ and ‘Golden Reinders’, were also present, representing approximately 4% of the planting.

During the trial, daily maximum, minimum, and mean air temperatures, solar radiation, evapotranspiration, and precipitation were recorded between May and August (Figure 1). The number of days with temperatures exceeding 30 °C was also monitored. Meteorological data were collected from a weather station installed approximately 30 m from the orchard, providing environmental context for the experimental conditions.

Drip irrigation was applied via a dedicated line for each row, with emitters placed 30 cm above the ground at 1 m spacing and a nominal flow of 4 L h⁻¹. The orchard was irrigated three times per week (Tuesdays, Thursdays, and Saturdays) for 2.5 h per event, starting on 28 June 2021. The soil is classified as loam, with a texture composed of 56.8% sand, 19.3% silt, and 24.9% clay. It has low organic matter content (1.25%) and a neutral pH (7.6, H₂O). A permanent ground cover, naturally established without deliberate sowing or management, was maintained between the rows. Within-row weed control was achieved using a non-selective systemic herbicide containing glyphosate (28.4% w/w), applied at a rate of 2.1 L ha⁻¹ twice during the growing season—once during dormancy (November) and once at petal fall (May)—while inter-row spaces were managed mechanically to preserve low-growing vegetation. Fertilization programs and pest management were implemented uniformly across all treatments, following the principles and recommendations of the Portuguese Integrated Production System for pome fruits [24].

Eight treatments were tested: Control (C), Kiplant Eckosil^® (EK), Foliar Fertilization (FF), Water Reinforcement (WR), Surround^® (SD), Agrowhite^® (AW), Vegepron Sun^® (VS), and Sunstop^® (SS) (

Table 1. Treatments evaluated in the study, with their respective abbreviations, commercial entities, and main compositions or descriptions.

Abbreviation	Treatment	Commercial Entity	Composition/Description
C	Control	—	Without treatment
EK	Kiplant Eckosil®	AsfertGlobal	4.1% Si
FF	Foliar Fertilization	Tradecorp	Fertilization strategy (see Table 2)
WR	Water Reinforcement	—	Increase in irrigation allocation
SD	Surround®	BASF	95% Kaolin
AW	Agrowhite®	Codiagro	33–46% CaO, 0.3–0.42% MgO
VS	Vegepron Sun®	UPL	60% CaCO3
SS	Sunstop®	Fitosistema	20% CaCO3

Legend: C = Control; EK = Eckosil^®; FF = Foliar Fertilizers; WR = Water Reinforcement; SD = Surround^®; AW = Agrowhite^®; VS = Vegepron Sun^®; SS = Sunstop^®; Si: Orthosilicic acid; Kaolin: natural clay mineral; CaO: Calcium oxide; MgO: Magnesium oxide; and CaCO₃: Calcium carbonate.

).

Four of the eight treatments corresponded to particle film formulations (SD, AW, VS, and SS) designed to form a reflective film on the fruit surface. By enhancing the reflection and scattering of incident solar radiation, especially in the UV and IR spectral regions—these treatments effectively lower fruit surface temperature and contribute to sunburn prevention.

The foliar fertilization treatment consisted of a nutritional approach involving the application of biostimulant products designed to optimize plant physiological status and strengthen their tolerance to abiotic stress, particularly elevated temperatures. By supporting key metabolic processes, these products contribute to the alleviation of heat stress, enhancing the plant’s adaptive capacity and leading to improved crop quality and performance.

The trees of each treatment were chosen based on their average trunk section areas, making the treatments more homogeneous among themselves, and allowing production to be normalized. Each treatment consisted of 20 trees (5 replications of 4 trees), randomly distributed across the plot. In turn, each experimental unit was composed of four trees, with the two trees at the ends serving as treatment borders, in order to avoid contamination from adjacent treatments.

As for the treatments, they were carried out at different stages of the cycle, according to the number of days after full bloom (DAFB) (Table 2), using a Pulmic Industrial 35 electric sprayer (Grupo Sanz, Benisanó, Spain).

Table 2. Record of treatments carried out in the experimental plot, during 2021 apple growing season.

Date	DAFB	Treatment	Dose (Unit)
28 May	46	FF: FG + AA + MKP + MAP; EK	250 mL/100 L + 150 mL/100 L + 300 g/100 L + 300 g/100 L; 50 mL/100 L
11 June	60	FF: CF + FL; EK	2 kg/ha + 100 mL/100 L; 50 mL/100 L
24 June	73	FF: NPK + BX; SS; SD; AW; VS; EK	500 g/100 L + 150 g/100 L; 12 kg/ha; 2.5 kg/ha; 5 kg/ha; 2 L/100 L; 50 mL/100 L
7 July	86	FF: RD + FG; EK	2.5 kg/ha + 0.5 kg/ha; 50 mL/100 L
21 July	100	FF: FT; EK	3 kg/ha; 50 mL/100 L
9 August	119	FF: ST + RD; EK	2 L/ha + 2.5 kg/ha; 50 mL/100 L

Legend: EK = Eckosil^®; FF = Foliar Fertilizers (Fitoalgas Green = FG; Aton Az = AA; MKP = MKP; MAP = MAP; Calfinish = CF; Folur = FL; 15-05-30 = NPK; Borexpert = BX; Radikal = RD; Fortan = FT; Stimulus = ST); Particle Films: SS = Sunstop^®; SD = Surround^®; AW = Agrowhite^®; VS = Vegepron Sun^®.

Table 2. Record of treatments carried out in the experimental plot, during 2021 apple growing season.

Date	DAFB	Treatment	Dose (Unit)
28 May	46	FF: FG + AA + MKP + MAP; EK	250 mL/100 L + 150 mL/100 L + 300 g/100 L + 300 g/100 L; 50 mL/100 L
11 June	60	FF: CF + FL; EK	2 kg/ha + 100 mL/100 L; 50 mL/100 L
24 June	73	FF: NPK + BX; SS; SD; AW; VS; EK	500 g/100 L + 150 g/100 L; 12 kg/ha; 2.5 kg/ha; 5 kg/ha; 2 L/100 L; 50 mL/100 L
7 July	86	FF: RD + FG; EK	2.5 kg/ha + 0.5 kg/ha; 50 mL/100 L
21 July	100	FF: FT; EK	3 kg/ha; 50 mL/100 L
9 August	119	FF: ST + RD; EK	2 L/ha + 2.5 kg/ha; 50 mL/100 L

Legend: EK = Eckosil^®; FF = Foliar Fertilizers (Fitoalgas Green = FG; Aton Az = AA; MKP = MKP; MAP = MAP; Calfinish = CF; Folur = FL; 15-05-30 = NPK; Borexpert = BX; Radikal = RD; Fortan = FT; Stimulus = ST); Particle Films: SS = Sunstop^®; SD = Surround^®; AW = Agrowhite^®; VS = Vegepron Sun^®.

