The Dietary Inclusion of Ensiled Olive Cake Increases Unsaturated Lipids in Milk and Alters the Expression of Lipogenic Genes in Mammary and Adipose Tissue in Goats
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Management, and Experimental Diets
2.2. Measurements, Sampling, and Analysis
2.3. Tissue Sampling for Expression Analysis
2.4. Applied Molecular Techniques
2.5. Statistical Analysis
3. Results
3.1. Fatty Acid Profile of OC Silage and Experimental Diets
3.2. Milk Yield and Composition
3.3. Milk’s Fatty Acid Composition
3.4. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chilliard, Y.; Ferlay, A.; Mansbridge, R.; Doreau, M. Ruminant milk fat plasticity: Nutritional control of saturated, polyunsaturated, trans and conjugated fatty acids. Ann. Zootech. 2000, 49, 181–205. [Google Scholar] [CrossRef]
- Chilliard, Y.; Ferlay, A.; Rouel, J.; Lamberet, G. A Review of Nutritional and Physiological Factors Affecting Goat Milk Lipid Synthesis and Lipolysis. J. Dairy Sci. 2003, 86, 1751–1770. [Google Scholar] [CrossRef] [PubMed]
- Ferlay, A.; Bernard, L.; Meynadier, A.; Malpuech-Brugère, C. Production of trans and conjugated fatty acids in dairy ruminants and their putative effects on human health: A review. Biochimie 2017, 141, 107–120. [Google Scholar] [CrossRef] [PubMed]
- Tzamaloukas, O.; Neofytou, M.C.; Simitzis, P.E. Application of Olive By-Products in Livestock with Emphasis on Small Ruminants: Implications on Rumen Function, Growth Performance, Milk and Meat Quality. Animals 2021, 11, 531. [Google Scholar] [PubMed]
- Symeou, S.; Tsiafoulis, C.G.; Gerothanassis, I.P.; Miltiadou, D.; Tzamaloukas, O. Nuclear magnetic resonance screening of changes in fatty acid and cholesterol content of ovine milk induced by ensiled olive cake inclusion in Chios sheep diets. Small Rumin. Res. 2019, 177, 111–116. [Google Scholar] [CrossRef]
- Symeou, S.; Miltiadou, D.; Constantinou, C.; Papademas, P.; Tzamaloukas, O. Feeding olive cake silage up to 20 percent of DM intake in sheep improves lipids quality and health related indices of milk and ovine Halloumi cheese. Trop. Anim. Health Prod. 2021, 53, 229. [Google Scholar] [CrossRef]
- Neofytou, M.C.; Miltiadou, D.; Sfakianaki, E.; Constantinou, C.; Symeou, S.; Sparaggis, D.; Hager-Theodorides, A.L.; Tzamaloukas, O. The use of ensiled olive cake in the diets of Friesian cows increases beneficial fatty acids in milk and Halloumi cheese and alters the expression of SREBF1 in adipose tissue. J. Dairy Sci. 2020, 103, 8998–9011. [Google Scholar] [CrossRef] [PubMed]
- Abbeddou, S.; Rischkowsky, B.; Hilali, M.E.D.; Hess, H.D.; Kreuzer, M. Influence of feeding Mediterranean food industry by-products and forages to Awassi sheep on physicochemical properties of milk, yoghurt and cheese. J. Dairy Res. 2011, 78, 426–435. [Google Scholar] [CrossRef]
- Abbeddou, S.; Rischkowsky, B.; Richter, E.K.; Hess, H.D.; Kreuzer, M. Modification of milk fatty acid composition by feeding forages and agro-industrial byproducts from dry areas to Awassi sheep. J. Dairy Sci. 2011, 94, 4657–4668. [Google Scholar] [CrossRef]
- Abbeddou, S.; Rischkowsky, B.; Hilali, M.E.D.; Haylani, M.; Hess, H.D.; Kreuzer, M. Supplementing diets of Awassi ewes with olive cake and tomato pomace: On-farm recovery of effects on yield, composition and fatty acid profile of the milk. Trop. Anim. Health Prod. 2015, 47, 145–152. [Google Scholar] [CrossRef]
- Chiofalo, B.; Liotta, L.; Zumbo, A.; Chiofalo, V. Administration of olive cake for ewe feeding: Effect on milk yield and composition. Small Rumin. Res. 2004, 55, 169–176. [Google Scholar] [CrossRef]
- Castellani, F.; Vitali, A.; Bernardi, N.; Marone, E.; Palazzo, F.; Grotta, L.; Martino, G. Dietary supplementation with dried olive pomace in dairy cows modifies the composition of fatty acids and the aromatic profile in milk and related cheese. J. Dairy Sci. 2017, 100, 8658–8669. [Google Scholar] [CrossRef] [PubMed]
