Using Recombinase-Aid Amplification Combined with Pyrococcus furiosus Argonaute for Rapid Sex Identification in Flamingo (Phoenicopteridae)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. DNA Extraction and Conventional PCR
2.3. Design and Selection of RAA Primer
2.4. Design of ssDNA, gDNA, and Probe
2.5. Optimization of RAA Reaction Conditions
2.6. gDNA Selection
2.7. Establishment of RAA- PfAgo Assay
2.8. Evaluation of the RAA-PfAgo Assay for Sex Identification
2.9. Sex Identification Using RAA-PfAgo Assay for Field Test
3. Results
3.1. Mechanism of RAA-PfAgo Detection System
3.2. RAA Primer Selection
3.3. Optimization of RAA Conditions
3.4. gDNA Selection Result
3.5. RAA-PfAgo Assay Result
3.6. Optimization of RAA-PfAgo Assay
3.7. Sensitivity and Specificity of RAA-PfAgo Assay
3.8. Field Sample Test of RAA-PfAgo Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McDonald, H.G.; Steadman, D.W. Fossil Flamingo (Phoenicopteriformes) from the Miocene (Hemingfordian) of Southern California, USA. Hist. Biol. 2022, 35, 1574–1582. [Google Scholar] [CrossRef]
- Miller, A.H. The fossil flamingos of Australia. Condor 1963, 65, 289–299. [Google Scholar] [CrossRef]
- Frias-Soler, R.C.; Bauer, A.; Grohme, M.A.; Espinosa López, G.; Gutiérrez Costa, M.; Llanes-Quevedo, A.; Van Slobbe, F.; Frohme, M.; Wink, M. Phylogeny of the order Phoenicopteriformes and population genetics of the Caribbean flamingo (Phoenicopterus ruber: Aves). Zool. J. Linn. Soc. 2022, 196, 1485–1504. [Google Scholar] [CrossRef]
- Torres, C.R.; Ogawa, L.M.; Gillingham, M.A.F.; Ferrari, B.; van Tuinen, M. A multi-locus inference of the evolutionary diversification of extant flamingos (Phoenicopteridae). BMC Evol. Biol. 2014, 14, 36. [Google Scholar] [CrossRef]
- Javed, S.; ElAlQamy, H.; Khan, S.B.; Ahmed, S.; Al Dhaheri, S.S.; Al Hammadi, A.; Al Hammadi, E. Using greater flamingo tracking and count data in delineating marine protected areas in the coastal zone of Abu Dhabi, United Arab Emirates: Conservation planning in an economically important area. Glob. Ecol. Conserv. 2019, 17, e00557. [Google Scholar] [CrossRef]
- Wijesundara, C.; Wanniarachchi, S.; Hettiarachchi, T.; Galappaththi, S.; Weerawardhana, A.; Rajkumar, P. Population size and movements of the Greater Flamingo (Phoenicopterus roseus) in the Jaffna peninsula, Sri Lanka: Results from a long-term study. Ceylon J. Sci. 2018, 47, 373–378. [Google Scholar] [CrossRef]
- Krienitz, L.; Mähnert, B.; Schagerl, M. Lesser Flamingo as a central element of the East African avifauna. In Soda Lakes of East Africa; Springer: Cham, Switzerland, 2016; pp. 259–284. [Google Scholar]
- Delfino, H.C.; Carlos, C.J. Still standing on one leg: A systematic review of threats, priorities, and conservation perspectives for flamingos (Phoenicopteridae). Biodivers. Conserv. 2024, 33, 1227–1268. [Google Scholar] [CrossRef]