In the WR treatment, crop water requirements were estimated based on crop evapotranspiration (ET_c), obtained as the product of reference evapotranspiration (ET_o) and crop coefficient (K_c), following the FAO-56 approach [25]:

$$ETc=ETo\times Kc$$

(1)

where ET_o (mm d⁻¹) was provided by the on-site meteorological station, which calculates this parameter using FAO-56 equations based on meteorological inputs (net radiation, soil heat flux, air temperature at 2 m, wind speed at 2 m, and vapor pressures).

K_c values for each growth stage (initial, development, mid-season, and late season) were obtained from FAO-56 guidelines for apple trees under active ground cover conditions, with risk of frost. During the experimental period (May–August), trees were mainly in the development (stage II) and mid-season (stage III) growth stages. In stage II, K_c values ranged between 0.84 and 1.20, while in stage III (mid-season), K_c was maintained at 1.20.

Daily reference evapotranspiration (ET_o), calculated by the meteorological station following FAO-56 methodology, averaged 4.65 mm day⁻¹ between May and August. In the WR treatment, irrigation began one month before the conventional program, applying 75% of ET_c weekly (~105 L per tree). After 28 June 2021, an additional 35% ET_c (~50 L per tree per week) supplemented the standard irrigation schedule.

2.2. Agronomic Determinations

Trunk diameter was measured in ten trees per treatment at three equidistant positions around the trunk using a digital caliper (Calibit, Horticultural Knowledge, Cesena, Italy) at the beginning and end of the experimental period, 20 cm above the grafting point. The average of the three diameters (D1, D2, D3) was used to estimate the trunk cross-sectional area (TCSA, cm²) according to the formula:

$$\mathrm{TCSA} = \mathsf{\pi } \times {\left({\displaystyle \frac{ \mathit{D}1 + \mathit{D}2 + \mathit{D}3}{3 \times 2}}\right)}^2$$

(2)

where D1, D2, and D3 are the trunk diameters, $\mathsf{\pi }$ is the mathematical constant (≈3.1416), and the denominator reflects average radius.

The adherence and coverage of particle film products on fruits were assessed using ImageJ software (v1.53t, NIH, USA; https://imagej.net/ij/, accessed on 15 September 2025). Six fruits per particle film treatment were photographed in 8-bit format, and a threshold (106–255) was applied to determine the percentage of surface coverage.

On four dates (1 July, 28 July, 13 August, 15 August), fruit surface temperatures were measured using a FLIR E6-XT thermal camera (240 × 180 resolution, 7.5–13 μm spectral range; Flir Systems AB, Wilsonville, OR, USA). For each treatment, maximum temperatures were recorded on five external fruits (located on the outer half of the branch, 50–100% along the branch length) and five internal fruits (located on the inner half of the branch, 0–50% along the branch length).

2.3. Physiological Determinations

Net photosynthesis (A_n, μmol CO₂ m⁻² s⁻¹) was measured on clear days using a portable IRGA (LCpro T, ADC BioScientific Ltd., Hoddesdon, UK) at 25 °C. Measurements were conducted on five fully expanded leaves per treatment from the middle third of branches, in the morning (10:00–12:30) and afternoon (15:00–17:30), on three dates (1 and 27 July, 13 August).

Chlorophyll a fluorescence parameters (Fv/Fm and Fv′/Fm′) were determined using a FluorPen FP 110 (Photon Systems Instruments, Drásov, Czech Republic) on dark-adapted leaves (during at least 30 min), from the outer canopy. Five leaves per treatment were measured on each of the same dates.

Specific leaf area (SLA, cm² g⁻¹) was measured early (May–June) and late season (July–August) using 20 leaf discs (14 mm diameter) per replicate (three replicates per treatment). Discs were dried at 70 °C for 48 h, and SLA was calculated following Reich et al. [26]:

$$SLA\left({\displaystyle \frac{{cm}^2}{8}}\right)=\pi \times {\left({\displaystyle \frac{disc diameter}{2}}\right)}^2\times number of discs \times {\displaystyle \frac{1}{Dry weight discs}}$$

(3)

To determine the content of chlorophyll a (Chl a), chlorophyll b (Chl b), total chlorophyll (Chl t), carotenoids (Car), and anthocyanins (AnC) (μmol g⁻¹), three frozen leaves from the middle third of random external branches were collected per replicate, with six replicates per treatment. The samples were macerated in an acetone solution prepared in 100 mM Tris-HCl buffer (pH 7.8, 80:20). The homogenized solutions were centrifuged at maximum speed for 15 min at 10 °C (Centrifuge 5424 R, Eppendorf, Hamburg, Germany). The supernatant was transferred to a new tube, and the pellet discarded.

Pigment concentrations were then quantified by spectrophotometry in a microplate reader (Synergy HT, Biotek, Winooski, VT, USA; Gen5 3.05 software) at 470, 537, 647, and 663 nm, using the equations described by Sims & Gamon [27]:

$$Chla\left(\mathsf{\mu }\mathrm{m}\mathrm{o}\mathrm{l}{\mathrm{m}\mathrm{L}}^{-1}\right)=0.01373\times \mathrm{A}663-0.000897\times \mathrm{A}537-0.003046\times \mathrm{A}647$$

(4)

$$Chlb\left(\mathsf{\mu }\mathrm{m}\mathrm{o}\mathrm{l}{\mathrm{m}\mathrm{L}}^{-1}\right)=0.02405\times \mathrm{A}647-0.004305\times \mathrm{A}537-0.005507\times \mathrm{A}663$$

(5)

$$Chlt\left(\mathsf{\mu }\mathrm{m}\mathrm{o}\mathrm{l}{\mathrm{m}\mathrm{L}}^{-1}\right)=Chla+Chlb$$