- Molina-Alcaide, E.; Morales-García, E.Y.; Martín-García, A.I.; Ben Salem, H.; Nefzaoui, A.; Sanz-Sampelayo, M.R. Effects of partial replacement of concentrate with feed blocks on nutrient utilization, microbial N flow, and milk yield and composition in goats. J. Dairy Sci. 2010, 93, 2076–2087. [Google Scholar] [CrossRef] [PubMed]
- Arco-Pérez, A.; Ramos-Morales, E.; Yáñez-Ruiz, D.R.; Abecia, L.; Martín-García, A.I. Nutritive evaluation and milk quality of including of tomato or olive by-products silages with sunflower oil in the diet of dairy goats. Anim. Feed Sci. Technol. 2017, 232, 57–70. [Google Scholar] [CrossRef]
- Marcos, C.N.; Carro, M.D.; Fernández Yepes, J.E.; Haro, A.; Romero-Huelva, M.; Molina-Alcaide, E. Effects of agroindustrial by-product supplementation on dairy goat milk characteristics, nutrient utilization, ruminal fermentation, and methane production. J. Dairy Sci. 2020, 103, 1472–1483. [Google Scholar] [CrossRef] [PubMed]
- Anderson, J.L.; Schingoethe, D.J.; Kalscheur, K.F.; Hippen, A.R. Evaluation of Dried and Wet Distillers Grains Included at Two Concentrations in the Diets of Lactating Dairy Cows. J. Dairy Sci. 2006, 89, 3133–3142. [Google Scholar] [CrossRef] [PubMed]
- Neofytou, M.C.; Michael, C.; Constantinou, C.; Sparaggis, D.; Tzamaloukas, O. Feeding wheat dried distillers’ grains with solubles increases conjugated linoleic acid and unsaturated lipids in ovine milk without adversely affecting milk yield. J. Dairy Res. 2021, 88, 128–133. [Google Scholar] [CrossRef]
- Mannelli, F.; Cappucci, A.; Pini, F.; Pastorelli, R.; Decorosi, F.; Giovannetti, L.; Mele, M.; Minieri, S.; Conte, G.; Pauselli, M.; et al. Effect of different types of olive oil pomace dietary supplementation on the rumen microbial community profile in Comisana ewes. Sci. Rep. 2018, 8, 8455. [Google Scholar] [CrossRef]
- García-Rodríguez, J.; Mateos, I.; Saro, C.; González, J.S.; Carro, M.D.; Ranilla, M.J. Replacing forage by crude olive cake in a dairy sheep diet: Effects on ruminal fermentation and microbial populations in rusitec fermenters. Animals 2020, 10, 2235. [Google Scholar] [CrossRef]
- Shingfield, K.J.; Bernard, L.; Leroux, C.; Chilliard, Y. Role of trans fatty acids in the nutritional regulation of mammary lipogenesis in ruminants. Animal 2010, 4, 1140–1166. [Google Scholar] [CrossRef]
- Shingfield, K.J.; Bonnet, M.; Scollan, N.D. Recent developments in altering the fatty acid composition of ruminant-derived foods. Animal 2013, 7, 132–162. [Google Scholar] [CrossRef] [PubMed]
- Bauman, D.E.; Harvatine, K.J.; Lock, A.L. Nutrigenomics, Rumen-Derived Bioactive Fatty Acids, and the Regulation of Milk Fat Synthesis. Annu. Rev. Nutr. 2011, 31, 299–319. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Bonnet, M.; Delavaud, C.; Delosière, M.; Ferlay, A.; Fougère, H.; Graulet, B. Milk Fat Globule in Ruminant: Major and Minor Compounds, Nutritional Regulation and Differences Among Species. Eur. J. Lipid Sci. Technol. 2018, 120, 1700039. [Google Scholar] [CrossRef]
- Fougère, H.; Bernard, L. Effect of diets supplemented with starch and corn oil, marine algae, or hydrogenated palm oil on mammary lipogenic gene expression in cows and goats: A comparative study. J. Dairy Sci. 2019, 102, 768–779. [Google Scholar] [CrossRef] [PubMed]
- Animal Welfare Law—The Law for the Protection, Health and Welfare of Animals of 1994 Republic of Cyprus; Council of Ministers: Nicosia, Cyprus, 1994; Volume 46, pp. 1–14.
- European Union. Directive, 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the Protection of Animals Used for Scientific Purposes. Off. J. Eur. Union 2010, L 276/33, 65–68. [Google Scholar]
- NRC. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids; National Academy Press: Washington, DC, USA, 2007. [Google Scholar]
- AOAC. Official Methods of Analysis of AOAC International, 18th ed.; AOAC International: Rockville, MD, USA, 2005. [Google Scholar]
- Van-Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [PubMed]
- ISO 5509: 2000; Animal and Vegetable Fats and Oils—Preparation of Methyl Esters of Fatty Acids. ISO (International Organization for Standardization): Geneva, Switzerland, 2002.