- Timyan, J.; Bonifassi, A.-I.; Exantus, J.-M. Census of the American Flamingo Phoenicopterus ruber (Phoenicopteriformes: Phoenicopteridae) in Haiti. Novit. Caribaea 2024, 24, 1–10. [Google Scholar] [CrossRef]
- Kumar, A.; Rana, S. Population and conservation threats to the Greater Flamingos Phoenicopterus roseus (Aves: Phoenicopteriformes: Phoenicopteridae) at Basai Wetland and Najafgarh Jheel Bird Sanctuary, Haryana, India. J. Threat. Taxa 2021, 13, 18894–18898. [Google Scholar] [CrossRef]
- Delfino, H.C.; Carlos, C.J. What do we know about flamingo behaviors? A systematic review of the ethological research on the Phoenicopteridae (1978–2020). Acta Ethologica 2021, 25, 1–14. [Google Scholar] [CrossRef]
- Yang, S.; Francis, R.J.; Holding, M.; Kingsford, R.T. Aerial photography and machine learning for estimating extremely high flamingo numbers on the Makgadikgadi Pans, Botswana. Glob. Ecol. Conserv. 2024, 53, e03011. [Google Scholar] [CrossRef]
- Mooney, A.; Teare, J.A.; Staerk, J.; Smeele, S.Q.; Rose, P.; Edell, R.H.; King, C.E.; Conrad, L.; Buckley, Y.M. Flock size and structure influence reproductive success in four species of flamingo in 540 captive populations worldwide. Zoo Biol 2023, 42, 343–356. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.W.; Hou, H.Y.; Hsieh, H.I.; Jang-Liaw, N.H. Sex identification of birds in Taipei Zoo. Zoo Biol. 2024, 43, 268–275. [Google Scholar] [CrossRef]
- Machkour, M.; Rabet, S.; Torres-Cristiani, L.; Calmé, S.; Espinoza Medinilla, E.E.; Rodríguez Aguirre, C.; Lara Martínez, G.; Escalona-Segura, G. Sex identification and sex ratio of the American flamingo Phoenicopterus ruber using molecular techniques: Importance for management in zoological collections. J. Zoo Aquar. Res. 2024, 12, 16–22. [Google Scholar]
- Li, H.; Hu, Y.; Song, C.; Ji, G.; Liu, H.; Xu, W.; Ding, J. A New Primer for Sex Identification of Ducks and a Minimally Invasive Technique for Sampling of Allantoic Fluid to Detect Sex during Bird Embryo Development. Sex Dev. 2015, 9, 173–181. [Google Scholar] [CrossRef] [PubMed]
- Griffiths, R.; Daan, S.; Dijkstra, C. Sex identification in birds using two CHD genes. Proc. R. Soc. London. Ser. B Biol. Sci. 1996, 263, 1251–1256. [Google Scholar]
- Lee, J.C.-I.; Tsai, L.-C.; Hwa, P.-Y.; Chan, C.-L.; Huang, A.; Chin, S.-C.; Wang, L.-C.; Lin, J.-T.; Linacre, A.; Hsieh, H.-M. A novel strategy for avian species and gender identification using the CHD gene. Mol. Cell. Probes 2010, 24, 27–31. [Google Scholar] [CrossRef] [PubMed]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Hu, L.; Ying, L.; Zhao, Z.; Chu, P.K.; Yu, X.-F. A CRISPR–Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection. Nat. Commun. 2018, 9, 5012. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Liu, Y.; Zhang, Q.; Tang, X.; Man, S.; Ye, S.; Ma, L. An Argonaute-mediated bio-barcode bioassay for one-tube and on-site detection of Staphylococcus aureus. Sens. Actuators B Chem. 2024, 410, 135713. [Google Scholar] [CrossRef]