(6)

$$Anthocyanins \left(\mathsf{\mu }\mathrm{m}\mathrm{o}\mathrm{l}{\mathrm{m}\mathrm{L}}^{-1}\right)=0.08173\times \mathrm{A}537-0.00697\times \mathrm{A}647-0.002228\times \mathrm{A}663$$

(7)

$$Carotenoids \left(\mathsf{\mu }\mathrm{m}\mathrm{o}\mathrm{l}{\mathrm{m}\mathrm{L}}^{-1}\right)={\displaystyle \frac{\mathrm{A}470-17.1\times Chl\mathrm{t}-9.479\times \mathrm{A}\mathrm{n}\mathrm{t}\mathrm{h}\mathrm{o}\mathrm{c}\mathrm{y}\mathrm{a}\mathrm{n}\mathrm{i}\mathrm{n}\mathrm{s}}{119.26}}$$

(8)

Finally, pigment concentrations were converted to μmol g⁻¹ fresh leaf mass [28].

To quantify the non-enzymatic antioxidants ascorbate and glutathione, leaf and fruit samples (skin and pulp) were collected on two dates, 5 July and 17 August, using three biological replicates per treatment. Samples were immediately frozen in liquid nitrogen and macerated in the presence of liquid nitrogen. Then, 1 mL of 6% metaphosphoric acid (pH 2.8) containing 1 mM Ethylenediaminetetraacetic acid (EDTA) and pre-cooled on ice was added to each replicate. The homogenized solutions were centrifuged at 27,000× g for 15 min at 4 °C. The supernatant (acid extract) was transferred to a new tube, and the pellet discarded. Extracts were stored at −20 °C until analysis.

Reduced (GSH) and oxidized (GSSG) forms of glutathione were quantified colorimetrically using the 2-vinylpyridine method described by Anderson et al. [29]. GSSG was measured after derivatization of GSH with 2-vinylpyridine, and total glutathione was measured without derivatization. The GSH was then calculated as the difference between total glutathione and GSSG, as:

$$\mathrm{\%}GSH={\displaystyle \frac{GSH}{GSH+GSSG}}\times 100$$

(9)

Concentrations were expressed in μmol g⁻¹ fresh weight.

For the analysis of ascorbic (AsA) and dehydroascorbic (DAsA) acids, a method adapted from Masato [30] by Carvalho & Amâncio [31] was employed. To determine total and reduced ascorbate (AsA), 25 μL of acid extract was neutralized with 5 μL of 1.5 M triethanolamine, followed by the addition of 30 μL of 150 mM sodium phosphate buffer (pH 7.4). To quantify total ascorbate, 15 μL of 10 mM dithiothreitol (DTT) was added, and samples were incubated for 15 min at 25 °C to reduce the DAsA present. Excess DTT was removed by adding 15 μL of 0.5% (w/v) N-ethylmaleimide, followed by 30 s incubation at 25 °C. For AsA quantification, 30 μL of distilled water was added to equalize sample volumes.

Subsequently, the following reagents were successively added to each sample: 60 μL of 10% (w/v) trichloroacetic acid, 60 μL of 44% (v/v) phosphoric acid, 60 μL of 2.2′-dipyridyl (4% w/v) previously dissolved in 70% ethanol, and 30 μL of 3% (w/v) FeCl₃. Samples were incubated at 37 °C for 1 h in a water bath, then transferred to 96-well microplates, and absorbance was measured at 525 nm using a microplate reader. The concentration of DAsA was calculated by subtracting the AsA content from the total ascorbate.

Analyses were performed on samples of leaves, epidermis, and fruit pulp collected on two dates during the growing season (5 July and 17 August). Due to very low values in July, only the August data were used for statistical analysis.

2.4. Gene Expression Analysis

2.4.1. Ribonucleic Acid Extraction

Plant material from one fruit per sunburn severity level (epidermis and flesh) was ground in liquid nitrogen using a mortar and pestle, and four analytical replicates were prepared from each sample. Total RNA was extracted using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA), following the manufacturer’s instructions. RNA concentrations were quantified, and purity was assessed spectrophotometrically with a microplate reader (Synergy HT, Biotek, Winooski, VT, USA; Gen5 v3.05) using a Take3 microvolume plate, loading 2 μL per well. Absorbance was recorded at 260 nm (RNA concentration), 280 nm (protein contamination via A260/A280), and 320 nm (sample purity). Only RNA samples with concentrations > 35 ng μL⁻¹ were used.

RNA integrity was verified by electrophoresis on 2% agarose gels, run with a 1 Kb+ DNA ladder (Thermo-Fisher Scientific, Waltham, MA, USA) for 45 min at 90 V. Gels were visualized with a Gel Doc EZ Imager (Bio-Rad, Hercules, CA, USA) to observe ribosomal RNA bands as an indicator of RNA integrity.

2.4.2. Complementary DNA Synthesis by Reverse Transcription

RNA samples were treated with RQ1 RNase-Free DNase (Promega, Madison, WI, USA) and reverse-transcribed using oligo(dT) primers and RevertAid Reverse Transcriptase (Thermo-Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. Each reaction used 1 μg of RNA. The resulting cDNAs were diluted 1:10 and stored at −20 °C.

2.4.3. Selection of Defense-Related Target Genes

Based on the literature, genes involved in abiotic stress responses were selected, including small heat shock proteins (sHSPs) and other heat shock proteins (HSPs): HSP20, HSP23.6, HSP26.5, HSP22, HSP18.2A/B/C, and HSP17.9A/B. Actin 1 and Actin 2 were used as reference genes. Primer sequences and expected amplicon sizes are listed in

Table 3. NCBI reference, gene names, primer sequences, and amplicon sizes of defense-related genes monitored in sunburned fruits.