- Ulbricht, T.; Southgate, D. Coronary heart disease: Seven dietary factors. Lancet 1991, 338, 985–992. [Google Scholar] [CrossRef] [PubMed]
- Garnsworthy, P.C.; Feng, S.; Lock, A.L.; Royal, M.D. Short communication: Heritability of milk fatty acid composition and stearoyl-CoA desaturase indices in dairy cows. J. Dairy Sci. 2010, 93, 1743–1748. [Google Scholar] [CrossRef]
- Mavrogenis, A.P.; Papachristoforou, C. Estimation of the energy value of milk and prediction of fat-corrected milk yield in sheep and goats. Small Rumin. Res. 1988, 1, 229–236. [Google Scholar] [CrossRef]
- Miltiadou, D.; Hager-Theodorides, A.L.; Symeou, S.; Constantinou, C.; Psifidi, A.; Banos, G.; Tzamaloukas, O. Variants in the 3′ untranslated region of the ovine acetyl-coenzyme A acyltransferase 2 gene are associated with dairy traits and exhibit differential allelic expression. J. Dairy Sci. 2017, 100, 6285–6297. [Google Scholar] [CrossRef]
- Bionaz, M.; Loor, J.J. Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle. Physiol. Genom. 2007, 29, 312–319. [Google Scholar] [CrossRef] [PubMed]
- Hadjipanayiotou, M. Feeding ensiled crude olive cake to lactating Chios ewes, Damascus goats and Friesian cows. Livest. Prod. Sci. 1999, 59, 61–66. [Google Scholar] [CrossRef]
- Cabiddu, A.; Canu, M.; Decandia, M.; Pompei, R.; Molle, G. The intake and performance of dairy ewes fed with different levels of olive cake silage in late pregnancy and suckling periods. In Nutrition and Feeding Strategies of Sheep and Goats under Harsh Climates; Options Méditerranéennes, Série A—Séminaires Méditerranéens, n. 59; Ben Salem, H., Nefzaoui, A., Morand-Fehr, P., Eds.; CIHEAM: Zaragoza, Spain, 2004; Volume 201, pp. 197–201. [Google Scholar]
- Shdaifat, M.M.; Al-barakah, F.S.; Kanan, A.Q.; Obeidat, B.S. The effect of feeding agricultural by-products on performance of lactating Awassi ewes. Small Rumin. Res. 2013, 113, 11–14. [Google Scholar] [CrossRef]
- Meo Zilio, D.; Bartocci, S.; Di Giovanni, S.; Servili, M.; Chiariotti, A.; Terramoccia, S. Evaluation of dried stoned olive pomace as supplementation for lactating Holstein cattle: Effect on milk production and quality. Anim. Prod. Sci. 2014, 55, 185–188. [Google Scholar] [CrossRef]
- Chiofalo, B.; Di Rosa, A.R.; Lo Presti, V.; Chiofalo, V.; Liotta, L. Effect of supplementation of herd diet with olive cake on the composition profile of milk and on the composition, quality and sensory profile of cheeses made therefrom. Animals 2020, 10, 977. [Google Scholar] [CrossRef] [PubMed]
- Jenkins, T.C.; McGuire, M.A. Major advances in nutrition: Impact on milk composition. J. Dairy Sci. 2006, 89, 1302–1310. [Google Scholar] [CrossRef] [PubMed]
- Pallara, G.; Buccioni, A.; Pastorelli, R.; Minieri, S.; Mele, M.; Rapaccini, S.; Messini, A.; Pauselli, M.; Servili, M.; Giovannetti, L.; et al. Effect of stoned olive pomace on rumen microbial communities and polyunsaturated fatty acid biohydrogenation: An in vitro study. BMC Vet. Res. 2014, 10, 271. [Google Scholar] [CrossRef]