- Pang, F.; Zhang, T.; Dai, F.; Wang, K.; Jiao, T.; Zhang, Z.; Zhang, L.; Liu, M.; Hu, P.; Song, J. A handheld isothermal fluorescence detector for duplex visualization of aquatic pathogens via enhanced one-pot LAMP-PfAgo assay. Biosens. Bioelectron. 2024, 254, 116187. [Google Scholar] [CrossRef]
- Wang, L.; He, R.; Lv, B.; Yu, X.; Liu, Y.; Yang, J.; Li, W.; Wang, Y.; Zhang, H.; Yan, G. Pyrococcus furiosus Argonaute coupled with modified ligase chain reaction for detection of SARS-CoV-2 and HPV. Talanta 2021, 227, 122154. [Google Scholar] [CrossRef]
- Fridolfsson, A.-K.; Ellegren, H. A simple and universal method for molecular sexing of non-ratite birds. J. Avian Biol. 1999, 30, 116–121. [Google Scholar] [CrossRef]
- Gutierrez, J.S.; Moore, J.N.; Donnelly, J.P.; Dorador, C.; Navedo, J.G.; Senner, N.R. Climate change and lithium mining influence flamingo abundance in the Lithium Triangle. Proc. Biol. Sci. 2022, 289, 20212388. [Google Scholar] [CrossRef]
- Lihepanyama, D.L.; Ndakidemi, P.A.; Marwa, J.J.; Treydte, A.C. Human activities affecting lesser flamingo (Phoeniconaias minor) habitat in Momella lakes, Tanzania. J. Land Use Sci. 2024, 19, 97–120. [Google Scholar] [CrossRef]
- Conde, D.A.; Colchero, F.; Gusset, M.; Pearce-Kelly, P.; Byers, O.; Flesness, N.; Browne, R.K.; Jones, O.R. Zoos through the Lens of the IUCN Red List: A Global Metapopulation Approach to Support Conservation Breeding Programs. PLoS ONE 2013, 8, e80311. [Google Scholar] [CrossRef] [PubMed]
- Montalti, D.; Graña Grilli, M.; Maragliano, R.E.; Cassini, G. The reliability of morphometric discriminant functions in determining the sex of Chilean Flamingos Phoenicopterus chilensis. Curr. Zool. 2012, 58, 851–855. [Google Scholar] [CrossRef]
- Griffiths, R.; Double, M.C.; Orr, K.; Dawson, R.J. A DNA test to sex most birds. Mol. Ecol. 1998, 7, 1071–1075. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Choi, J.S.; Sharma, N.; Ko, Y.G.; Do, Y.J.; Byun, M.; Seong, H.H.; Park, S.B.; Jeong, D.K. A novel approach for determination of chicken sexing at an early stage of development by using loop-mediated isothermal amplification method. Turk. J. Vet. Anim. Sci. 2015, 39, 583–588. [Google Scholar] [CrossRef]
- Koch, H.R.; Blohm-Sievers, E.; Liedvogel, M. Rapid sex determination of a wild passerine species using loop-mediated isothermal amplification (LAMP). Ecol. Evol. 2019, 9, 5849–5858. [Google Scholar] [CrossRef]
- Lai, F.-Y.; Chang, K.-C.; Chang, C.-S.; Wang, P.-H. Development of a rapid sex identification method for newborn pigeons using recombinase polymerase amplification and a lateral-flow dipstick on farm. Animals 2022, 12, 2969. [Google Scholar] [CrossRef]
- Wang, Z.-H.; Zhang, W.; Zhang, X.-Z.; Yao, X.-R.; Huang, W.; Jia, H.; Liu, X.-L.; Hou, S.-H.; Wang, X.-J. Development of a real-time recombinase-aided amplification (RT-RAA) molecular diagnosis assay for sensitive and rapid detection of Toxoplasma gondii. Vet. Parasitol. 2021, 298, 109489. [Google Scholar] [CrossRef]