NCBI Ref	Gene	Forward Primer (5′→3′)	Reverse Primer (5′→3′)	bp
XM_002282480	ACT1	GCCTCCGATTCTCTCTGCTCTC	TCACCATTCCAGTTCCATTGTCAC	158
AF369525	ACT2	TGGATTCTGATGGTGTGAGTC	CAATTTCCCGTTCAGCAGTAGTGG	167
XM_002272382	HSP20	CCTCTGGCAACCCACAAAC	GGTCCATTGCGTCCATCAT	292
XM_002270560	HSP23.6	CCGCCTCCTCTCCTCTCC	TCTTCGCCATCATCGTAGTCG	109
XM_002263340	HSP22	TCTTCGCCATCATCGTAGTCG	GAGCACCCCATTCTCAAGC	192
XM_002280785	HSP18.2A	GAGGTGAAGATAGAGGTGGACG	ACACCGTTCTCCATAGTAGCCT	192
XM_002280644	HSP17.9A	GAAGGAGGAAGTGAAGGTTGAG	AACTTCCCCACCCTCCTCT	177
XM_002281249	HSP18.2B	CGTCAAGGAGTACCCCAATTC	CTCCCTTCCTCAACCTCTACCT	170
XM_002280449	HSP17.9B	CCGTTCCAAGACTTCCCATT	ACACGCCATCTTGACAAACC	230
XM_002281224	HSP18.2C	TTCCTACGCCTTCATCATCG	CTCGGTGCCACTTGTCATTC	235
XM_002267889	HSP26.5	CCATTCCAGGACTTCCCATT	ATCAGTCGGAGTCCATGTATCG	109

Abbreviations: ACT1 = Actin 1; ACT2 = Actin 2; HSP20 = small heat shock protein (sHSP), chloroplastic; HSP23.6 = sHSP, mitochondrial; HSP26.5 = sHSP 26.5 kDa; HSP22 = heat shock protein 22.0 kDa; HSP18.2A/B/C = Class I heat shock proteins, 18.2 kDa; HSP17.9A/B = Class II heat shock proteins, 17.9 kDa. Forward and reverse primer sequences are listed 5′→3′. bp = expected amplicon size in base pairs.

.

2.4.4. Quantitative Real-Time PCR

RT-qPCR was performed on a CFX Connect Real-Time PCR Detection System (Bio-Rad, USA). Each 20 μL reaction contained 1 μL of diluted cDNA, 1 μL of primer mix (forward and reverse, 10 μM each), and SsoFast EvaGreen Supermix (Bio-Rad). Thermal cycling: 95 °C for 3 min (polymerase activation), 40 cycles of 95 °C for 10 s (denaturation), 60 °C for 15 s (annealing), 72 °C for 25 s (extension), followed by melt curve analysis.

PCR products were resolved on 2% agarose gels to confirm a single amplicon of expected size. Negative controls were included in duplicate. Quantification cycle (Cq) values were determined using a baseline threshold of 140 in the exponential phase. Relative quantification used the 2^−ΔΔCq method, normalizing target gene Cq values against Act1 and Act2 [32,33].

2.4.5. Gene Expression Analysis Using the 2^−ΔΔCq Method

ΔCq values were calculated by subtracting reference gene Cq values from target gene Cq values [34]. ΔΔCq values were obtained by subtracting the ΔCq of the control (slight sunburn) from each treatment ΔCq. Fold change was calculated as 2^−ΔΔCq and log₂-transformed for graphical representation [Log₂(2^−ΔΔCq)] to visualize negative values clearly.

2.5. Production and Fruit Quality Determinations

At harvest, fruits from ten trees per treatment were weighed and graded according to size, and quality parameters of production of the marked trees were evaluated. Fruit quality was determined using a random sample of 30 fruits per treatment, corresponding to the predominant sizes (65–70 mm and 70–75 mm). Non-destructive parameters measured included fruit weight, diameter, height, color (CIE Lab*, Minolta CR-400, Konica Minolta, Osaka, Japan), and sunburn incidence, which was classified into four severity levels (slight, moderate, severe, and very severe; Figure 2) based on the degree of surface discoloration and tissue damage.

Diameter was measured with a digital caliper (Calibit, Horticultural Knowledge, Cesena, Italy), while firmness was assessed using a bench penetrometer with an 11 mm probe suitable for apples (PENEFEL, Copa–Informatique SA, Yverdon-les-Bains, Switzerland) and calculated as the average of two measurements per fruit. Soluble solids content (SSC) was expressed in °Brix and determined using a portable digital refractometer (ATAGO PR-100, ATAGO Co., Ltd., Tokyo, Japan).

Starch content was evaluated in twenty fruits per treatment to estimate the state of fruit maturation using the CTIFL scale (Centre Technique Interprofessionnel des Fruits et Légumes, Paris, France), which ranges from 0 (no starch) to 10 (high starch content), based on the intensity of coloration after iodine staining [35]. Values are adimensional, corresponding to this scale. Dry matter was determined in six replicates per treatment, each consisting of five fruit slices (one slice from each fruit). Fresh weight was recorded using an analytical balance (Kern ALJ 160-4AM, max 180 g, precision 0.1 mg; Kern & Sohn GmbH, Ballingen, Germany), and samples were then placed in Petri dishes and oven-dried at 70 °C until two consecutive weight measurements indicated constant dry mass.

2.6. Statistical Analyses

Data were analyzed using RStudio (v. 2021.09.1+372). One-way ANOVA was performed at 95% confidence (p < 0.05), followed by Tukey’s test for mean comparison. When ANOVA assumptions were not met, Kruskal–Wallis test was applied, followed by Dunn’s test with Bonferroni adjustment. In cases of unequal variances, Welch’s ANOVA was applied followed by the Games–Howell post hoc test.

3. Results

3.1. Percentage of Particle Films Coverage

The percentage of fruit surface covered by the four particle film treatments is shown in Figure 3. Surround^® provided the highest coverage (53.1 ± 6.42%), indicating a potentially greater protection against sunscald. Vegepron Sun^® presented intermediate coverage (32.9 ± 5.92%), significantly lower than Surround^®. Agrowhite^® and Sunstop^® showed the lowest values (18.2 ± 2.18% and 11.3 ± 2.64%, respectively), with no significant differences between them (p < 0.05).

3.2. Agronomic Parameters

Fruit number, production per tree, productivity, average fruit weight, TCSA, and normalized production were assessed across all treatments (

Table 4. Fruit number, tree production, productivity, average fruit weight, TCSA, and normalized production across treatments (2 × 5 trees). No significant differences by Tukey’s test; p ≤ 0.05.