- Chilliard, Y.; Glasser, F.; Ferlay, A.; Bernard, L.; Rouel, J.; Doreau, M. Diet, rumen biohydrogenation and nutritional quality of cow and goat milk fat. Eur. J. Lipid Sci. Technol. 2007, 109, 828–855. [Google Scholar] [CrossRef]
- Dorea, J.R.R.; Armentano, L.E. Effects of common dietary fatty acids on milk yield and concentrations of fat and fatty acids in dairy cattle. Anim. Prod. Sci. 2017, 57, 2224–2236. [Google Scholar] [CrossRef]
- Vargas-Bello-Pérez, E.; Vera, R.R.; Aguilar, C.; Lira, R.; Peña, I.; Fernández, J. Feeding olive cake to ewes improves fatty acid profile of milk and cheese. Anim. Feed Sci. Technol. 2013, 184, 94–99. [Google Scholar] [CrossRef]
- Bernard, L.; Toral, P.G.; Chilliard, Y. Comparison of mammary lipid metabolism in dairy cows and goats fed diets supplemented with starch, plant oil, or fish oil. J. Dairy Sci. 2017, 100, 9338–9351. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Leroux, C.; Bonnet, M.; Rouel, J.; Martin, P.; Chilliard, Y. Expression and nutritional regulation of lipogenic genes in mammary gland and adipose tissues of lactating goats. J. Dairy Res. 2005, 72, 250–255. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Leroux, C.; Rouel, J.; Bonnet, M.; Chilliard, Y. Effect of the level and type of starchy concentrate on tissue lipid metabolism, gene expression and milk fatty acid secretion in Alpine goats receiving a diet rich in sunflower-seed oil. Br. J. Nutr. 2012, 107, 1147–1159. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Bonnet, M.; Leroux, C.; Shingfield, K.J.; Chilliard, Y. Effect of sunflower-seed oil and linseed oil on tissue lipid metabolism, gene expression, and milk fatty acid secretion in Alpine goats fed maize silage–based diets. J. Dairy Sci. 2009, 92, 6083–6094. [Google Scholar] [CrossRef] [PubMed]
- Toral, P.G.; Bernard, L.; Delavaud, C.; Gruffat, D.; Leroux, C.; Chilliard, Y. Effects of fish oil and additional starch on tissue fatty acid profile and lipogenic gene mRNA abundance in lactating goats fed a diet containing sunflower-seed oil. Animal 2013, 7, 948–956. [Google Scholar] [CrossRef] [PubMed]
- Castro-Carrera, T.; Frutos, P.; Leroux, C.; Chilliard, Y.; Hervás, G.; Belenguer, A.; Bernard, L.; Toral, P.G. Dietary sunflower oil modulates milk fatty acid composition without major changes in adipose and mammary tissue fatty acid profile or related gene mRNA abundance in sheep. Animal 2015, 9, 582–591. [Google Scholar] [CrossRef] [PubMed]
- Bichi, E.; Frutos, P.; Toral, P.G.; Keisler, D.; Hervás, G.; Loor, J.J. Dietary marine algae and its influence on tissue gene network expression during milk fat depression in dairy ewes. Anim. Feed Sci. Technol. 2013, 186, 36–44. [Google Scholar] [CrossRef][Green Version]
- Bionaz, M.; Loor, J.J. ACSL1, AGPAT6, FABP3, LPIN1, and SLC27A6 are the most abundant isoforms in bovine mammary tissue and their expression is affected by stage of lactation. J. Nutr. 2008, 138, 1019–1024. [Google Scholar] [CrossRef]
- Invernizzi, G.; Thering, B.J.; McGuire, M.A.; Savoini, G.; Loor, J.J. Sustained upregulation of stearoyl-CoA desaturase in bovine mammary tissue with contrasting changes in milk fat synthesis and lipogenic gene networks caused by lipid supplements. Funct. Integr. Genom. 2010, 10, 561–575. [Google Scholar] [CrossRef]