- Wu, K.; Zhang, Y.; Zeng, S.; Liu, X.; Li, Y.; Li, X.; Chen, W.; Li, Z.; Qin, Y.; Chen, J.; et al. Development and Application of RAA Nucleic Acid Test Strip Assay and Double RAA Gel Electrophoresis Detection Methods for ASFV and CSFV. Front. Mol. Biosci. 2021, 8, 811824. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Fan, J.; Li, Z.; Zhang, Y.; Qin, Y.; Wu, K.; Li, X.; Li, Y.; Fan, S.; Zhao, M. Development of Recombinase Aided Amplification Combined with Disposable Nucleic Acid Test Strip for Rapid Detection of Porcine Circovirus Type 2. Front. Vet. Sci. 2021, 8, 676294. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Mao, S.; Wang, L.; Fu, S.; Dong, Y.; Jaffrezic-Renault, N.; Guo, Z. CRISPR/Cas and Argonaute-Based Biosensors for Pathogen Detection. ACS Sens. 2023, 8, 3623–3642. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Yin, K.; Li, Z.; Lalla, R.V.; Ballesteros, E.; Sfeir, M.M.; Liu, C. Ultrasensitive and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay. Nat. Commun. 2020, 11, 4711. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.-Y.; Feng, X.-Y.; Zhang, J.-X.; Yang, T.-D.; Zhan, M.-X.; Zeng, Y.-M.; Huang, W.-Y.; Lian, H.-B.; Ke, L.; Cai, S.-S. RT-RPA-Pf Ago detection platform for one-tube simultaneous typing diagnosis of human respiratory syncytial virus. Front. Cell. Infect. Microbiol. 2024, 14, 1419949. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Luo, Q.; Li, L.; Zheng, Y.; Wei, H.; Liao, J.; Liu, Y.; Liu, M.; Wang, Z.; Lin, W. Recombinase polymerase amplification combined with Pyrococcus furiosus Argonaute for fast Salmonella spp. testing in food safety. Int. J. Food Microbiol. 2024, 417, 110697. [Google Scholar] [CrossRef]
- Lisitskaya, L.; Shin, Y.; Agapov, A.; Olina, A.; Kropocheva, E.; Ryazansky, S.; Aravin, A.A.; Esyunina, D.; Murakami, K.S.; Kulbachinskiy, A. Programmable RNA targeting by bacterial Argonaute nucleases with unconventional guide binding and cleavage specificity. Nat. Commun. 2022, 13, 4624. [Google Scholar] [CrossRef] [PubMed]
- Nussenzweig, P.M.; Marraffini, L.A. Molecular mechanisms of CRISPR-Cas immunity in bacteria. Annu. Rev. Genet. 2020, 54, 93–120. [Google Scholar] [CrossRef] [PubMed]
- Swarts, D.C.; Hegge, J.W.; Hinojo, I.; Shiimori, M.; Ellis, M.A.; Dumrongkulraksa, J.; Terns, R.M.; Terns, M.P.; van der Oost, J. Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA. Nucleic Acids Res 2015, 43, 5120–5129. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zhang, Y.; Wu, W.; Kang, T.; Sun, J.; Jiang, H. Rapid and sensitive detection of Mycoplasma synoviae using RPA combined with Pyrococcus furiosus Argonaute. Poult. Sci. 2024, 103, 103244. [Google Scholar] [CrossRef]
- Yu, Z.; Shi, D.; Dong, Y.; Shao, Y.; Chen, Z.; Cheng, F.; Zhang, Y.; Wang, Z.; Tu, J.; Song, X. Pyrococcus furiosus argonaute combined with loop-mediated isothermal amplification for rapid, ultrasensitive, and visual detection of fowl adenovirus serotype 4. Poult. Sci. 2024, 103, 103729. [Google Scholar] [CrossRef]