Treatments	Average Number of Fruits per Tree	Production (kg per Tree)	Productivity (t/ha)	Average Weight per Fruit (kg)	TCSA (cm2)	Normalized Production (kg cm−2 of TCSA)
C	144.80 ± 9.70	18.88 ± 2.22	35.00 ± 4.11	0.129 ± 0.007	30.24 ± 2.63	0.62 ± 0.04
SS	126.80 ± 22.72	16.85 ± 3.99	31.20 ± 7.39	0.130 ± 0.008	31.99 ± 3.32	0.50 ± 0.06
EK	110.80 ± 16.17	14.25 ± 1.92	26.40 ± 3.56	0.130 ± 0.004	28.86 ± 1.36	0.50 ± 0.07
FF	142.40 ± 9.29	19.59 ± 0.91	36.30 ± 1.69	0.139 ± 0.006	26.36 ± 1.92	0.75 ± 0.04
SD	142.00 ± 2.01	16.47 ± 2.01	30.50 ± 3.73	0.118 ± 0.005	30.86 ± 3.68	0.54 ± 0.06
AW	168.00 ± 18.55	21.65 ± 2.81	40.10 ± 5.21	0.128 ± 0.004	32.53 ± 2.02	0.66 ± 0.07
WR	152.60 ± 16.65	21.80 ± 2.70	40.40 ± 4.99	0.142 ± 0.007	33.98 ± 2.67	0.66 ± 0.10
VS	153.40 ± 20.97	18.98 ± 1.54	35.20 ± 2.86	0.128 ± 0.007	31.19 ± 2.83	0.61 ± 0.03

Legend: C = Control; EK = Eckosil^®; FF = Foliar Fertilizers; WR = Water Reinforcement; SD = Surround^®; AW = Agrowhite^®; VS = Vegepron Sun^®; SS = Sunstop^®.

). The average number of fruits per tree ranged from 110.8 ± 16.2 in EK to 168.0 ± 18.6 in AW. Production per tree varied from 14.25 ± 1.92 kg in EK to 21.80 ± 2.70 kg in WR, while productivity per hectare ranged between 26.40 ± 3.56 t/ha in EK and 40.4 ± 4.99 t/ha in WR. Average fruit weight was lowest in SD (0.118 ± 0.005 kg) and highest in WR (0.142 ± 0.007 kg). TCSA values ranged from 26.36 ± 1.92 cm² in FF to 33.98 ± 2.67 cm² in WR, showing relatively minor variation across treatments. Normalized production (kg cm⁻² TCSA) also showed minor variation, with the highest values in FF (0.75 ± 0.04) and the lowest in SS and EK (0.50 ± 0.06–0.07). No statistically significant differences were observed among treatments (p < 0.05).

Table 5. Quality analyzes of the 30 fruits harvested by method with a size of 65–75 mm. Different letters in the column indicate significantly different values (Dry Matter and Firmness by Tukey’s test; remaining significant cases by Kruskal–Wallis test followed by Dunn’s post hoc test; p ≤ 0.05).

Treatments	SSC (°Brix)	Firmness (kg cm−2)	Starch	°Hue	Dry Matter (%)
C	13.20 ± 0.17 ab	7.78 ± 0.14 ab	6.75 ± 0.54 a	55.19 ± 16.40 a	15.83 ± 0.07 bc
SS	13.36 ± 0.19 ab	7.60 ± 0.12 ab	5.92 ± 0.56 ab	42.45 ± 11.56 b	15.93 ± 0.09 bc
EK	13.82 ± 0.24 ab	7.59 ± 0.11 ab	5.67 ± 0.66 ab	55.88 ± 23.69 ab	16.30 ± 0.27 ab
FF	14.01 ± 0.17 a	7.65 ± 0.09 ab	6.00 ± 0.59 ab	43.59 ± 12.40 b	16.84 ± 0.10 a
SD	12.83 ± 0.18 b	8.02 ± 0.11 a	4.75 ± 0.45 b	62.02 ± 16.59 a	15.43 ± 0.17 c
AW	13.64 ± 0.20 ab	7.35 ± 0.12 b	5.67 ± 0.79 ab	43.62 ± 15.66 b	16.32 ± 0.22 ab
WR	13.14 ± 0.19 ab	7.34 ± 0.09 b	6.58 ± 0.56 a	47.52 ± 15.92 b	15.63 ± 0.23 c
VS	13.25 ± 0.15 ab	7.39 ± 0.12 b	5.42 ± 0.78 ab	51.74 ± 16.14 ab	16.20 ± 0.18 ab

Legend: EK = Eckosil^®, FF = Foliar Fertilizers (Fitoalgas Green = FG, Aton Az = AA, MKP = MKP, MAP = MAP, Calfinish = CF, Folur = FL, 15-05-30 = NPK, Borexpert = BX, Radikal = RD, Fortan = FT, Stimulus = ST), Particle Films: SS = Sunstop^®, SD = Surround^®, AW = Agrowhite^®, VS = Vegepron Sun^®.

presents the quality analyzes of the fruits harvested. Regarding qualitative production parameters, the SSC, expressed in °Brix, was within acceptable limits (≥12%) for all treatments [36]. FF showed the highest SSC (14.01 °Brix), while SD had the lowest value among treatments (12.83 °Brix). WR presented an intermediate SSC value (13.14 °Brix).

Concerning fruit firmness, all treatments presented values within the optimal range (7.0–8.0 kg cm⁻²) at harvest [36]. SD recorded the highest mean firmness (8.02 kg cm⁻²), whereas WR (7.34 kg cm⁻²), AW (7.35 kg cm⁻²), and VS (7.39 kg cm⁻²) showed slightly lower values.

Regarding starch content, SD fruits presented the lowest values (4.75), indicating a tendency toward lower maturity, while C (6.75) and WR (6.58) showed higher starch values, suggesting more advanced maturity.

Regarding colorimetric parameters, fruits from SD and VS treatments exhibited higher °Hue values (62.02 and 51.74, respectively), indicative of a lower intensity of red pigmentation. Conversely, SS, AW, and FF fruits showed lower °Hue values, suggesting a tendency toward more intense red coloration.

For dry matter, FF displayed the highest content (16.84%), whereas SS (15.93%), C (15.83%), WR (15.63%), and SD (15.43%) had comparatively lower values.