- Shi, H.; Zhu, J.; Luo, J.; Cao, W.; Shi, H.; Yao, D.; Li, J.; Sun, Y.; Xu, H.; Yu, K.; et al. Genes regulating lipid and protein metabolism are highly expressed in mammary gland of lactating dairy goats. Funct. Integr. Genom. 2015, 15, 309–321. [Google Scholar] [CrossRef]
- Liang, M.Y.; Hou, X.M.; Qu, B.; Zhang, N.; Li, N.; Cui, Y.J.; Li, Q.Z.; Gao, X.J. Functional analysis of FABP3 in the milk fat synthesis signaling pathway of dairy cow mammary epithelial cells. Vitr. Cell. Dev. Biol. Anim. 2014, 50, 865–873. [Google Scholar] [CrossRef] [PubMed]
- Thering, B.J.; Graugnard, D.E.; Piantoni, P.; Loor, J.J. Adipose tissue lipogenic gene networks due to lipid feeding and milk fat depression in lactating cows. J. Dairy Sci. 2009, 92, 4290–4300. [Google Scholar] [CrossRef] [PubMed]
- Vahmani, P.; Glover, K.E.; Fredeen, A.H. Effects of pasture versus confinement and marine oil supplementation on the expression of genes involved in lipid metabolism in mammary, liver, and adipose tissues of lactating dairy cows. J. Dairy Sci. 2014, 97, 4174–4183. [Google Scholar] [CrossRef]
- Harvatine, K.J.; Perfield, J.W.; Bauman, D.E. Expression of Enzymes and Key Regulators of Lipid Synthesis Is Upregulated in Adipose Tissue during CLA-Induced Milk Fat Depression in Dairy Cows. J. Nutr. 2009, 139, 849–854. [Google Scholar] [CrossRef]
- Yanting, C.; Yang, Q.Y.; Ma, G.L.; Du, M.; Harrison, J.H.; Block, E. Dose- and type-dependent effects of long-chain fatty acids on adipogenesis and lipogenesis of bovine adipocytes. J. Dairy Sci. 2018, 101, 1601–1615. [Google Scholar] [CrossRef] [PubMed]
- Ebeling, P.; Koistinen, H.A.; Koivisto, V.A. Insulin-independent glucose transport regulates insulin sensitivity. FEBS Lett. 1998, 436, 301–303. [Google Scholar] [CrossRef]
Treatment | ||||
---|---|---|---|---|
Item | OC0 | OC10 | OC20 | OC Silage |
Ingredient composition, % | ||||
OC | - | 9.7 | 19.8 | |
Alfalfa | 11.1 | 10.9 | 10.3 | |
Barley hay | 17.4 | 12.8 | 8.0 | |
Barley straw | 10.8 | 6.2 | 1.7 | |
Concentrate mix | 60.7 | 60.5 | 60.2 | |
Chemical composition, % DM | ||||
Dry matter, % | 88.60 | 82.96 | 78.98 | 47.74 |
Crude protein, % DM | 15.86 | 15.89 | 15.92 | 5.32 |
Crude fat, % DM | 2.30 | 3.07 | 3.82 | 6.88 |
Crude fiber, % DM | 18.20 | 18.75 | 19.30 | 49.53 |
Ash, % DM | 7.13 | 6.90 | 6.67 | 2.71 |
Ca | 1.00 | 0.99 | 0.98 | - |
P | 0.39 | 0.39 | 0.38 | - |
Na | 0.24 | 0.23 | 0.23 | - |
aNDF, % DM | 37.44 | 37.71 | 38.01 | 71.56 |
ADF, % DM | 22.89 | 23.06 | 23.25 | 54.93 |
Metabolized Energy (MJ/kg)2 | 10.65 | 10.51 | 10.37 | - |
Symbol | Name | Forward (F) and Reverse (R) | Access Number | Amplicon (bp) | R2 | Efficiency (%) |
---|---|---|---|---|---|---|
ACACA | Acetyl-Coa-Carboxylase A | F: ATCATCACCATCAGCCTGGTTA R: AGGTGTATACTTCCCTCCCGA | XM_018064168.1 | 154 | 0.992 | 93 |
FASN | Fatty Acid Synthase | F: CTCCATCCTCGCTCTCCTTC R: CATATAGTCCCGCCTTCCACC | NM_001285629.1 | 200 | 0.997 | 87 |