- Wang, F.; Yang, J.; He, R.; Yu, X.; Chen, S.; Liu, Y.; Wang, L.; Li, A.; Liu, L.; Zhai, C. PfAgo-based detection of SARS-CoV-2. Biosens. Bioelectron. 2021, 177, 112932. [Google Scholar] [CrossRef]
- He, R.; Wang, L.; Wang, F.; Li, W.; Liu, Y.; Li, A.; Wang, Y.; Mao, W.; Zhai, C.; Ma, L. Pyrococcus furiosus Argonaute-mediated nucleic acid detection. Chem. Commun. 2019, 55, 13219–13222. [Google Scholar] [CrossRef] [PubMed]
- Faux, C.E.; McInnes, J.C.; Jarman, S.N. High-throughput real-time PCR and melt curve analysis for sexing Southern Ocean seabirds using fecal samples. Theriogenology 2014, 81, 870–874. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequences (5′–3′) | Fragment Size (bp) |
---|---|---|
2550F | GTTACTGATTCGTCTACGAGA | 500 and 700 |
2718R | ATTGAAATGATCCAGTGCTTG | |
W1 | GAAGTGTTACATTACTCTTATTTCCCTCCC | 161 |
CAGTGCTTGTTTCCTCAATTCCCCTTTTAT | ||
W2 | GAAGTGTTACATTACTCTTATTTCCCTCCC | 151 |
TTCCTCAATTCCCCTTTTATTGATCCGTCA | ||
W3 | AAGAATTTTGCTGGTAGTAACCAAGAAGCC | 206 |
CAATTGGGGAGGGAAATAAGAGTAATGTAA | ||
W4 | AGTTTCCCTTTCAGGTAAGAATTTTGCTGG | 338 |
TTCCTCAATTCCCCTTTTATTGATCCGTCA |
Name | Sequences (5′–3′) |
---|---|
ssDNA | GAAGTGTTACATTACTCTTATTTCCCTCCCCAATTGTTTTGGCAATTGAG AATTCCAGTTGCTCCGATTAGAATATAGTAGGAGTTCCTTTTTAACTGTA TTATTCAATCTCTTTAGAGACTTGACGGATCAATAAAAGGGGAATTGAG GAAACAAGCACTG |
g-1 | GGAACTCCTACTATAT |
g-2 | AACTCCTACTATATTC |
g-3 | CTCCTACTATATTCTA |
g-4 | CCTACTATATTCTAAT |
g-5 | TACTATATTCTAATCG |
g-6 | CTATATTCTAATCGGA |
g-7 | ATATTCTAATCGGAGC |
Probe | FAM-TAAAAAGGAACTCCTACTATATTCTAAT-BHQ1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tan, S.; Zeng, F.; Zhong, W.; Chen, T.; Chen, X.; Li, L.; Wei, H.; Zhang, S. Using Recombinase-Aid Amplification Combined with Pyrococcus furiosus Argonaute for Rapid Sex Identification in Flamingo (Phoenicopteridae). Animals 2025, 15, 7. https://doi.org/10.3390/ani15010007
Tan S, Zeng F, Zhong W, Chen T, Chen X, Li L, Wei H, Zhang S. Using Recombinase-Aid Amplification Combined with Pyrococcus furiosus Argonaute for Rapid Sex Identification in Flamingo (Phoenicopteridae). Animals. 2025; 15(1):7. https://doi.org/10.3390/ani15010007
Chicago/Turabian StyleTan, Shenluan, Fanwen Zeng, Wanhuan Zhong, Tanzipeng Chen, Xuanjiao Chen, Li Li, Hengxi Wei, and Shouquan Zhang. 2025. "Using Recombinase-Aid Amplification Combined with Pyrococcus furiosus Argonaute for Rapid Sex Identification in Flamingo (Phoenicopteridae)" Animals 15, no. 1: 7. https://doi.org/10.3390/ani15010007
APA StyleTan, S., Zeng, F., Zhong, W., Chen, T., Chen, X., Li, L., Wei, H., & Zhang, S. (2025). Using Recombinase-Aid Amplification Combined with Pyrococcus furiosus Argonaute for Rapid Sex Identification in Flamingo (Phoenicopteridae). Animals, 15(1), 7. https://doi.org/10.3390/ani15010007