In relation to sunburn incidence and its distribution across severity levels, no statistically significant differences were detected among treatments. The highest overall incidence was observed in EK (5.19%), followed by SS (3.91%), whereas SD (0.69%) and VS (2.31%) exhibited the lowest levels (Figure 4).

Across all treatments, slight sunburn was the most prevalent category, representing the majority of affected fruits. Moderate sunburn occurred at lower frequencies, with values ranging from 0.00% (SD) to 1.21% (FF). Severe and very severe sunburn were rare, never exceeding 0.79% in any treatment. C treatment displayed the highest proportion of severe sunburn (0.79%), while SS recorded the highest proportion of very severe sunburn (0.75%). Notably, SD treatment had no cases of moderate or severe sunburn, and only 0.28% of fruits were classified as very severe.

3.3. Physiological Parameters

Regarding the physiological behavior of plants under different treatments, significant differences in A_n were observed primarily during morning measurements. Notably, the FF treatment exhibited higher A_n values on 27 July (16.28 ± 3.19) compared with the other treatments, which may reflect a positive effect of the nutritional strategy applied.

In the final assessment, conducted under the highest recorded air temperature (27 °C) on 13 August, the FF, WR, C, and SS treatments presented the highest A_n values (16.60, 16.55, 16.42, and 16.31 µmol m⁻² s⁻¹, respectively), significantly exceeding the values recorded for VS (13.19 µmol m⁻² s⁻¹).

Overall, the SD and VS treatments, corresponding to two of the particle film applications, consistently exhibited lower A_n throughout the measurement period. The remaining particle film treatments did not display similar reductions, possibly due to lower canopy coverage allowing for better light interception (

Table 6. A_n under different treatments on three morning sampling dates. Different letters within the same date indicate significant differences between treatments (on 13 August determined by the Kruskal–Wallis test followed by Dunn’s post hoc test; on the remaining significant dates by Tukey’s test; p ≤ 0.05).

Treatments	An (µmol m−2 s−1)
	1 July	27 July	13 August
C	12.49 ± 0.78 ab	14.58 ± 2.25 ab	16.42 ± 1.84 a
SS	11.61 ± 1.04 ab	13.80 ± 2.10 ab	16.31 ± 1.89 a
EK	11.10 ± 0.33 b	14.12 ± 2.64 ab	15.47 ± 3.16 ab
FF	12.06 ± 0.76 ab	16.28 ± 3.19 a	16.60 ± 1.65 a
SD	11.83 ± 1.43 ab	12.76 ± 2.13 b	13.94 ± 2.77 ab
AW	11.94 ± 1.83 ab	12.41 ± 2.94 b	15.53 ± 2.83 ab
WR	13.45 ± 1.27 a	14.14 ± 3.10 ab	16.55 ± 1.87 a
VS	11.26 ± 0.74 b	12.28 ± 3.51 b	13.19 ± 2.54 b

Legend: C = Control; EK = Eckosil^®; FF = Foliar Fertilizers; WR = Water Reinforcement; SD = Surround^®; AW = Agrowhite^®; VS = Vegepron Sun^®; SS = Sunstop^®.

).

Regarding chlorophyll fluorescence parameters, a general increase in the maximum efficiency of PSII in dark-adapted leaves (Fv/Fm) was observed throughout the measurement period (Figure 5a). In contrast, the maximum efficiency of PSII in light-adapted leaves (F′v/F′m) tended to increase in most treatments, except for SD and VS, which showed relatively stable values (Figure 5b).

On 1 July, Fv/Fm values were generally lower (ranging from 0.73 ± 0.04 in SD to 0.79 ± 0.03 in FF), indicating higher stress at the beginning of the measurement season. By 13 August, Fv/Fm values had increased in all treatments (0.85 ± 0.01 to 0.86 ± 0.01), approaching the optimal range (≥0.83) [37], which suggests a recovery of photosynthetic performance and reduced stress over time.

Regarding fruit temperature, all particle film treatments tended to reduce the surface temperature of outer fruits compared with the control. SD and VS appeared to more consistently maintain fruit surface temperatures below 50 °C on the hottest days. At 30 °C (Figure 6c), SD (47.74 ± 1.87 °C) and WR (47.88 ± 2.65 °C) showed the lowest outer fruit temperatures, with SD presenting the smallest difference between outer and inner fruit temperatures (Δ = 10.76 °C), suggesting a tendency for lower heat accumulation in the fruit tissue.

At lower ambient temperatures of 23 °C and 25 °C (Figure 6a,b), all treatments showed smaller differences between outer and inner fruit temperatures, whereas at ≈35 °C (Figure 6d), SD and VS maintained fruit surface temperatures below the approximate critical threshold of 50 °C (48.18 ± 1.63 °C and 48.44 ± 0.88 °C, respectively), while the control slightly exceeded it (50.30 ± 3.48 °C).

Considering that thermal damage to epidermal cells occurs at approximately 52 °C [5], these results suggest that SD and VS may have provided relatively more effective protection against heat stress, potentially reducing the risk of sunburn. The remaining treatments exhibited higher variability (standard deviations up to 3 °C) and occasionally approached or exceeded 50 °C.

Regarding SLA, which is directly related to the maximum photosynthetic rate, lower SLA values indicate thicker leaves and greater assimilate availability per unit area. All treatments followed a similar trend throughout the crop cycle, with slightly lower SLA values in the second half of the season (Figure 7).

When comparing the mean values from the second half of the cycle, the SD (108.82 ± 14.58 cm² g⁻¹) and VS (108.62 ± 16.68 cm² g⁻¹) treatments exhibited the highest SLA values, corresponding to thinner leaves. This response may be associated with lower photosynthetic activity during this period, leading to a morphological adjustment similar to that observed in shade leaves, which have greater surface area per unit weight.

From the assessment of leaf chlorophyll content, results were consistent with the SLA trends, showing a general decrease between July and August (Figure 8a). On the first date, the highest chlorophyll values were recorded in C (1.026 µmol g⁻¹ FW), SD (0.995 µmol g⁻¹ FW), VS (0.983 µmol g⁻¹ FW), and AW (0.944 µmol g⁻¹ FW). Notably, particle film treatments with greater fruit coverage (SD and VS) exhibited chlorophyll levels comparable to shade leaves, which typically increase pigment content to compensate for lower light availability. Treatments WR and EK presented more stable Chl a and Chl b values throughout the season, possibly reflecting the specific formulations applied. SS and VS also showed smaller reductions compared to other treatments, despite starting from higher levels.