G6PDH | Glucose 6 Phosphate Dehydrogenase | F: CTTCCATCAGGCCGATACGC R: GGGTAGCTTTGAAGAAGGGCTC | XM_018044339.1 | 200 | 0.997 | 94 |
VLDLR | Very-Low-Density Lipoprotein Receptor | F: CTGCTGTGGAAATGCGATGG R: TCTCATATGGCACTGTTCTGGG | XM_018052033.1 | 192 | 0.993 | 89 |
LPL | Lipoprotein Lipase | F: CAACAAGGTCAGAGCCAAAAGA R: ACTTCAGGCAGGGTAAAAGGG | NM_001285607.1 | 198 | 0.998 | 88 |
SLC2A1 | Solute Carrier Family 2 Member1 | F: GTCGTGTCGCTGTTTGTGG R: GCCTGGACCCACTTCGAAAA | NM_001314223.1 | 189 | 0.991 | 90 |
FAT/CD36 | Fatty Acid Translocase | F: ATTGACACATACAAAGGCAGAAAGAAT R: AGCTCCGAACACAGCATAGAT | XM_018046617.1 | 176 | 0.998 | 99 |
FABP3 | Fatty Acid Binding Protein | F: CGAGTTCGATGAGACCACGG R: CATGGGTGAGTGTCAGAATGAGT | NM_001285701.1 | 155 | 0.993 | 99 |
PPARγ | Peroxisome Proliferator Activated Receptor γ | F: AAGCGTCAGGGTTCCACTATG R: CCGAACCTGATGGCGTTATGA | NM_001285658.1 | 199 | 0.997 | 96 |
SCD1 | Stearoyl-Coa Desaturase | F: ACATTGATCCCCACCTGCAA R: TCAAAAACGTCATTCTGGAACGC | NM_001285619.1 | 185 | 0.998 | 94 |
Housekeeping genes | ||||||
UXT | Ubiquitously Expressed Transcript | F: CGTAAGAGCAATCTCCTCACAGA R: TGTAGCTCTCTAAGCCCCTCTA | XM_005700842.2 | 104 | 0.997 | 96 |
RPS9 | Ribosomal Protein S9 | F: AAGCTGATCGGCGAGTACG R: TTCATCTTGCCCTCGTCCAG | XM_018063497.1 | 191 | 0.998 | 98 |
RPS15 | Ribosomal Protein S15 | F: GCATTGAGACCCCGCGATAA R: TTCTACTTCCGCCATCTTGCC | XM_018050438.1 | 171 | 0.990 | 88 |
Item | Treatments | |||||
---|---|---|---|---|---|---|
OC0 | OC10 | OC20 | SEM | p-Value | Ensiled OC | |
C14:0 | 1.19 a | 0.67 b | 0.41 c | 0.14 | ** | - |
C16:0 | 37.29 a | 30.18 b | 29.61 b | 0.79 | ** | 13.45 |
C16:1 cis-9 | 0.35 c | 0.62 b | 0.97 a | 0.05 | ** | 1.48 |
C18:0 | 1.78 c | 2.46 b | 3.54 a | 0.10 | *** | 4.15 |
C18:1 cis-9 | 21.00 b | 34.82 a | 37.00 a | 2.70 | *** | 63.58 |
C18:2n-6 | 25.52 a | 19.97 b | 18.30 c | 0.50 | ** | 13.12 |
C18:3n-3 | 2.42 a | 2.38 b | 2.12 b | 0.15 | * | 1.46 |
Treatment | p-Value 1 | ||||||
---|---|---|---|---|---|---|---|
Item | OC0 | OC10 | OC20 | SEM | D | T | D × T |
DMI (kg/d) | 2.53 | 2.57 | 2.63 | 0.03 | NS | NS | NS |
Milk (kg/d) | 2.72 | 2.79 | 2.83 | 0.10 | NS | NS | NS |
FCM 2 (kg/d) | 2.35 | 2.43 | 2.50 | 0.07 | NS | ** | NS |
Fat (%) | 3.08 c | 3.20 b | 3.30 a | 0.06 | * | *** | NS |
Fat (kg/d) | 0.082 | 0.085 | 0.091 | 0.004 | † | * | NS |
Protein (%) | 3.68 b | 3.74 b | 3.85 a | 0.02 | *** | *** | NS |
Protein (kg/d) | 0.106 | 0.111 | 0.114 | 0.004 | NS | † | NS |
Lactose (%) | 5.33 | 5.61 | 5.48 | 0.10 | NS | NS | NS |
SNF (%) | 9.56 | 10.07 | 10.05 | 0.08 | NS | NS | NS |
Treatment | p-Value 1 | ||||||
---|---|---|---|---|---|---|---|
Item | OC0 | OC10 | OC20 | SEM | D | T | D × T |
C4:0 | 0.80 a | 0.72 b | 0.75 ab | 0.01 | * | ** | † |
C5:0 | 0.12 | 0.15 | 0.13 | 0.001 | NS | NS | NS |
C6:0 | 1.53 a | 1.37 b | 1.45 ab | 0.04 | ** | NS | ** |
C7:0 | 0.36 b | 0.45 a | 0.38 ab | 0.003 | NS | NS | NS |
C8:0 | 2.32 a | 2.13 b | 2.15 b | 0.05 | ** | * | ** |
Octanoic | 0.039 a | 0.037 a | 0.028 b | 0.002 | *** | NS | NS |
C9:0 | 0.097 | 0.117 | 0.096 | 0.007 | † | NS | NS |
C10:0 | 5.79 b | 6.69 a | 5.37 b | 0.28 | ** | ** | * |
C10:1 cis-9 | 0.21 a | 0.16 b | 0.17 b | 0.008 | *** | *** | NS |
C11:0 | 0.15 ab | 0.19 a | 0.14 b | 0.01 | * | NS | † |
C12:0 | 4.09 | 4.06 | 3.76 | 0.12 | † | ** | * |
C12:1 cis-9 | 0.038 | 0.032 | 0.031 | 0.003 | NS | *** | NS |
C13:0 iso | 0.02 | 0.02 | 0.01 | 0.002 | NS | NS | NS |
C13:0 | 0.19 | 0.21 | 0.18 | 0.01 | NS | ** | NS |
C14:0 | 9.00 a | 8.47 b | 8.05 b | 0.15 | *** | *** | *** |
C14:0 iso | 0.07 a | 0.051 b | 0.05 b | 0.003 | *** | NS | * |
C14:1 cis-9 | 0.44 | 0.15 | 0.15 | 0.12 | NS | NS | NS |
C15:0 | 1.24 a | 1.23 a | 1.13 b | 0.03 | * | ** | * |
C15:0 iso | 0.18 a | 0.14 b | 0.13 b | 0.005 | *** | ** | *** |
C15:0 antiso | 0.43 a | 0.36 b | 0.34 b | 0.011 | *** | *** | *** |
C16:0 | 25.39 a | 22.89 b | 22.37 b | 0.38 | *** | † | NS |
C16:0 iso | 0.31 a | 0.26 b | 0.27 b | 0.008 | *** | ** | *** |
C16:1 cis-9 | 0.13 b | 0.15 b | 0.18 a | 0.008 | *** | NS | NS |
C16:1 cis-7 | 0.28 b | 0.27 b | 0.31 a | 0.009 | ** | ** | NS |
C17:0 | 1.07 a | 1.01 b | 0.94 c | 0.02 | *** | *** | *** |
C17:0 iso | 0.54 a | 0.46 b | 0.41 b | 0.01 | *** | ** | *** |
C17:0 antiso | 1.43 | 1.38 | 1.37 | 0.02 | NS | NS | ** |
C17:1 cis-9 | 0.34 | 0.33 | 0.32 | 0.01 | NS | *** | NS |
C18:0 | 10.40 | 10.12 | 10.35 | 0.46 | NS | † | NS |
C18:0 iso | 0.094 | 0.093 | 0.090 | 0.004 | NS | *** | ** |
C18:1 trans-10 | 0.31 b | 0.37 ab | 0.39 a | 0.01 | *** | *** | NS |
C18:1 trans-11 | 4.75 b | 5.70 a | 6.12 a | 0.26 | *** | NS | † |
C18:1 trans-12 | 0.33 c | 0.41 b | 0.68 a | 0.05 | *** | † | NS |
C18:1 cis-9 | 18.48 c | 21.12 b | 23.05 a | 0.49 | *** | NS | NS |
C18:1 cis-11 | 0.71 b | 0.86 a | 0.91 a | 0.02 | *** | † | NS |
C18:1 cis-12 | 0.30 | 0.30 | 0.31 | 0.01 | NS | NS | *** |
C18:1 cis-13 | 0.17 b | 0.21 a | 0.23 a | 0.01 | *** | *** | NS |
C18:1 cis-16 | 0.26 | 0.29 | 0.28 | 0.02 | NS | † | NS |
C18:1 trans-16 | 0.27 | 0.25 | 0.24 | 0.01 | NS | NS | *** |
C18:2 cis-9, trans-13/trans-8, cis-12 | 0.21 | 0.21 | 0.21 | 0.006 | NS | ** | NS |
C18:2 trans-9, cis-13/trans-8, cis-12 | 0.13 | 0.14 | 0.15 | 0.005 | † | ** | NS |
C18:2 trans-11, cis-15 | 0.11 | 0.13 | 0.13 | 0.008 | NS | NS | NS |
C18:2n-6 | 4.58 | 4.59 | 4.69 | 0.18 | NS | † | NS |
C18:3n-6 | 0.04 | 0.04 | 0.04 | 0.002 | NS | ** | NS |
C18:3n-3 | 0.35 | 0.36 | 0.38 | 0.01 | NS | † | NS |
C19:1 cis-9 | 0.043 | 0.043 | 0.042 | 0.003 | NS | *** | NS |
C20:0 | 0.25 b | 0.25 b | 0.27 a | 0.006 | ** | *** | NS |
C21:0 | 0.066 a | 0.055 b | 0.061 ab | 0.002 | *** | ** | ** |
C22:0 | 0.074 | 0.068 | 0.069 | 0.002 | NS | *** | * |
C23:0 | 0.031 | 0.022 | 0.020 | 0.002 | *** | NS | NS |
C24:0 | 0.014 ab | 0.015 a | 0.012 b | 0.001 | ** | NS | NS |
CLA cis-9, trans-11 | 0.41 c | 0.46 b | 0.52 a | 0.01 | *** | † | * |
CLA trans-10, cis-12 | 0.062 | 0.068 | 0.073 | 0.005 | NS | NS | NS |
CLA trans, trans | 0.11 | 0.15 | 0.15 | 0.01 | † | † | NS |
C20:2n-6 | 0.028 | 0.032 | 0.025 | 0.004 | NS | NS | NS |
C20:3n-6 | 0.04 | 0.03 | 0.03 | 0.01 | NS | † | NS |
C20:3n-3 | 0.02 | 0.02 | 0.02 | 0.001 | NS | *** | NS |