Significant differences were also observed for carotenoid and anthocyanin concentrations (Figure 8b,c). Carotenoid levels increased between July and August only in SS, EK, WR, and VS, with WR exhibiting the greatest increment (+0.254). In contrast, anthocyanin content increased only in C, AW, and VS, whereas FF showed the largest reduction (−0.819). By August 17, EK, AW, WR, and VS presented significantly higher anthocyanin concentrations compared to SS and FF, suggesting an enhanced photoprotective response in these treatments.

Regarding the chlorophyll a/chlorophyll b ratio, a general increase was observed across treatments (Figure 8d), with significant differences detected only in August. The highest values were found in AW (2.99 ± 0.05), SD (2.95 ± 0.09), and C (2.94 ± 0.15), indicating a shift toward higher Chl a content, which is typical under conditions of increased light stress.

Finally, the total chlorophyll-to-carotenoid ratio (Chl t/Car) decreased between July and August across all treatments (Figure 8e). On both dates, SS, EK, FF, and WR exhibited significantly higher Chl t/Car ratios than C, AW, and VS, indicating a relatively higher investment in photosynthetic pigments compared to photoprotective pigments in these treatments.

Analyzing the antioxidant concentrations in the leaves (Figure 9a), the SD treatment tended to show the highest reduction in ascorbic acid (50.1 ± 36.96%), which may suggest that plants under this treatment experienced comparatively lower oxidative stress, possibly due to protection provided by the particle film. The lowest ascorbate reductions in leaves were observed for EK (20.7 ± 24.0%) and VS (20.8 ± 23.7%), indicating a potential trend toward higher stress levels relative to SD. Glutathione contents in leaves decreased towards the end of the cycle in all treatments, likely reflecting phenological stage and source–sink relationships rather than stress.

In the epidermis (Figure 9b), all particle film treatments exhibited higher percentages of ascorbate reduction compared with the control (28.1 ± 44.6%), suggesting enhanced protective effects. The highest reductions were observed in VS (59.2 ± 49.0%) and AW (53.5 ± 39.9%), while EK showed the lowest reduction (11.1 ± 17.6%), potentially reflecting greater exposure to stress. Glutathione reductions in the epidermis remained relatively stable across treatments (≈67–78%), supporting the view that ascorbate was the main compound responding to oxidative stress.

In the pulp (Figure 9c), FF (23.0 ± 35.8%) and WR (24.0 ± 39.1%) showed the highest ascorbate reductions, whereas AW exhibited almost no reduction (0.8 ± 1.9%). This may indicate that particle film applications influenced ascorbic acid dynamics in fruits, with lower reduction percentages reflecting possible lower stress exposure. Glutathione contents in the pulp were consistently high (≈73–85%), reinforcing the idea that glutathione primarily acted in sulfur mobilization rather than oxidative stress response.

Regarding small heat shock protein (sHSP) expression, differences among sunburn severity levels were mainly observed for HSP26A and HSP22. HSP26A increased at the Severe level (Moderate: –0.77; Severe: 3.82; Very Severe: 1.63), while HSP22 reached the highest expression at the Very Severe level (Moderate: 5.906; Severe: 8.73; Very Severe: 9.74) (Figure 10). Other sHSPs (HSP26.5, HSP23.6, HSP18.2A/B/C, HSP17.9A/B, HSP17, HSP22.7) showed either minor or inconsistent changes across severity levels. These results suggest that only specific sHSPs respond markedly to increased sunburn stress, highlighting targeted protective mechanisms in apple fruits.

4. Discussion

4.1. Agronomic Aspects

TCSA was assessed as an agronomic parameter. The WR treatment exhibited the highest TCSA and greatest yield, suggesting that thicker-trunked trees had higher vegetative growth potential and, consequently, greater productivity. Nevertheless, no statistically significant differences were detected in TCSA, indicating that the trees were balanced and homogeneous. When yields were normalized by TCSA, FF clearly stood out, producing more per cm² of trunk cross-section. WR and AW were the most productive treatments; however, only WR and FF produced larger-sized fruits. Treatments SD, AW, and VS, corresponding to three of the four particle films protectants, were the only ones producing fruits with lower average weights compared with the control. Similar findings have been reported, where Surround^® application reduced fruit size, possibly due to increased reflected light, causing greater shading of leaves and fruits [38,39]. By contrast, WR not only increased yields but also produced heavier, larger fruits.

All treatments achieved SSC above the acceptable threshold (≥12%) according to the Technical Standards for Integrated Pome Fruit Production [36]. FF produced fruits with the highest °Brix, significantly higher than SD and WR. The lower °Brix in WR may reflect a dilution effect due to higher plant water availability. Among the particle films treatments, only SD and VS produced fruits with lower °Brix than the control, likely because their high coverage limited light interception and photoassimilate synthesis. Other studies reported no differences in SSC for Surround^® treated fruits [16,39,40].

Fruit firmness was within the optimal range (7.0–8.0 kg cm⁻²) for all treatments [36]. Although SD was expected to produce firmer fruits, higher firmness in other treatments may reflect a delayed harvest, enhancing starch degradation and °Brix accumulation.

Regarding fruit color, SD and VS produced fruits with less red pigmentation, while SS, AW, and FF showed lower °Hue values, indicating stronger red pigmentation. Reduced red coloration in kaolin-treated fruits, particularly Surround WP, has been previously reported [38,39]. SS and AW not only produced redder fruits than the control but were comparable to FF. This may be related to their lower coverage rates, which, while less effective against sunburn, yielded fruits with better market acceptance.

Dry matter trends mirrored °Brix results, with FF producing the highest DM, suggesting that well-nourished plants accumulate more compounds, such as fibers and sugars. These results were aligned with [18]. The influence of plant nutrition in fruit quality is also highlighted by Figueiredo et al. [41].

Except for SS, particle films treatments substantially reduced sunburn incidence, with SD being the most effective. However, no significant differences among treatments were detected. From June to August, only four days recorded temperatures above 30 °C, compared with the 1991–2020 climatological average of 15.6 days [42], making 2021 atypical for sunburn development. Nevertheless, some treatment trends were observed. Sunburn incidence in particle films-treated fruits was inversely proportional to fruit coverage: higher coverage led to lower incidence. FF and WR slightly reduced sunburn compared with the control and shifted severity distribution, reducing moderate to severe symptoms.

4.2. Plant Physiological Analyses

Analysis of plant physiological responses revealed significant differences in A_n. FF exhibited increased photosynthesis earlier than other treatments, likely due to its nutritional strategy. In contrast, SD and VS, corresponding to two particle film treatments, showed lower photosynthetic rates across measurement dates, probably due to their higher fruit coverage. These results align with previous studies reporting reduced photosynthesis in apple trees treated with kaolin-based products under mild stress conditions [16], attributed to shading caused by increased light reflection [10,16,18]. Conversely, Glenn et al. observed enhanced canopy photosynthesis under high air temperatures [43].

Chlorophyll fluorescence measurements indicated a general increase in the maximum efficiency of PSII in dark-adapted leaves (Fv/Fm) over the study period. Similarly, PSII efficiency in light-adapted leaves (F′v/F′m) increased in most treatments except SD and VS. Higher Fv/Fm values later in the season suggest reduced stress over time. Overall, all treatments remained within optimal ranges, indicating limited physiological stress.

Fruit temperature measurements showed that particle film treatments uniformly reduced fruit surface temperatures compared with the untreated control. SD and VS consistently maintained surface temperatures below 50 °C under ambient conditions of 30–35 °C. As thermal degradation of epidermal cells occurs at ~52 °C [6], these treatments provided higher protection. Schrader et al. [6] reported that dark scald occurs when fruit surface temperatures reach 46–49 °C. Internal fruit temperatures at ambient 35 °C were higher for AW and SD (41.2 and 39.9 °C), yet all treatments remained within safe limits, highlighting SD’s effectiveness.

SLA trends indicated thinner leaves in SD and VS, resembling shade leaves, consistent with higher coverage. Chlorophyll content measurements supported this pattern: SD, AW, and VS showed higher chlorophyll levels, compensating for reduced light availability. Chlorophyll a/b ratio increased later in the season, likely due to denser canopy and shading in August compared with July.

High solar radiation increases carotenoid content while decreasing chlorophyll [44,45]. SS, EK, WR, and VS appeared more stressed, showing increased carotenoids. Plants exposed to heat and high radiation often respond by increasing anthocyanin production, which can enhance stress tolerance [46]. In this study, all treatments, except C, AW, and VS, showed decreased anthocyanin levels, suggesting that most treatments contributed to improved thermal stress tolerance compared with the control.

The total chlorophyll/carotenoids ratio (Chl t/Car) indicates stress level: lower ratios reflect greater chlorophyll degradation and carotenoid production. SD, AW, and VS showed the least reduction, suggesting better protection against thermal stress.

Antioxidant analysis revealed that SD had the largest reduction in leaf ascorbic acid, suggesting lower stress response due to treatment protection, effects also confirmed with other orchard sunburn technologies, such as net coverings [47]. Glutathione declined toward the season’s end, reflecting phenological changes and sulfur re-mobilization. In fruits, particle film treatments increased ascorbate retention, particularly in AW and VS, indicating stress mitigation.

4.3. Expression of HSPs

Heat shock protein expression is a well-established response to thermal stress [48]. Small heat shock proteins play structural roles in maintaining cellular membrane integrity and typically return to basal levels after stress cessation [49].

HSP23.6, localized in mitochondria, deviated from the typical sHSP upregulation pattern. In Triticum durum and Vitis vinifera, transcript levels of mitochondrial HSPs, including HSP23.6, were directly associated with thermotolerance [50,51].

While the HSP20 family is generally strongly up-regulated under both abiotic and biotic stress [52], our observation of the weak up-regulation of HSP17.9 in response to sunburn was unexpected may reflect gene-specific regulation, tissue-specific expression, temporal dynamics, or saturation of the stress response pathways, as commonly observed for other sHSPs under stress conditions.

HSP26.5, also mitochondrial [53,54], showed consistently high expression across all sunburn severity levels, suggesting a specific response to sunburn. Similarly, HSP22, a member of the HSP26 subfamily, exhibited a typical stress-induced expression pattern across sunburn levels.

It is worth noting that some genes, such as HSP22 and HSP18.2C, displayed apparently high variation among treatments but did not show statistically significant differences. This lack of significance is likely due to the high variability among replicates relative to the mean differences between sunburn severity levels. Such patterns are not uncommon in stress-response genes and may reflect intrinsic variability in gene expression, gene-specific regulatory mechanisms, or limited statistical power due to sample size. Therefore, while trends in expression can be observed, caution is needed when interpreting these differences.

5. Conclusions

Protecting crops from abiotic stress is crucial for high-quality production and consumer satisfaction. Climate largely determines agricultural productivity, and global warming is expected to increase extreme events [55]. Although 2021 was atypical, with conditions less favorable to fruit sunburn [42], some treatment-dependent trends were still observed under the Mediterranean climate of this study.

Acquiring prior knowledge of regional climate and crop-specific cultural characteristics is crucial before implementing any preventive measures. The present study demonstrates that, as expected, the greater the percentage of coverage provided by particle film treatments, the higher the protection of fruits against extreme temperatures and radiation. Notably, some treatments simultaneously produced fruits of similar or superior quality compared to untreated controls.

Within the conditions and climatic anomaly of the 2021 season, Agrowhite^® showed a favorable balance between sunburn reduction and fruit quality; however, results should be validated across multiple seasons and sites before general recommendations can be made.

Overall, these findings provide valuable guidance for integrating targeted agronomic and physiological strategies in apple orchards, contributing to sustainable production and improved resilience under climate change.

Future research should focus on validating these treatments across multiple seasons and diverse climatic conditions to confirm their effectiveness. Further studies are also needed to explore the underlying physiological mechanisms, optimize application timing and dosage, and assess long-term impacts on orchard sustainability and fruit quality. Additionally, evaluating the economic feasibility of each treatment, including cost–benefit analyses and cost comparison among treatments, will be crucial for practical adoption by farmers. Such insights will support the development of robust, climate-resilient, and economically sustainable strategies for apple production.