C20:4n-6 | 0.26 | 0.24 | 0.24 | 0.009 | NS | *** | NS |
C20:5n-3 | 0.025 a | 0.018 b | 0.016 b | 0.001 | *** | NS | NS |
C22:4n-6 | 0.019 | 0.016 | 0.016 | 0.001 | NS | *** | ** |
C22:5n-6 | 0.043 a | 0.032 b | 0.033 b | 0.001 | *** | *** | † |
C22:5n-3 | 0.055 a | 0.046 ab | 0.042 b | 0.002 | ** | *** | NS |
SCFA 2 | 10.93 | 11.09 | 10.22 | 0.30 | NS | † | * |
MCFA 3 | 41.49 a | 38.30 b | 36.99 b | 0.52 | *** | *** | ** |
LCFA 4 | 46.33 c | 49.92 b | 52.39 a | 0.69 | *** | NS | NS |
<C16 | 26.94 a | 26.62 a | 24.73 b | 0.46 | ** | NS | ** |
>C16 | 46.55 b | 50.19 a | 52.40 a | 0.69 | *** | NS | ND |
SFA | 65.51 a | 62.46 b | 59.68 c | 0.69 | *** | NS | NS |
MUFA | 29.92 b | 30.88 ab | 32.98 a | 0.64 | ** | *** | *** |
PUFA | 6.44 | 6.43 | 6.74 | 0.22 | NS | NS | NS |
Atherogenicity index 5 | 1.16 a | 1.03 b | 0.92 b | 0.03 | *** | † | NS |
Desaturation index 6 | 1.76 | 1.72 | 1.85 | 0.07 | NS | *** | NS |
Item | Treatment | SEM | p-Value 1 | ||||
---|---|---|---|---|---|---|---|
OC0 | OC10 | OC20 | D | T | D × T | ||
SCFA 2 | 9.56 ab | 10.50 a | 7.94 b | 0.55 | NS | * | NS |
MCFA 3 | 37.02 a | 35.02 b | 30.11 c | 1.72 | *** | *** | NS |
LCFA 4 | 38.10 b | 42.92 a | 44.44 a | 2.10 | ** | *** | NS |
<C16 | 25.47 a | 24.58 a | 20.52 b | 1.58 | ** | NS | NS |
>C16 | 38.64 c | 41.96 b | 46.83 a | 2.19 | ** | NS | NS |
SFA | 59.52 a | 56.14 b | 50.34 c | 1.69 | ** | ** | NS |
MUFA | 25.81 b | 28.33 ab | 29.24 a | 1.64 | *** | NS | NS |
PUFA | 5.50 | 5.44 | 5.97 | 0.22 | NS | *** | NS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Neofytou, M.C.; Hager-Theodorides, A.-L.; Sfakianaki, E.; Simitzis, P.; Symeou, S.; Sparaggis, D.; Tzamaloukas, O.; Miltiadou, D. The Dietary Inclusion of Ensiled Olive Cake Increases Unsaturated Lipids in Milk and Alters the Expression of Lipogenic Genes in Mammary and Adipose Tissue in Goats. Animals 2023, 13, 3418. https://doi.org/10.3390/ani13213418
Neofytou MC, Hager-Theodorides A-L, Sfakianaki E, Simitzis P, Symeou S, Sparaggis D, Tzamaloukas O, Miltiadou D. The Dietary Inclusion of Ensiled Olive Cake Increases Unsaturated Lipids in Milk and Alters the Expression of Lipogenic Genes in Mammary and Adipose Tissue in Goats. Animals. 2023; 13(21):3418. https://doi.org/10.3390/ani13213418
Chicago/Turabian StyleNeofytou, Marina C., Ariadne-Loukia Hager-Theodorides, Eleni Sfakianaki, Panagiotis Simitzis, Simoni Symeou, Dionysis Sparaggis, Ouranios Tzamaloukas, and Despoina Miltiadou. 2023. "The Dietary Inclusion of Ensiled Olive Cake Increases Unsaturated Lipids in Milk and Alters the Expression of Lipogenic Genes in Mammary and Adipose Tissue in Goats" Animals 13, no. 21: 3418. https://doi.org/10.3390/ani13213418
APA StyleNeofytou, M. C., Hager-Theodorides, A.-L., Sfakianaki, E., Simitzis, P., Symeou, S., Sparaggis, D., Tzamaloukas, O., & Miltiadou, D. (2023). The Dietary Inclusion of Ensiled Olive Cake Increases Unsaturated Lipids in Milk and Alters the Expression of Lipogenic Genes in Mammary and Adipose Tissue in Goats. Animals, 13(21), 3418. https://doi.org/10.3390/ani13213418